Biology Practice Test 4

Biology Practice Test 4 is designed to help students strengthen their understanding of key biological concepts, theories, and processes for competitive entry tests like MDCAT, NUMS, AKU, UET, ECAT, NTS, as well as FSC Board Exams. This test covers topics from human anatomy, physiology, microbiology, and ecology, helping students improve accuracy and retention.

PLS Academy

Get Access to 20 thousands+ MCQs Including Topical MCQs, Practice Tests, Mock Tests, Solved Past Papers, Flashcards, Notes, FLPS, and Much More.

UNLOCK PREMIUM🔐

1244

Created by Ali Durrani

MDCAT Practice Tests

Biology Practice Test 4

This is the Free Access to Limited MCQs. Enroll to PLS Boost Premium Bundle to Get More MCQs HERE

1 / 100

Category: Biology Ch 7 Class 12

Interphase is a phase of the cell cycle defined only by the absence of _______.

NTS 2019
Biology
Cell Cycle
Elimination Tool:

A) Enzymes

B) DNA

C) Replication

D) Cell division

2 / 100

Category: Biology

Q.64 All of the following are the attributes of evolution except:

A. O3 began to filter UV radiations

B. Some organisms began to utilized O2 in the start of evolution

C. Nutrient supply is abundant

D. The reducing atmosphere slowly become oxidizing atmosphere

3 / 100

Category: Biology Ch 4 Class 11

In a typical compound microscope the resolution is 2 μm. Which is about _____ that of naked eye.

NUMS 2019 Reconduct
Biology
Cell Structure and Function
Elimination Tool:

A) 100 x

B) 300 x

C) 400 x

D) 500 x

4 / 100

Category: Biology

Q.39 The fertilization of ovum takes place at:

A. Distal part of the oviduct

B. Proximal part of the oviduct

C. Middle part of the oviduct

D. Anywhere in the oviduct

5 / 100

Category: Biology Ch 2 Class 12

Skeleton of arms and legs is:

NUMS 2018
Biology
Support and Movement
Elimination Tool:

A) Exoskeleton

B) Endoskeleton

C) Axial skeleton

D) Appendicular skeleton

6 / 100

Category: Biology

The structure of a fibrous protein comprises of polypeptide chains in the form of:

NUMS Mock 2
Biology
Biological Molecules

A) Cluster

B) Spherical or curried up ball

C) Long strands or fibrils

D) Flat uncoiled chains

7 / 100

Category: Biology Ch 10 Class 11

Which of the following phyla of Kingdom Animalia do humans belong to?

NTS 2018
Biology
Kingdom Animalia
Elimination Tool:

A) Mollusca

B) Arthropoda

C) Echinodermata

D) Chordata

8 / 100

Category: Biology Ch 5 Class 11

Second major form of hepatitis is:

NUMS 2015
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Hepatitis A

B) Hepatitis B

C) Hepatitis C

D) Hepatitis D

9 / 100

Category: Biology Ch 11 Class 11

Chlorophyll is insoluble in:

Carbon tetrachloride

Alcohol

Organic solvents

Water

10 / 100

Category: Biology Ch 3 Class 12

The prolactin hormone, responsible for the activation of mammary glands to start producing milk, is a hormone of the:

NTS 2010
Biology
Coordination and Control
Elimination Tool:

A) Pituitary gland

B) Pancreas

C) Thyroid gland

D) Thymus gland

11 / 100

Category: Biology Ch 2 Class 11

Most simple amino acid is:

NUMS 2019 Cancelled
Biology
Biological Molecules
Elimination Tool:

A) Alanine

B) Valine

D) Lycine

C) Glycine

12 / 100

Category: Biology Ch 13 Class 11

Gaseous exchange through the skin is known as ______ respiration.

Cuticular

Cutaneous

Skin

Pulmonary

13 / 100

Category: Biology Ch 5 Class 11

Which of the following is not related to the enveloped virus?

PMC 2020
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) They survive for a short time

B) Their envelope is sensitive to sunlight

C) They are tolerant to antibodies

D) Envelope is derived from host

14 / 100

Category: Biology Ch 12 Class 11

In human gut, chylomicrons are formed by the combination of:

NUMS 2020
Biology
Nutrition
Elimination Tool:

A) Proteins and carbohydrates

B) Fats and proteins

C) Fats and carbohydrates

D) Vitamins and fats

15 / 100

Category: Biology Ch 11 Class 11

Immediate source of energy for cellular respiration is:

NUMS 2016
Biology
Bioenergetics
Elimination Tool:

A) Lipids

B) ATP

C) Proteins

D) Carbohydrates

16 / 100

Category: Biology Ch 2 Class 11

Glucose and fructose join together through _____ to form sucrose.

NUMS 2019 Cancelled
Biology
Biological Molecules
Elimination Tool:

A) 1, 4 glycosidic linkage

B) 1, 6 glycosidic linkage

D) 1,3 glycosidic linkage

C) 1,2 glycosidic linkage

17 / 100

Category: Biology Ch 11 Class 11

Which is the correct order of energy transfer from assessory pigments to main photosynthetic pigment?

. Carotenoids ? Chlorophyll a ? Chlorophyll b.

Chlorophyll b ? Carotenoids ? Chlorophyll a.

. Carotenoids ? Chlorophyll b ? Chlorophyll a.

Chlorophyll a ? Chlorophyll b ? Carotenoids.

18 / 100

Category: Biology

Q.29 Fluid secreted by Sertoli cells provides sperms with which of the following ?

A. Liquid medium

B. Protection

C. Nourishment

D. All of these

19 / 100

Category: Biology Ch 4 Class 12

Which of the following is an ovoviviparous animal?

PMC Sample 1
Biology
Reproduction
Elimination Tool:

A) basking shark

B) humans

C) blue shark

D) all of these

20 / 100

Category: Biology Ch 7 Class 12

Gametes in animals are produced by:

PMC 2021 Tested
Biology
Cell Cycle
Elimination Tool:

A) Meiosis

B) Fission

C) Mitosis

D) All three

21 / 100

Category: Biology Ch 11 Class 12

A dual organism composed of symbiotic association of an alga living within a fungus myceliium is

Mycorrhiza

Rhizobium

Lichen

Legume

22 / 100

Category: Biology Ch 1 Class 12

The characteristic which enable animals to tolerate dehydration is called

Osmoconformation

Osmoregulaton

Anhydrobiosis

Anhydrosis

23 / 100

Category: Biology Ch 8 Class 12

Read the passage below to answer the question:

Hemophilia is a disorder in which blood fails to clot. Saad, a male hemophiliac, marries Sara, a normal woman and together they have four children, two boys (Ahmed and Ali) and two girls (Alia and Ayesha). None of the children display the symptoms of Hemophilia. Ahmed, Ali, Ayesha, and Ali all marry normal individuals and have children. None of Ahmeds or Ali’s children, male or female, display symptoms of hemophilia, but the sons of Alia and Ayesha display symptoms of hemophilia while the daughters of Alia and Ayesha do not.

Which of the following individuals are heterozygous for hemophilia:

NTS 2010
Biology
Variation and Genetics
Elimination Tool:

A) Saad, Ahmed, and Ali

B) Ahmed, Ali, Alia, and Ayesha

C) Saad and Sara

D) Alia and Ayesha

24 / 100

Category: Biology

The scientific name of thorn Apple is?

NUMS Mock 2
Biology
Kingdom Plantae

A) Sycopodium phlogmaria

B) Anthocoros fusiform

C) Ginkgo biloba

D) Datura alba

25 / 100

Category: Biology Ch 13 Class 12

Endangered species are

Dangerous for the life of humans

Reduced in number

Already extinct

All of these

26 / 100

Category: Biology Ch 6 Class 11

In many bacteria, the cell wall is enclosed within a slime capsule made up of:

NUMS 2017
Biology
Kingdom Prokaryote
Elimination Tool:

A) Polysaccharides

B) Cellulose

C) Amino acids

D) Proteins

27 / 100

Category: Biology

Transport of glucose across the cell membrane occurs by:

NUMS Mock 1
Biology
Cell Structure and Function

A) Simple diffusion

B) Facilitated diffusion

C) Osmosis

D) Primary active transport

28 / 100

Category: Biology Ch 10 Class 11

Which of the following is a freshwater sponge?

NUMS 2016
Biology
Kingdom Animalia
Elimination Tool:

A) Sycon

B) Leucosolenia

C) Euplectella

D) Spongilla

29 / 100

Category: Biology Ch 7 Class 12

If a person has 44 autosomes + XXY, he will suffer from

UHS 2012
Biology
Cell Cycle
Elimination Tool:

A) Klinefelter’s syndrome

B) Down’s syndrome

C) Turner’s syndrome

D) Edward’s syndrome

30 / 100

Category: Biology

Q.39 Which of the following genetic diseases is caused by mutations in a membrane protein?

A. Alzheimer's disease

B. Parkinson's disease

C. Anemia

D. Hemolytic anemia

31 / 100

Category: Biology Ch 5 Class 12

Apical meristems are located at

Tips of leaves

Tips of flowers

Tips of roots and stems

Tips of roots only

32 / 100

Category: Biology Ch 7 Class 11

The nucleoid is found only in certain species of:

PMC 2021 Tested
Biology
Kingdom Protista
Elimination Tool:

A) Gram positive bacteria

B) Both gram positive and gram negative bacteria

C) Gram negative bacteria

D) All bacteria

33 / 100

Category: Biology Ch 4 Class 12

In human females, oocytes are held in the second metaphase until ________.

NUMS 2019 Reconduct
Biology
Reproduction
Elimination Tool:

A) Death

B) Birth

C) Ovulation

D) Fertilization

34 / 100

Category: Biology Ch 3 Class 12

Which hormone is chemically a steroid?

NUMS 2020
Biology
Coordination and Control
Elimination Tool:

A) ADH

B) Thyroxin

C) Cortisone

D) Insulin

35 / 100

Category: Biology Ch 4 Class 11

Fibers of the extracellular matrix are attached to ______ in the plasma membrane:

NUMS 2020
Biology
Cell Structure and Function
Elimination Tool:

A) Phospholipids

B) Carbohydrates

C) Glycolipids

D) Proteins

36 / 100

Category: Biology Ch 2 Class 11

Antibodies are

NUMS 2019 Cancelled
Biology
Biological Molecules
Elimination Tool:

A) Primary proteins

B) Secondary proteins

C) Tertiary proteins

D) Quaternary proteins

37 / 100

Category: Biology Ch 8 Class 11

A plant disease which is not caused by a fungus is:

NUMS 2015
Biology
Kingdom Fungi
Elimination Tool:

A) Red rot of Sugarcane

B) Late blight of Potato

C) Black rot of crucifers

D) Brown rust of wheat

38 / 100

Category: Biology Ch 7 Class 11

Based on molecular data euglenoids are thought to be closely related to

Dinoflagellates

Zooflagellates

Protozoans

Algae

39 / 100

Category: Biology

Q.28 The enzyme which plays important role in HIV pathogenesis

A. RNA polymerase I

B. DNA polymerase II

C. Reverse Transcriptase I

D. Reverse Transcriptase

40 / 100

Category: Biology Ch 11 Class 11

Which of the following pigment is Blue- green in colour:

Chlorophyll a

. Chlorophyll b

Chlorophyll c

Chlorophyll d.

41 / 100

Category: Biology Ch 3 Class 12

The _____ is the main nutritional part and it’s concerned with the biosynthesis of materials necessary for neurons.

NUMS 2019 Reconduct
Biology
Coordination and Control
Elimination Tool:

A) Nerves

B) Axon

C) Soma

D) Dendrites

42 / 100

Category: Biology Ch 9 Class 12

The technique use of identification of criminals is called:

NTS 2018
Biology
Biotechnology
Elimination Tool:

A) Cloning

B) DNA fingerprinting

C) Restriction Analysis

D) Polymorphism

43 / 100

Category: Biology

Which trait is not sex-linked recessive:

NUMS Mock 2
Biology
Variation and Genetics

A) Haemophilia

B) Colour blindness

C) Hypophosphatemia

D) TFM syndrome

44 / 100

Category: Biology Ch 9 Class 11

Chlorophyta is considered to be closest to plants but do not resemble plants in having:

NUMS 2020
Biology
Kingdom Plantae
Elimination Tool:

A) Chlorophyll a and b

B) Starch as stored food

C) Cellulose cell wall

D) Multicellular sex organs

45 / 100

Category: Biology

Which was the first virus to be successfully crystalized?

NUMS Mock 1
Biology
Bio-diversity | Variety of Life

A) TMV

B) Smallpox

C) Poliovirus

D) Adenovirus

46 / 100

Category: Biology Ch 1 Class 12

The only possible treatment in end stage renal failure is:

NUMS 2018
Biology
Homeostasis
Elimination Tool:

A) Hemodialysis

B) Peritoneal dialysis

C) Lithotripsy

D) Kidney transplantation

47 / 100

Category: Biology Ch 2 Class 11

Which one is an organic compound?

CO2

Water

Lipids

HCI

48 / 100

Category: Biology Ch 14 Class 11

Regarding structure of the human heart, Chordae Tendinae are present in:

PMC 2020
Biology
Transport
Elimination Tool:

A) Atria

B) Pulmonary valve

D) Aortic valve

C) Ventricles

49 / 100

Category: Biology Ch 12 Class 12

Coniferous forests located at high altitude are called

Taiga

Alpine

Boreal

Arctic

50 / 100

Category: Biology Ch 10 Class 12

This theory says that “mitochondria and chloroplasts are, in effect, ancient bacteria which now live inside the larger cells”:

PMC 2020
Biology
Evolution
Elimination Tool:

A) Darwin’s theory of evolution

B) Lamarckism

C) Neo – darwinism

D) Endosymbiont theory

51 / 100

Category: Biology Ch 2 Class 11

5 different amino acids, numbered 1, 2, 3, 4, and 5, below from the following sequence in the path of a polypeptide chain:

1-2-3-4-2-5-3

Messenger RNA codon, which correspond to the amino acids, are:
amino acid 1 UGU

amino acid 2 GAU

amino acid 3 CAC

amino acid 4 UAG

amino acid 5 AAG

Which one of the following DNA bases sequences could provide the code for the given section of the polypeptide?

NTS 2015 DUHS and JSMU
Biology
Biological Molecules
Elimination Tool:

A) ACACTTGTGATGCTATTCGTG

B) ACACUAGUGAUGCUAUUCGUG

C) ACACTAGTGATGCTAAACGTG

D) ACACTAGTGATCCTATTCGTG

52 / 100

Category: Biology Ch 4 Class 12

Which statement is incorrect?

In short day plants red light prevents flowering

Henbane is a short day plant

In long day plants for red light promotes flowering

Leaf unrolling occurs in grasses

53 / 100

Category: Biology Ch 10 Class 12

Which statement is incorrect?

Homologous organs are functionally different but structurally alike

Analogous organs are functionally different but structurally alike

Examples of homologous structures are arms of man, forelimb of cat, flipper of whale

Examples of analogous structures are wings of bats, birds and insects

54 / 100

Category: Biology

Q.64 Which of the following conditions is not required to be true for a population in Hardy-Veinberg equilibrium?

A. Random mutation

B. Large population

C. No natural selection

D. Random mating

55 / 100

Category: Biology Ch 4 Class 12

Which statement is incorrect?

Climacteric is burst of respiratory activity in fruit ripening

It is associated with ethane production C

It helps in fruit set

It helps in fruit ripening

56 / 100

Category: Biology Ch 2 Class 12

Unpaired facial bones are:

NUMS 2018
Biology
Support and Movement
Elimination Tool:

A) Maxilla, Zygomatic

B) Palatine, Inferior concha

C) Nasal, Lacrimal

D) Mandible, Vomer

57 / 100

Category: Biology Ch 9 Class 12

It is a method for rapid production of a very large number of copies of a particular fragment of DNA:

PMC 2020
Biology
Biotechnology
Elimination Tool:

A) Gel electrophoresis

B) Polymerase chain reaction

C) DNA extraction

D) Recombination

58 / 100

Category: Biology

The dark reactions of photosynthesis are characterized by:

NUMS Mock 1
Biology
Bioenergetics

A) Synthesis of ATP, O2 and NADH

B) Utilization of ATP, CO2 and NADPH

C) Electron transfer from NADPH to RuBP

D) Carbon dioxide transfer from RuBP to glucose

59 / 100

Category: Biology Ch 3 Class 12

Which of the following statement about neuron is incorrect?

They not only conduct impulses but also generate them.

They are not the only cellular component of nervous system.

They may show limited regenerative capabilities.

Like all the living cell, when they mature and divide to form similar cells.

60 / 100

Category: Biology Ch 9 Class 11

Brassica and rosa plant belong to the group of plants:

NUMS 2017
Biology
Kingdom Plantae
Elimination Tool:

A) Hydrophytes

B) Mesophytes

C) Xerophytes

D) Succulent

61 / 100

Category: Biology Ch 3 Class 12

The 1st human hormone produced by recombinant DNA technology was:

NUMS 2016
Biology
Coordination and Control
Elimination Tool:

A) Estrogen

B) Testosterone

C) Cortisone

D) Insulin

62 / 100

Category: Biology Ch 8 Class 11

Lichen is a symbiotic mutualistic association of fungi with

Autotrophs

Roots of vascular plants

Green algae and cyanobacterium

Leguminous plants

63 / 100

Category: Biology

Q.8 Which of the following structure provides greater pathogenicity to the bacteria?

A. slime

B. cell wall

C. cell membrane

D. capsule

64 / 100

Category: Biology Ch 5 Class 11

Five kingdom classification was proposed by :

Carlous Linnaeus

E-Chatton

Robert Whittaker

Lynn Margulis and Karlene Schwartz

65 / 100

Category: Biology Ch 5 Class 12

The fate of each blastomere is foretold. What will that cleavage be?

PMC Sample 2
Biology
Growth and Development
Elimination Tool:

A) Spiral and indeterminate

B) Radial and determinate

C) Radial and indeterminate

D) Spiral and determinate

66 / 100

Category: Biology

Q.2 Prokaryotic and eukaryotic cells generally have which of the following features in common?

A. Cell wall made of cellulose

B. Presence of linear chromosome

C. Presence of ribosomes

D. Presence of nucleus

67 / 100

Category: Biology Ch 10 Class 11

Pseudocoelom is actually derived from:

NUMS 2016
Biology
Kingdom Animalia
Elimination Tool:

A) Blastocoel

B) Gastrocoel

C) Neurocoel

D) Haemocoel

68 / 100

Category: Biology

In chemiosmosis, the proton (H+) moves from _______.

NUMS Mock 4
Biology
Bioenergetics

A) Stroma to Lumen

B) Cytoplasm to Stroma

C) Lumen to Stroma

D) Stroma to cytoplasm

69 / 100

Category: Biology

Hemoglobin carries more oxygen than plasma by:

NUMS Mock 1
Biology
Gaseous Exchange

A) 50 times

B) 20 times

C) 70 times

D) 100 times

70 / 100

Category: Biology Ch 6 Class 12

Who discovered DNA?

P.A.Levene

Frederick Griffith

Friedrich Miescher

Rosalind Franklin

71 / 100

Category: Biology Ch 3 Class 12

The _____ may be a cell, neuron ending or an organ that receives the stimulus.

NUMS 2019 Reconduct
Biology
Coordination and Control
Elimination Tool:

A) Effector

B) Receptor

C) Adopter

D) Stimuli

72 / 100

Category: Biology Ch 5 Class 11

The genome of viruses is composed of

NTS 2019
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) DNA

B) RNA

C) Protien

D) Both A and B

73 / 100

Category: Biology Ch 14 Class 11

Autoimmune diseases act as the principle of:

PMC 2020
Biology
Transport
Elimination Tool:

A) Self against antigens

C) Self against self

B) Antigen against self

D) Antigen self destroyed

74 / 100

Category: Biology Ch 10 Class 12

Which condition can be explained by Lamarckism?

PMC Sample 1
Biology
Evolution
Elimination Tool:

A) How giraffes got their long neck

B) How humans lost their tail

C) How humans became bipedal

D) all of these

75 / 100

Category: Biology Ch 4 Class 11

Who coined the term CELL?

Schwann

Schleiden

Robert Hook

Both a and b

76 / 100

Category: Biology Ch 10 Class 12

Prokaryotes are considered to be evolved

. 3.5 billion years ago

1.5 billion years ago

4.5 billion years ag

1000 million years ago

77 / 100

Category: Biology

Q.33 The researcher notices that round seeds occur maturely in the environment.Based solely on this information, what can there searcher conclude about the round phenotype?

A. It is dominant

B. It is recessive

C. It is wild type

D. Both a and b

78 / 100

Category: Biology Ch 9 Class 12

Protoplasts are plant cells from which

. Cell walls are removed

Nucleus is removed

New organelles are added

Vacuoles are taken out

79 / 100

Category: Biology Ch 10 Class 11

Scales are present in:

NUMS 2015
Biology
Kingdom Animalia
Elimination Tool:

A) Fishes

B) Reptiles

C) Birds

E) A and B

80 / 100

Category: Biology Ch 3 Class 11

Which type of bonds are never formed when a substrate fits into the active site of an enzyme?

PMC Practice 1
Biology
Enzymes
Elimination Tool:

A) Hydrogen bonds

B) Ionic interactions

C) Hydrophobic interactions

D) Covalent linkages

81 / 100

Category: Biology Ch 11 Class 11

At which times there is no net gaseous exchange between leaves and the atmosphere.

Day time.

Night time

Dawn & Dusk

Mid night

82 / 100

Category: Biology Ch 8 Class 11

Ecological role of fungi as decomposers is only paralleled by

Blue green algae

Cyanobacteria

Bacteria

Virus

83 / 100

Category: Biology

Four events in the transmission of nerve impulses across synapses are:

I. depolarisation of the presynaptic membrane

II. propagation of postsynaptic action potential

III. reabsorption of the transmitter substance

IV. release of transmitter substance into the synaptic cleft

In which sequence do these events occur?

FIRST -> LAST

NUMS Mock 4
Biology
Coordination and Control
D) IV, III, I and II

A) I, III, II, and IV

B) I, IV, II and III

C) IV, I, III and II

D) IV, III, I and II

84 / 100

Category: Biology Ch 10 Class 11

The system well – developed in the acoelomate is

Excretory system

Nervous system

Both of these

Transport system

85 / 100

Category: Biology

Which one of the following is a fish?

NUMS Mock 3
Biology
Kingdom Animalia

A) Flying fish

B) Salmon

C) Sea horse

D) All of the above

86 / 100

Category: Biology Ch 10 Class 12

Which scientist does not match his achievements

Lamarck published his theory of evolution

Lyell published principles of geology

Malthus published essay on principle of population

Cuvier published papers on inheritance

87 / 100

Category: Biology Ch 11 Class 11

In the Krebs cycle, substrate-level phosphorylation accompanies the formation of:

NTS 2013
Biology
Bioenergetics
Elimination Tool:

A) Citrate

B) Alpha-ketoglutarate

C) Succinate

D) Fumarate

88 / 100

Category: Biology Ch 7 Class 12

Most critical phase of mitosis is

Prophase

Anaphase

Metaphase

Telophase

89 / 100

Category: Biology Ch 1 Class 11

In animals coordination is achieved by means of

Respiratory system

Nervous system

Endocrine system

Both b and c

90 / 100

Category: Biology Ch 6 Class 12

The combination of XXY (47) chromosomes results in:

NTS 2012
Biology
Chromosomes and DNA
Elimination Tool:

A) Down's Syndrome

B) Turner's Syndrome

C) Klinefelter's Syndrome

D) Sickle cell anemia

91 / 100

Category: Biology Ch 12 Class 11

The disease night blindness is caused by deficiency of vitamin:

NTS 2016 SMBBMC
Biology
Nutrition
Elimination Tool:

A) A

B) B

C) C

D) D

92 / 100

Category: Biology Ch 8 Class 11

Coenocytic hyphae are also known as

Septate

. Perforated hyphae

Aseptate

Uninucleate hyphae

93 / 100

Category: Biology Ch 13 Class 11

In most birds air sacs are _____ in number

94 / 100

Category: Biology

As an excretory organ, liver:

NUMS Mock 3
Biology
Homeostasis

A) Detoxifies many chemical poisons

B) Produces ammonia for excretion by the kidneys

C) Produces urea and uric acids from the nitrogen of amino acids

D) All of the above

95 / 100

Category: Biology Ch 1 Class 11

A structure formed by groups of similar cells organized into loose sheetsor bundles performing similar functions is called as:

An organ

An organism

A Tissue

A Cell

96 / 100

Category: Biology Ch 9 Class 11

Which of the following is an ovoviviparous organism?

PMC Sample 3
Biology
Kingdom Plantae
Elimination Tool:

A) reptiles

B) mammals

C) frog

D) Duckbill platypus

97 / 100

Category: Biology

Q.41 The period during which a girl sexually matures is called

A. Menstrual cycle

B. Puberty

C. Childhood

D. Teens

98 / 100

Category: Biology Ch 6 Class 12

Chromosome is made of

2 chromatids +1 centromere +secondary constriction

1 chromated + 1 centromere + primary constriction

2 chromatids + 1 centromere + primary constriction

2 chromatids + 2 centromere + secondary constriction

99 / 100

Category: Biology Ch 9 Class 12

Cloning is a form of:

NUMS 2016
Biology
Biotechnology
Elimination Tool:

A) Parthenogenesis

B) Apomixis

C) Sexual reproduction

D) Asexual reproduction

100 / 100

Category: Biology Ch 10 Class 12

The genetic change in a population caused by natural selection is called?

PMC Sample 1
Biology
Evolution
Elimination Tool:

A) polymorphism

B) specialization

C) gene linkage

D) adaptation

Your score is

The average score is 61%

Structured Practice for Best Entry Test Preparation

This topic-wise and chapter-wise practice test allows students to focus on individual biology concepts, including diagrams, processes, and conceptual questions. Regular practice enhances understanding, sharpens problem-solving skills, and builds confidence to tackle both board and competitive exam questions efficiently.

Free Resources for Best Entry Test Preparation

Students can access free Biology Practice Test 4 to systematically improve knowledge, recall, and problem-solving abilities. This test is suitable for FSC Board Exams as well as major entry tests, helping students perform better in the biology section. PLS Academy provides these resources to support students in their preparation.

JazakAllah