Biology Practice Test 4

Biology Practice Test 4 is designed to help students strengthen their understanding of key biological concepts, theories, and processes for competitive entry tests like MDCAT, NUMS, AKU, UET, ECAT, NTS, as well as FSC Board Exams. This test covers topics from human anatomy, physiology, microbiology, and ecology, helping students improve accuracy and retention.

PLS Academy

Get Access to 20 thousands+ MCQs Including Topical MCQs, Practice Tests, Mock Tests, Solved Past Papers, Flashcards, Notes, FLPS, and Much More.

UNLOCK PREMIUM🔐

1244

Created by Ali Durrani

MDCAT Practice Tests

Biology Practice Test 4

This is the Free Access to Limited MCQs. Enroll to PLS Boost Premium Bundle to Get More MCQs HERE

1 / 100

Category: Biology Ch 10 Class 12

Consider the following statements about biological communities.

I. Their members share a common gene pool

II. The community remains stable even though some physical aspect of the environment may undergo a change

III. It consists of all the populations living in a particular area.

IV. A community interacts with a non-living environment and both function together to form an ecosystem

Which two of the above statements are true?

NTS 2014
Biology
Evolution
Elimination Tool:

A) 1 and 2

B) 1 and 3

D) 2 and 3

E) 3 and 4

2 / 100

Category: Biology Ch 13 Class 12

Which of the following trophic levels has the largest biomass in ecosystems?

NUMS 2018
Biology
Man and His Environment
Elimination Tool:

A) Decomposers

B) Primary consumer

D) Producers

C) Secondary consumer

3 / 100

Category: Biology

Mutations can occur in:

NUMS Mock 4
Biology
Chromosomes and DNA

A) DNA

B) Protein

C) RNA

D) A and C

4 / 100

Category: Biology Ch 13 Class 12

Study of environmental relations is called:

NUMS 2018
Biology
Man and His Environment
Elimination Tool:

A) Physiology

B) Pulmonology

C) Morphology

D) Ecology

5 / 100

Category: Biology Ch 6 Class 11

The cell membrane of a bacterial cell often invaginates to produce membranous structures referred to as:

NUMS 2017
Biology
Kingdom Prokaryote
Elimination Tool:

A) Centrosomes

B) Mesosomes

C) Dictyosomes

D) Polysomes

6 / 100

Category: Biology Ch 13 Class 11

During breathing air from Pharynx enters to:

UHS 2018
Biology
Gaseous Exchange
Elimination Tool:

A) Trachea

B) Bronchioles

C) Alveoli

D) Bronchi

7 / 100

Category: Biology Ch 7 Class 12

Mitotic apparatus in animals is formed by

Aster and spindle

Polar and kinetochore microtubules

Spindle and RNA

Spindle only

8 / 100

Category: Biology

Q.27 In the process of esterification OH is derived from?

A. Ether

B. Alcohol

C. Water

D. Both A and B

9 / 100

Category: Biology Ch 10 Class 12

Natural selection can amplify or diminish variations that are

Non heritable

Heritable

Both heritable and non heritable

Acquired

10 / 100

Category: Biology Ch 9 Class 12

Choose the term from the following which is NOT a part of gene therapy?

NTS 2019
Biology
Biotechnology
Elimination Tool:

A) Bone marrow transplant

B) Retrovirus

C) DNA Fingerprinting

D) Somatic cells

11 / 100

Category: Biology

Q.54 Which of the following elements are not found in carbohydrates?

A.C

B.H

C.N

D. O

12 / 100

Category: Biology Ch 10 Class 12

In the Hardy – Weinberg principle,p2 + 2pq + q2= ?

NTS 2016 SMBBMC
Biology
Evolution
Elimination Tool:

A) 0

B) 1

C) Infinity

D) Any value between 0 to 1

13 / 100

Category: Biology Ch 12 Class 12

Annual rainfall in grass land i

1500-2500 mm

750-1500 mm

250-750 mm

250-500 mm

14 / 100

Category: Biology Ch 10 Class 12

The process that has transformed life on earth from its earliest forms to vast diversity is?

PMC Sample 3
Biology
Evolution
Elimination Tool:

A) mutation

B) evolution

C) migration

D) genetic drift

15 / 100

Category: Biology

Q.15 The inhibitory effect of which inhibitor can be more dangerous in Krebs cycle?

A. Irreversible inhibitors

B. Competitive inhibitor

C. Reversible inhibitors

D. Non-competitive inhibitor

16 / 100

Category: Biology

The best function of coelom is described as ____.

NUMS Mock 1
Biology
Kingdom Animalia

A) To increase the size of the animals

B) To help in the functioning of reproductive system

C) To provide space for the development of organs and systems

D) All of these options are correct

17 / 100

Category: Biology Ch 3 Class 11

Reversible inhibitors form WEAK linkages with which of the following?

PMC Sample 3
Biology
Enzymes
Elimination Tool:

A) enzyme

B) reactant

C) product

D) substrate

18 / 100

Category: Biology Ch 6 Class 11

Apparently which bacteria is more resistant to antibiotics?

NUMS 2017
Biology
Kingdom Prokaryote
Elimination Tool:

A) Gram-positive bacteria

B) Gram-negative bacteria

C) Both Gram-negative and positive bacteria

D) None of these options are correct

19 / 100

Category: Biology

Q.53____________________are among smallest known virus

A. Picornavirus

B. Parvoviruses

C. Herpes virus

D. Rotavirus

20 / 100

Category: Biology

Which of the following will not undergo aldol condensation?

NUMS Mock 2
Chemistry
Aldehydes and Ketones

A) Acetaldehyde

B) Propanaldehyde

C) Benzaldehyde

D) Trideuteroacetaldehyde

21 / 100

Category: Biology

Which of the following, which is the incorrectly paired one?

NUMS Mock 2
Biology
Biology and its Major Fields of Specialization

B) Schlelden and schwann … cell theory

C) Robert Brown… nucleus

D) Watson and Crick … DNA model

E) Virchow… mosaic model of plasma membrane

22 / 100

Category: Biology Ch 11 Class 11

Molecular formula of chlorophyll ‘a’ molecule is:

C55H72O5N4Mg

C55H70O6N4Mg

C50H72O6N4Mg

C55H70O5N4Mg

23 / 100

Category: Biology Ch 9 Class 11

Which of the following is not a parasitic fungus of plants?

NUMS 2015
Biology
Kingdom Plantae
Elimination Tool:

A) Rust

B) Mildews

C) Armillaria

D) None of the given options

24 / 100

Category: Biology Ch 13 Class 12

Water constitutes –% of body weight?

A. 25-30%

70-90%

10-30%

30-50%

25 / 100

Category: Biology

The system responsible for fighting the pathogens is:

NUMS Mock 4
Biology
Transport

A) Muscular System

B) Endocrine System

C) Nervous System

D) Immune System

26 / 100

Category: Biology

Which of the following statements are true for mitochondria and chloroplasts?

A. ATP synthesis is seen in both
B. Outer membrane has more surface area in both
C. Circular naked DNA, RNA, and 70 ribosomes are seen in both
D. Oxidative phosphorylation occurs in both

NUMS Mock 4
Biology
Cell Structure and Function

A) A and B

B) B and C

C) A and C

D) A and D

27 / 100

Category: Biology Ch 4 Class 11

Autophagosomes are

Those lysosomes which eat parts of their own cells to generate energy.

Those lysosomes which eat old and worn out cellular organelles.

Lysosomes which help in extracellular digestion

Both a and b

28 / 100

Category: Biology Ch 4 Class 11

Resolution power of a compound microscope is

2.0 ?m

2-4 A

24 ?m

24 A

29 / 100

Category: Biology

The region where the impulse moves from one neuron to another is called ______.

NUMS Mock 4
Biology
Coordination and Control

A) Axon

B) Dendrites

C) Synapse

D) Thalamus

30 / 100

Category: Biology Ch 3 Class 11

The lock and key model of enzyme action was proposed by:

PMC Sample 3
Biology
Enzymes
Elimination Tool:

A) Louis Pasteur

B) Emil Fischer

C) Daniel Koshland

D) Urey Miller

31 / 100

Category: Biology Ch 3 Class 12

Which of the following is not the function of the cerebrum?

NUMS 2016
Biology
Coordination and Control
Elimination Tool:

A) Voluntary digestion

B) Thinking

C) Intelligence

D) Skeletal muscles

32 / 100

Category: Biology Ch 7 Class 11

This protist has isomorphic alternation of generation:

PMC 2021 Tested
Biology
Kingdom Protista
Elimination Tool:

A) Phytopthora

B) Chlorella

C) Ulva

D) Euglena

33 / 100

Category: Biology Ch 8 Class 12

If a heterozygous individual shows the complete effect of both alleles, the type of inheritance would be

Complete dominance

Non dominance

Incomplete dominance

Co-Dominance

34 / 100

Category: Biology Ch 6 Class 11

Which of the following is not a component of extracellular matrix in bacteria?

NUMS 2015
Biology
Kingdom Prokaryote
Elimination Tool:

A) Cell wall

B) Slime

C) Capsule

D) Cell membrane

35 / 100

Category: Biology Ch 2 Class 11

Which chemical component has the same % in bacterial as well as the mammalian cell?

Water

Carbohydrate

Proteins

Lipids

36 / 100

Category: Biology Ch 9 Class 11

In Pakistan, the furniture wood is mainly obtained from the members of family:

UHS 2010
Biology
Kingdom Plantae
Elimination Tool:

A) Rosaceae

B) Solanaceae

C) Minosaceae

D) Fabaceae

37 / 100

Category: Biology Ch 5 Class 11

There are 3 stages of HIV infection, which sequence is correct

PMC Sample 1
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) AIDS, Chronic HIV, Acute HIV

B) Chronic HIV, AIDS, Acute HIV

C) Acute HIV, Chronic HIV, AIDS

D) all of them

38 / 100

Category: Biology Ch 1 Class 12

The mechanism of regulation, generally between organism and its environment, of solutes and the gain and the loss of water is called

Homeostasis

Hemostasis

Osmoregualtion

Thermoregulation

39 / 100

Category: Biology Ch 10 Class 12

Consider the following statements about biological communities.

I. Their members share a common gene pool

II. The community remains stable even though some physical aspect of the environment may undergo a change

III. It consists of all the populations living in a particular area.

IV. A community interacts with a non-living environment and both function together to form an ecosystem

Which two of the above statements are true?

NTS 2014
Biology
Evolution
Elimination Tool:

A) 1 and 2

B) 1 and 3

D) 2 and 3

E) 3 and 4

40 / 100

Category: Biology Ch 6 Class 12

Which statement correctly describes the transcription of DNA?

PMC 2020
Biology
Chromosomes and DNA
Elimination Tool:

A) It produces amino acids

B) It produces messenger RNA

C) It results in increased DNA synthesis

D) It is a semi conservative process

41 / 100

Category: Biology Ch 2 Class 11

5 different amino acids, numbered 1, 2, 3, 4, and 5, below from the following sequence in the path of a polypeptide chain:

1-2-3-4-2-5-3

Messenger RNA codon, which correspond to the amino acids, are:
amino acid 1 UGU

amino acid 2 GAU

amino acid 3 CAC

amino acid 4 UAG

amino acid 5 AAG

Which one of the following DNA bases sequences could provide the code for the given section of the polypeptide?

NTS 2015 DUHS and JSMU
Biology
Biological Molecules
Elimination Tool:

A) ACACTTGTGATGCTATTCGTG

B) ACACUAGUGAUGCUAUUCGUG

C) ACACTAGTGATGCTAAACGTG

D) ACACTAGTGATCCTATTCGTG

42 / 100

Category: Biology Ch 9 Class 11

The scientific name of thorn Apple is?

NTS 2015 DUHS and JSMU
Biology
Kingdom Plantae
Elimination Tool:

A) Sycopodium phlogmaria

B) Anthocoros fusiform

C) Ginkgo biloba

D) Datura alba

43 / 100

Category: Biology

A person got an infection, he became ill but then he survived. What do you think which of immunity he would have developed?

NUMS Mock 1
Biology
Transport

A) Active immunity

B) Artificially induced active immunity

C) Passive immunity

D) Naturally induced active immunity

44 / 100

Category: Biology Ch 7 Class 12

Gametes in animals are produced by:

PMC 2021 Tested
Biology
Cell Cycle
Elimination Tool:

A) Meiosis

B) Fission

C) Mitosis

D) All three

45 / 100

Category: Biology Ch 5 Class 12

The active sites of all enzyme are formed by:

NUMS 2016
Biology
Growth and Development
Elimination Tool:

A) R-groups of amino acids

B) NH2 groups of amino acids

C) -COOH groups of amino acids

D) Exposed disulphide bonds

46 / 100

Category: Biology Ch 9 Class 11

Which of the following is included in Bryophytes?

NTS 2011
Biology
Kingdom Plantae
Elimination Tool:

A) Mosses

B) Club mosses

C) Ferns

D) Seed plants

47 / 100

Category: Biology

Some enzymes require the presence of a non protein molecule to behave catalytically. An enzyme devoid of this molecule is called a(n):

NUMS Mock 1
Biology
Enzymes

A) Holoenzyme

B) Apoenzyme

C) Coenzyme

D) Zymoenzyme

48 / 100

Category: Biology

Q37 The muscle contraction depends on:

A. Nerve impulse

B. Energy

C. Calcium

D. All of these

49 / 100

Category: Biology Ch 2 Class 11

Which of the following has the ability to develop ester linkage with the OH group of Pentose sugar?

NUMS 2017
Biology
Biological Molecules
Elimination Tool:

A) Purine

B) Pyrimidine

C) H3PO4

D) HNO3

50 / 100

Category: Biology Ch 11 Class 12

Abiotic components include

Atmosphere

Hydrosphere

Lithosphere

All of these

51 / 100

Category: Biology Ch 4 Class 11

In a typical compound microscope the resolution is 2 μm. Which is about _____ that of naked eye.

NUMS 2019 Reconduct
Biology
Cell Structure and Function
Elimination Tool:

A) 100 x

B) 300 x

C) 400 x

D) 500 x

52 / 100

Category: Biology Ch 13 Class 11

Oxygen contents per liter of air is

10 ml

100 ml

200 ml

100ml

53 / 100

Category: Biology Ch 10 Class 11

Archaeopteryx is a transitional stage between the members of which one of the following pairs?

NTS 2013
Biology
Kingdom Animalia
Elimination Tool:

A) Amphibian … bird

B) Fish … amphibian

C) Reptile … mammal

D) Reptile … bird

54 / 100

Category: Biology Ch 5 Class 11

Which of the following is NOT TRUE about Human Immunodeficiency virus (HIV)?

PMC 2020
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) It is a retrovirus

B) It is surrounded by an envelope

C) It does not cause AIDS

D) It causes deficiency of the human immune system

55 / 100

Category: Biology Ch 6 Class 12

The combination of XXY (47) chromosomes results in:

NTS 2012
Biology
Chromosomes and DNA
Elimination Tool:

A) Down's Syndrome

B) Turner's Syndrome

C) Klinefelter's Syndrome

D) Sickle cell anemia

56 / 100

Category: Biology Ch 6 Class 12

In semi-conservative replication

. Sequence of original duplex is conserved after one round of replication

Gererate DNA copies of entirely new molecules

Parental DNA become completely dispersed

Each strand of daughter molecules will be a mixture of old and new

57 / 100

Category: Biology Ch 7 Class 12

During meiosis, the homologous chromosomes come together and form pairs, this process is called:

PMC 2020
Biology
Cell Cycle
Elimination Tool:

A) Linkage

B) Synapsis

C) Pairing

D) Crossing over

58 / 100

Category: Biology Ch 4 Class 11

The following are all features of eukaryotic cells:

I. chloroplast

II. peroxisome

III. lysosome

IV. mitochondrion

v. nucleus

Which of these have a double membrane?

NTS 2014
Biology
Cell Structure and Function
Elimination Tool:

A) I, II and IV

B) I, III and V

C) I, IV and V

D) II, III and V

59 / 100

Category: Biology

Which of the following is NOT a difference that would allow one to distinguish between a prokaryotic and a eukaryotic cell?

Presence of absence of the nucleus
Presence or absence of the cell wall
Membrane bound versus no membrane bound organelles
NUMS Mock 3
Biology
Cell Structure and Function

A) I only

B) II only

C) III only

D) I and II only

60 / 100

Category: Biology

Q.36 The ETC in plants consists of an electron carrier called?

A. Pq

B. Pc

C. Pt

D.Po

61 / 100

Category: Biology

Q45 Which was the first virus to be successfully crystalized?

A. TMV

B. Smallpox

C. Poliovirus

D. Adenovirus

62 / 100

Category: Biology

Phenylmethyl ketone can be converted into ethyl benzene in one step by using:

NUMS Mock 4
Chemistry
Aldehydes and Ketones

A) LiAlH4

B) Zn(Hg)-HCl

C) NaBH4

D) CH3Mgl

63 / 100

Category: Biology Ch 9 Class 11

In plants chlorosis is caused by the deficiency of:

PMC Sample 3
Biology
Kingdom Plantae
Elimination Tool:

A) chlorophyll

B) magnesium

C) nitrogen

D) all of above

64 / 100

Category: Biology Ch 6 Class 12

The Meselson and Stahl experiment confirmed that DNA replicates in _____ manner.

NUMS 2019 Reconduct
Biology
Chromosomes and DNA
Elimination Tool:

A) Conservative

B) Semi – conservative

C) Dispersive

D) New synthesis

65 / 100

Category: Biology Ch 11 Class 11

Lactic Acid Fermentation is a type of anaerobic respiration that occurs in human muscle cells. It yields only ____ % of the energy present in a glucose molecule.

NUMS 2019 Reconduct
Biology
Bioenergetics
Elimination Tool:

A) 5

B) 7

C) 10

D) 20

66 / 100

Category: Biology Ch 7 Class 12

Crossing over occur between ____________ of homologous chromosomes:

PMC Sample 1
Biology
Cell Cycle
Elimination Tool:

A) Sister pair of chromatid

B) Sister chromatids of homologous

C) Non-sister chromatin

D) All of them

67 / 100

Category: Biology Ch 7 Class 11

Who first separated bacteria from other protists as a group?

John Hogg

Ernst Haeckel

Margulis and Schwartz

Herbert Copeland

68 / 100

Category: Biology Ch 3 Class 12

At the induction of action potential opening of Na+ gate with influx of Na+ is a _________ processes:

Active transport

Passive transport.

Diffusion

none of these.

69 / 100

Category: Biology Ch 7 Class 12

In plants mitotic apparatus consists of

Centriole

Centriole and asters

Centrioles, asters and spindles

Spindles only

70 / 100

Category: Biology

Digestion of which food components starts from the oral cavity?

NUMS Mock 3
Biology
Nutrition

A) Proteins

B) Fats

C) Carbohydrates

D) Vitamins

71 / 100

Category: Biology Ch 12 Class 11

Scurvy is caused by deficiency of vitamin ______.

NTS 2016 DUHS & JSMU
Biology
Nutrition
Elimination Tool:

A) A

B) B

C) C

D) D

72 / 100

Category: Biology Ch 5 Class 11

Which of the following is the simplest form of pathogens causing diseases?

NTS 2018
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Viruses

B) Prions

C) Fungus

D) Amoeba

73 / 100

Category: Biology Ch 4 Class 12

Which of the following is found beneath the prostate gland?

PMC Sample 1
Biology
Reproduction
Elimination Tool:

A) vas deferens

B) seminal vesicle

C) urethra

D) cowper's gland

74 / 100

Category: Biology Ch 3 Class 12

The prolactin hormone, responsible for the activation of mammary glands to start producing milk, is a hormone of the:

NTS 2010
Biology
Coordination and Control
Elimination Tool:

A) Pituitary gland

B) Pancreas

C) Thyroid gland

D) Thymus gland

75 / 100

Category: Biology Ch 6 Class 12

During DNA replication ______ attaches the fragment to the lagging strand.

NUMS 2019 Reconduct
Biology
Chromosomes and DNA
Elimination Tool:

A) Ligase

B) Invertase

C) Helicase

D) Topoisomerase

76 / 100

Category: Biology Ch 12 Class 11

All of the insectivorous plants are true

Heterotrophs

Autotrophes

Carnivores

Saprotrophs

77 / 100

Category: Biology Ch 2 Class 12

Identify the bones in which the connecting joints are freely movable joints?

NTS 2015 DUHS and JSMU
Biology
Support and Movement
Elimination Tool:

A) Ankle

B) wrist

C) vertebrae

D) elbow

E) all of the above

78 / 100

Category: Biology Ch 1 Class 12

Which hormone prepares the body for situations of stress and emergency?

NUMS 2014
Biology
Homeostasis
Elimination Tool:

A) Adrenaline

B) Non adrenaline

C) Thyroxin

D) Insulin

79 / 100

Category: Biology

Proteins and lipids are converted into glycolipids and glycoproteins by adding carbohydrates by?

NUMS Mock 4
Biology
Cell Structure and Function

A) Ribosomes

B) Cytoplasm

C) Golgi apparatus

D) Endoplasmic reticulum

80 / 100

Category: Biology

In cross-section each Centriole consist of nine (each in triplets) of:

NUMS Mock 2
Biology
Cell Structure and Function

A) Microfilaments

B) Microvilli

C) Microtubules

D) Intermediate filaments

81 / 100

Category: Biology Ch 10 Class 12

Carolus Linnaeus was believer of which of the following?

PMC Sample 1
Biology
Evolution
Elimination Tool:

A) special creation

B) natural selection

C) catastrophism

D) Inheritance of acquired characters

82 / 100

Category: Biology

Q.66 Which type of sensory structures carrying the touch sensations are present in papillae extending into ridges of the finger tips?

A. Hair end organs

B. Pacinian corpuscles

C. Meissner's Corpuscles

D. All of these

83 / 100

Category: Biology Ch 2 Class 11

Which of the following has the ability to develop ester linkage with OH group of Pentose sugar?

NUMS 2019 Reconduct
Biology
Biological Molecules
Elimination Tool:

A) Purine

B) Pyrimidine

C) H3PO4

D) HNO3

84 / 100

Category: Biology Ch 9 Class 11

Thick, waxy & leathery cuticle around leaves is present in which of the following?

PMC Sample 3
Biology
Kingdom Plantae
Elimination Tool:

A) Hydrophytes

B) Mesophytes

D) Xerophytes

C) Halophytes

85 / 100

Category: Biology Ch 6 Class 12

A typical human chromosome contains _________ nucleotides in its DNA

240 million

140 million

150 million

160 million

86 / 100

Category: Biology Ch 2 Class 11

Which of these is not a disaccharide?

NUMS 2018
Biology
Biological Molecules
Elimination Tool:

A) Fructose

B) Sucrose

C) Lactose

D) Maltose

87 / 100

Category: Biology Ch 14 Class 11

The chemical nature of an antibody is:

NUMS 2016
Biology
Transport
Elimination Tool:

A) Glycoprotein

B) Glycolipids

C) Lipoproteins

D) Polysaccharides

88 / 100

Category: Biology Ch 5 Class 12

______ is the reconstruction of the lost part of the body.

NTS 2012
Biology
Growth and Development
Elimination Tool:

A) Growth

B) Development

C) Regeneration

D) Blastulation

89 / 100

Category: Biology Ch 10 Class 12

The organs which are similar in function but differ in structure are called:

PMC 2020
Biology
Evolution
Elimination Tool:

A) Analogous organs

B) Homologous organs

C) Convergent evolution

D) Divergent evolution

90 / 100

Category: Biology Ch 12 Class 11

Midgut in cockroach is a short narrow tube called

Hepatic caeca

Gizzard

Stomach

Rectum

91 / 100

Category: Biology Ch 3 Class 12

All of the following hormones are secreted from anterior lobe of pituitary gland BUT:

NUMS 2019 Reconduct
Biology
Coordination and Control
Elimination Tool:

A) Somatotropin hormone

B) Thyroid stimulating hormone

C) Antidiuretic hormone

D) Gonadotrophic hormone

92 / 100

Category: Biology Ch 3 Class 12

The directional movement toward or away from the stimulus is called:

PMC 2020
Biology
Coordination and Control
Elimination Tool:

A) Tropism

B) Orientation

C) Taxi

D) Non orientation

93 / 100

Category: Biology Ch 6 Class 12

Chromosome is made of

2 chromatids +1 centromere +secondary constriction

1 chromated + 1 centromere + primary constriction

2 chromatids + 1 centromere + primary constriction

2 chromatids + 2 centromere + secondary constriction

94 / 100

Category: Biology

When both the alleles of a gene pair are same, the organism is said to be:

NUMS Mock 3
Biology
Variation and Genetics

A) Heterozygous

B) Genotype

C) Homozygous

D) Phenotype

95 / 100

Category: Biology Ch 8 Class 12

Filial is a Latin word. It means

Spring

Issue

Progeny

Descendent

96 / 100

Category: Biology Ch 8 Class 12

Haemophilia occurs because of:

PMC 2020
Biology
Variation and Genetics
Elimination Tool:

A) Mutation in an autosome

B) Mutation of Y-chromosome

C) Mutation of X-chromosome

D) Deficiency of iron

97 / 100

Category: Biology Ch 13 Class 12

Wild life refers to

All plants of the world

All non cultivated plant

Non domesticated animals

Both b and c

98 / 100

Category: Biology Ch 3 Class 12

Cell membrane under resting conditions is impermeable to all the ions except

Na+

. K+

Cl-

PO4-2

99 / 100

Category: Biology Ch 11 Class 12

Mosses are

Dermatocarpon

Permellia

Tortula

Both b and c

100 / 100

Category: Biology Ch 13 Class 12

Grassland of Argentina is:

NUMS 2015
Biology
Man and His Environment
Elimination Tool:

A) Prairies

B) Savana

C) Boreal

D) Pampas

Your score is

The average score is 61%

Structured Practice for Best Entry Test Preparation

This topic-wise and chapter-wise practice test allows students to focus on individual biology concepts, including diagrams, processes, and conceptual questions. Regular practice enhances understanding, sharpens problem-solving skills, and builds confidence to tackle both board and competitive exam questions efficiently.

Free Resources for Best Entry Test Preparation

Students can access free Biology Practice Test 4 to systematically improve knowledge, recall, and problem-solving abilities. This test is suitable for FSC Board Exams as well as major entry tests, helping students perform better in the biology section. PLS Academy provides these resources to support students in their preparation.

JazakAllah