Biology Practice Test 4

Biology Practice Test 4 is designed to help students strengthen their understanding of key biological concepts, theories, and processes for competitive entry tests like MDCAT, NUMS, AKU, UET, ECAT, NTS, as well as FSC Board Exams. This test covers topics from human anatomy, physiology, microbiology, and ecology, helping students improve accuracy and retention.

PLS Academy

Get Access to 20 thousands+ MCQs Including Topical MCQs, Practice Tests, Mock Tests, Solved Past Papers, Flashcards, Notes, FLPS, and Much More.

UNLOCK PREMIUM🔐

1244

Created by Ali Durrani

MDCAT Practice Tests

Biology Practice Test 4

This is the Free Access to Limited MCQs. Enroll to PLS Boost Premium Bundle to Get More MCQs HERE

1 / 100

Category: Biology Ch 7 Class 12

Interphase is a phase of the cell cycle defined only by the absence of _______.

NTS 2019
Biology
Cell Cycle
Elimination Tool:

A) Enzymes

B) DNA

C) Replication

D) Cell division

2 / 100

Category: Biology Ch 13 Class 11

Gaseous exchange in plants takes place through the:

NUMS 2020
Biology
Gaseous Exchange
Elimination Tool:

A) Stomata

B) Mesophyll

C) Endoderm

D) Xylem

3 / 100

Category: Biology Ch 11 Class 11

NAD is an example of ______:

NUMS 2020
Biology
Bioenergetics
Elimination Tool:

A) Mononucleotide

B) Dinucleotide

C) Tri nucleotide

D) Tetra nucleotide

4 / 100

Category: Biology

Q.50 How does each photoexcited electron pass from PS1 to PS2?

A. ETC

B. chemiosmosis

C. photolysis

D. photosynthesis

5 / 100

Category: Biology

Erythroblastosis foetalis occurs when:

NUMS Mock 2
Biology
Variation and Genetics

A) Mother is Rh-positive and baby is Rh-negative

B) Mother is Rh-negative and the baby is Rh-positive

C) Both mother and baby are Rh-negative

D) Both mother and baby are Rh-positive

6 / 100

Category: Biology

Q.68 Enzymes are globular proteins because

A. They have a primary structure.

B. They have a secondary structure.

C They have a tertiary structure,

D. All of the above.

7 / 100

Category: Biology Ch 14 Class 11

How many ml of blood is pumped by each contraction of the heart?

NUMS 2016
Biology
Transport
Elimination Tool:

A) 80 ml

B) 90 ml

C) 70 ml

D) 60 ml

8 / 100

Category: Biology Ch 9 Class 12

Chemical nature of primers used in the PCR process is _______.

UHS 2018
Biology
Biotechnology
Elimination Tool:

A) RNA

B) Protein

C) Carbohydrate

D) DNA

9 / 100

Category: Biology Ch 13 Class 11

Vocal cords, which help in voice production are two thin edged fibrous bands, present in:

NUMS 2019 Cancelled
Biology
Gaseous Exchange
Elimination Tool:

A) Glottis

B) Bronchus

C) Larynx

D) Trachea

10 / 100

Category: Biology Ch 3 Class 12

Which type of sensory structures carry deep pressure and vibration sensations?

Hair end organs

Meissner's Corpuscles.

Pacinian corpuscles.

none of these.

11 / 100

Category: Biology Ch 7 Class 12

Interphase of meiosis lacks

G0 phase

G1 phase

G2 phase

S phase

12 / 100

Category: Biology Ch 8 Class 12

______ are more common in human males than females.

NUMS 2016
Biology
Variation and Genetics
Elimination Tool:

A) X-linked dominant traits

B) X-linked recessive traits

C) Y-linked dominant traits

D) Autosomal linked recessive traits

13 / 100

Category: Biology

Q.15 The inhibitory effect of which inhibitor can be more dangerous in Krebs cycle?

A. Irreversible inhibitors

B. Competitive inhibitor

C. Reversible inhibitors

D. Non-competitive inhibitor

14 / 100

Category: Biology

Which of the following basic structural level of proteins is indicated by an association of two alpha and two beta chains in the haemoglobin molecule?

NUMS Mock 4
Biology
Biological Molecules

A) Primary structure

B) Secondary structure

C) Tertiary structure

D) Quatenary Structure

15 / 100

Category: Biology Ch 5 Class 11

Vaccines for all of these have been developed EXCEPT:

NUMS 2019 Reconduct
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Polio

B) Mumps

C) Measles

D) Cancer

16 / 100

Category: Biology

Below the point at which the cotyledons are attached, the embryo axis is called _______.

NUMS Mock 2
Biology
Kingdom Plantae

A) Radicle

B) Epicotyl

C) Hypocotyl

D) Coleoptile

17 / 100

Category: Biology Ch 4 Class 12

Which statement is incorrect?

Climacteric is burst of respiratory activity in fruit ripening

It is associated with ethane production C

It helps in fruit set

It helps in fruit ripening

18 / 100

Category: Biology

Q.10 Synaptic vesicles discharge which hormone at the neuromuscular junction?

A, acetylcholine

B. adrenaline

C. estradiol

D. testosterone

19 / 100

Category: Biology Ch 6 Class 12

“Law of independent assortment” states:

PMC 2020
Biology
Chromosomes and DNA
Elimination Tool:

A) That each pair of alleles assort independently of other pairs of alleles during gamete formation

B) That alleles of each pair of contrasting trait have unequal probability to assort with the alleles of other pair

C) That the two coexisting alleles for each trait segregate (separate) from each other at meiosis so that each gamete receives only one of the two alleles

D) That pertain to inheritance of single trait (monohybrid cross)

20 / 100

Category: Biology Ch 2 Class 11

The cell wall of most of the bacteria have a unique macromolecule called_______.

NTS 2012
Biology
Biological Molecules
Elimination Tool:

A) Cellulose

B) Chitin

C) Fibres

E) Peptidoglycan

21 / 100

Category: Biology Ch 13 Class 12

The actual or preserved remains of the organisms that lived in the ancient past are called:

UHS 2018
Biology
Man and His Environment
Elimination Tool:

A) Fossils

B) Impression

C) Ancient prints

D) Ancient cast

22 / 100

Category: Biology Ch 2 Class 11

Water acts as a universal solvent because of:

PMC 2020
Biology
Biological Molecules
Elimination Tool:

A) Heat of vaporization

B) Hydrogen bonding

C) High polarity

D) Cohesion and adhesion

23 / 100

Category: Biology Ch 11 Class 11

NADH produces how many ATP?

NUMS 2016
Biology
Bioenergetics
Elimination Tool:

A) 2 ATP

B) 3 ATP

C) 4 ATP

D) 6 ATP

24 / 100

Category: Biology Ch 8 Class 12

In ‘Complete Dominance’:

PMC 2020
Biology
Variation and Genetics
Elimination Tool:

A) Different alleles of a gene are both expressed in heterozygous condition

B) One allele (R) is completely dominant over the other (r) and the presence of the recessive allele is functionally hidden, so the heterozygote (Rr) has the same round phenotype as (RR) homozygote.

C) The phenotype of the heterozygote is intermediate between phenotypes of the two homozygotes

D) Gene mutations may produce many different alleles of a gene

25 / 100

Category: Biology Ch 13 Class 12

An area previously supporting life is made barren, the subsequent recolonization is called ______.

UHS 2018
Biology
Man and His Environment
Elimination Tool:

A) Climax community

B) Pioneer succession

C) Primary succession

D) Secondary succession

26 / 100

Category: Biology Ch 7 Class 11

All of the following organisms belong to the kingdom protista EXCEPT:

NTS 2012
Biology
Kingdom Protista
Elimination Tool:

A) Ulva

B) Euglena

C) Slime Mold

D) Common Mold

27 / 100

Category: Biology Ch 10 Class 11

An amphibian’s heart has ______ chambers:

NUMS 2016
Biology
Kingdom Animalia
Elimination Tool:

A) Two

B) Three

C) Four

D) Five

28 / 100

Category: Biology Ch 7 Class 12

DNA is synthesized and chromosome number is doubled in

G1 phase

S phase

G2 phase

G0 phase

29 / 100

Category: Biology Ch 6 Class 11

Which of the following is not a sterilization method for the control of bacteria?

PMC Practice 4
Biology
Kingdom Prokaryote
Elimination Tool:

A) Radiation

C) High temperature

B) Filtration

D) Antiseptic

30 / 100

Category: Biology Ch 10 Class 12

Which of the following concepts is attributed to Lamarck?

NUMS 2014
Biology
Evolution
Elimination Tool:

A) Struggle for existence

B) Survival of the fittest

C) Inheritance of acquired characters

D) Cells come from pre-existing cells

31 / 100

Category: Biology Ch 7 Class 11

Pili are mainly found on certain species of:

PMC 2021 Tested
Biology
Kingdom Protista
Elimination Tool:

A) All bacteria

B) Gram negative bacteria

C) Both gram positive and gram negative bacteria

D) Gram positive bacteria

32 / 100

Category: Biology Ch 2 Class 11

5 different amino acids, numbered 1, 2, 3, 4, and 5, below from the following sequence in the path of a polypeptide chain:

1-2-3-4-2-5-3

Messenger RNA codon, which correspond to the amino acids, are:
amino acid 1 UGU

amino acid 2 GAU

amino acid 3 CAC

amino acid 4 UAG

amino acid 5 AAG

Which one of the following DNA bases sequences could provide the code for the given section of the polypeptide?

NTS 2015 DUHS and JSMU
Biology
Biological Molecules
Elimination Tool:

A) ACACTTGTGATGCTATTCGTG

B) ACACUAGUGAUGCUAUUCGUG

C) ACACTAGTGATGCTAAACGTG

D) ACACTAGTGATCCTATTCGTG

33 / 100

Category: Biology Ch 2 Class 12

In an annelids, the contraction of circular muscle results in:

Lengthening of the body.

Shortening of the body.

Widening of body

Thinning of body

34 / 100

Category: Biology Ch 2 Class 12

Skeleton of arms and legs is:

NUMS 2018
Biology
Support and Movement
Elimination Tool:

A) Exoskeleton

B) Endoskeleton

C) Axial skeleton

D) Appendicular skeleton

35 / 100

Category: Biology Ch 14 Class 11

The massive accumulation of blood with is a tissue is called as:

NTS 2011
Biology
Transport
Elimination Tool:

A) Haemorrhage

C) Hepatoma

B) Haematoma

D) Haemocoel

36 / 100

Category: Biology

The hormone which controls the uptake of Sodium ions in kidney and its maintenance in blood plasma is:

NUMS Mock 2
Biology
Coordination and Control

A) Somatotrophic Hormone

B) Aldosterone Hormone

C) Gonadotrophic Hormone

D) Thyroxine Hormone

37 / 100

Category: Biology Ch 10 Class 12

Consider the following statements about biological communities.

I. Their members share a common gene pool

II. The community remains stable even though some physical aspect of the environment may undergo a change

III. It consists of all the populations living in a particular area.

IV. A community interacts with a non-living environment and both function together to form an ecosystem

Which two of the above statements are true?

NTS 2014
Biology
Evolution
Elimination Tool:

A) 1 and 2

B) 1 and 3

D) 2 and 3

E) 3 and 4

38 / 100

Category: Biology Ch 10 Class 12

The following observations refer to evolution:

Inherited variations which are favored in a particular environment are passed on
There is a struggle for existence
Across time, inherited variations may accumulate causing gradual changes in the organism
Although populations tend to overproduce, they remain more or less constant in numbers from generation to generation
In what sequence should the statement be placed to support the Darwin theory of evolution?

NTS 2015 DUHS and JSMU
Biology
Evolution
Elimination Tool:

A) I, II, III, IV

B) II, I, III, IV

C) III, I, IV, II

E) IV, II, I, III

39 / 100

Category: Biology Ch 3 Class 11

The rate of reaction is directly proportional to the concentration of an enzyme which statement is incorrect in this respect:

Increase in enzyme molecule increases the available active sites.

This relation is for unlimited time period with unlimited enzyme concentration

If the concentration is doubled the rate will become two fold.

None of these.

40 / 100

Category: Biology Ch 4 Class 12

Ovulation is induced by ______ hormone secreted by the pituitary gland.

NUMS 2019 Reconduct
Biology
Reproduction
Elimination Tool:

A) Follicle stimulating

B) Estrogen

C) Luteinizing hormone

D) Progesterone

41 / 100

Category: Biology

Two species can avoid competition and better use the environment’s resources by occupying different ____.

NUMS Mock 4
Biology
Evolution

A) Adaptations

B) Polymorphism

C) Niches

D) Specialization

42 / 100

Category: Biology Ch 9 Class 11

Below the point at which the cotyledons are attached, the embryo axis is called _______.

NTS 2016 SMBBMC
Biology
Kingdom Plantae
Elimination Tool:

A) Radicle

B) Epicotyl

C) Hypocotyl

D) Coleoptile

43 / 100

Category: Biology Ch 10 Class 11

Leptocardii is a group of:

NUMS 2015
Biology
Kingdom Animalia
Elimination Tool:

A) Urochordata

B) Cephalochordata

C) Vertebrata

D) Mollusca

44 / 100

Category: Biology Ch 11 Class 11

At which times there is no net gaseous exchange between leaves and the atmosphere.

Day time.

Night time

Dawn & Dusk

Mid night

45 / 100

Category: Biology

Which of the following animals can survive without drinking water?

NUMS Mock 4
Biology
Nutrition

A) Kangaroo rat

B) Pig

C) Kangaroo

D) Camel

46 / 100

Category: Biology Ch 13 Class 11

Of the following, which one is better respiratory medium.

Air

Water

Soil

None of these

47 / 100

Category: Biology Ch 8 Class 12

In the pea plants, the factors round and yellow seeds (RRYY) is dominant over wrinkled and green seeds (rryy). Keeping this in mind, identify the seed that has the genotype round and green.

NTS 2011
Biology
Variation and Genetics
Elimination Tool:

A) Rryy

B) rrYy

C) RrYy

D) RRYy

48 / 100

Category: Biology Ch 6 Class 12

Which statement is correct?

Leading strand elongates away from the replication fork

Lagging strand elongates towards the replication fork

Lagging strand is constructed discontinuously.

Both a and b

49 / 100

Category: Biology Ch 6 Class 11

The shape of Cocci bacteria is:

NUMS 2017
Biology
Kingdom Prokaryote
Elimination Tool:

A) Spherical

B) Spring

C) Rod

D) Screw

50 / 100

Category: Biology Ch 6 Class 12

Evolutionary relationship among species are reflected in their ________.

NUMS 2020
Biology
Chromosomes and DNA
Elimination Tool:

A) DNA and proteins

B) Only DNA

C) Only proteins

D) RNA

51 / 100

Category: Biology Ch 12 Class 11

Carbohydrates, fats & proteins are essential for:

Metabolic processes of an organism

Providing energy

Formation of sturctures

All of these

52 / 100

Category: Biology Ch 13 Class 12

Hydroelectricity is generated by using ______ of falling water.

Potential energy

Gravitational energy

Kinetic energy

. All of these

53 / 100

Category: Biology Ch 13 Class 11

Vocal cords are stretched across

Larynx

Pharynx

Golttis

None of these

54 / 100

Category: Biology Ch 8 Class 12

In birds the male is the homogametic sex. A male bird showing the recessive trait was mated with a female showing the dominant trait of a characteristic governed by a pair of alleles which are sex-linked. What is the probability that the male offspring will show the dominant trait?

NTS 2014
Biology
Variation and Genetics
Elimination Tool:

A) 0

B) 0.25

C) 0.50

E) 1.00

55 / 100

Category: Biology Ch 14 Class 11

An example of passive acquired immunity is?

NTS 2015 DUHS and JSMU
Biology
Transport
Elimination Tool:

B) use of polio vaccine

C) passing of certain antibodies to the foetus by the pregnant women

D) inoculation of antitoxin in the case of puncture wound

E) both C and D

56 / 100

Category: Biology Ch 13 Class 11

Which of the following is not an infection of the lungs/respiratory tract?

NUMS 2015
Biology
Gaseous Exchange
Elimination Tool:

A) Histoplasmosis

B) Tuberculosis

C) Cystic fibrosis

D) None of the given options

57 / 100

Category: Biology Ch 13 Class 12

Balance in the nutrient cycle can be upset when

Too much food is consumed

Not enough food is produced

Decayed nutrients are not returned to the ground

All of these

58 / 100

Category: Biology Ch 9 Class 11

What is the name of the structure of the leaf that attaches the leaf to the stem?

PMC Sample 2
Biology
Kingdom Plantae
Elimination Tool:

A) Phloem

B) Mesophyll

C) Xylem

D) Petiole

59 / 100

Category: Biology Ch 12 Class 11

Bile is used in:

NUMS 2016
Biology
Nutrition
Elimination Tool:

A) Protein digestion

B) Starch digestion

C) Fat emulsification

D) Both A and B

60 / 100

Category: Biology

The idea that opposed the idea of abiogenesis was proposed by?

NUMS Mock 4
Biology
Cell Structure and Function

A) Robert Hooke

B) Robert Brown

C) Rudolph Virchow

D) Lorenz Oken

61 / 100

Category: Biology Ch 8 Class 12

The gene which controls ABO group has how many alleles in an individual

One

Two

Three

Four

62 / 100

Category: Biology Ch 14 Class 11

Consider the following statements regarding blood pressure:

1. It is the pressure exerted by the blood on the walls of any vessel.

2. It decreases in the arteries as the distance from the heart increases.

3. It is lower in the capillaries than in the arteries.

4. It is usually lower in women than in men.

Choose the correct statements.

NTS 2015 DUHS and JSMU
Biology
Transport
Elimination Tool:

A) 1, 2 and 3 are correct.

B) 2, 3 and 4 are correct.

C) 1 and 4 are correct.

D) 1, 2, 3 and 4 are correct.

63 / 100

Category: Biology Ch 12 Class 11

Nitrogen

Magnesium

Iron

Both A and B

64 / 100

Category: Biology Ch 6 Class 11

For respiratory metabolism, a bacterial cell membrane contains:

PMC Practice 4
Biology
Kingdom Prokaryote
Elimination Tool:

A) Proteins

B) Lipids

D) Chemicals

C) Enzymes

65 / 100

Category: Biology Ch 1 Class 11

In animals coordination is achieved by means of

Respiratory system

Nervous system

Endocrine system

Both b and c

66 / 100

Category: Biology Ch 9 Class 12

Which one has antibiotic resistance gene for tetracycline and ampicillin?

pSC 101

pBR 322

pCR 322

None of these

67 / 100

Category: Biology Ch 4 Class 11

Strengthening material of prokaryotic cell wall is

Cellulose

Chitin

Inorganic salts silica waxes and ligin

Peptidoglycan or Murein.

68 / 100

Category: Biology Ch 7 Class 11

In which of the following growth phases, the number of bacteria increases the most rapidly?

NTS 2018
Biology
Kingdom Protista
Elimination Tool:

A) Lag phase

B) Log phase

C) Stationary phase

D) Death / Decline phase

69 / 100

Category: Biology Ch 8 Class 12

The genes which do not follow law of independent assortment

Crossed genes

Linked genes

Recessive genes

Dominant genes

70 / 100

Category: Biology Ch 4 Class 11

Which of the statement about cell membrane is not true?

It contains protein molecules embedded in lipid bilayer

It is a differentially permeable membrane.

It contains charged pores thus ions being charged particles cross cell membrance much easier than neutral particles.

It may get infolded to engulf solid or liquid material.

71 / 100

Category: Biology Ch 11 Class 12

Plants growing in xeric conditions are called

Spherophytes

Mesophytes

Xerophytes

Teridophytes

72 / 100

Category: Biology Ch 6 Class 12

Phenylketonuria is

NTS 2016 DUHS & JSMU
Biology
Chromosomes and DNA
Elimination Tool:

A) Sex linked dominant trait

B) Sex linked recessive trait

C) Autosomal dominant trait

D) Autosomal recessive trait

73 / 100

Category: Biology

Q.30 This group of animals has three bones in the ear.

A. Reptiles

B. Mammals

C. Both reptiles and mammals

D. Birds and mammals

74 / 100

Category: Biology Ch 9 Class 11

In Hornworts the band of meristematic tissue is found near

Foot

Gamete producing region

Spore producing region

At junction of a & b

75 / 100

Category: Biology Ch 8 Class 12

To check the homozygosity or heterozygosity of apparently dominant trait, we do the test cross by crossing it with:

NUMS 2019 Cancelled
Biology
Variation and Genetics
Elimination Tool:

A) Any Dominant trait

B) Homozygous dominant trait

C) Homozygous Recessive trait

D) Heterozygous dominant trait

76 / 100

Category: Biology Ch 9 Class 12

Taq polymerase is extracted from a bacterium

Floral aquaticus

Taq aquaticus

Thermus floral

Thermus aquaticus

77 / 100

Category: Biology Ch 10 Class 12

Who developed a theory of natural selection essentially identical to Darwin’s

Hardy-Weinberg

Alfred Wallace

Malthus

Lyell

78 / 100

Category: Biology Ch 2 Class 11

Human cells maintain concentration gradients across their plasma membranes, such that there is a high sodium concentration outside the cell and a high potassium concentration inside the cell.

Suppose that within the cell membrane are sodium leak channels or carrier proteins. These channels would allow sodium to:

NTS 2017
Biology
Biological Molecules
Elimination Tool:

A) move out of the cell by simple diffusion

B) move into the cell by simple diffusion

C) move out of the cell by facilitated diffusion

D) move into the cell by facilitated diffusion

79 / 100

Category: Biology

Q.38 The cell organelles involved, in some cases, with extra-cellular digestion

A. Golgi complex

B. Lysosomes

C. Peroxisomes

D. Glyoxysomes

80 / 100

Category: Biology Ch 3 Class 11

Restriction endonucleases

PMC Sample 2
Biology
Enzymes
Elimination Tool:

A) are bacterial enzyme

B) convert RNA to DNA

C) hydrolyze protein into amino acids

D) get mutated for DNA repair

81 / 100

Category: Biology

Lymph vessels transfer the lymph into blood through_________.

NUMS Mock 3
Biology
Transport

A) Subclavian artery

B) Subclavian vein

C) Iliac artery

D) Iliac vein

82 / 100

Category: Biology

Q.15 Genes that affect growth rate in humans influencing both weight and height are?

A. Codominant

B. Epistasis

C. Polygene

D. Pleiotrop

83 / 100

Category: Biology Ch 5 Class 11

Amoeba belongs to which kingdom:

Prokaryotae

Plantae

Monera

Protista

84 / 100

Category: Biology

Q.12 An enzyme without its cofactor is called.

A. Coenzyme

B. Apoenzyme

C. Holoenzyme

D. Proenzyme

85 / 100

Category: Biology Ch 3 Class 11

Reversible inhibitors form WEAK linkages with which of the following?

PMC Sample 3
Biology
Enzymes
Elimination Tool:

A) enzyme

B) reactant

C) product

D) substrate

86 / 100

Category: Biology

In human gut, chylomicrons are formed by the combination of:

NUMS Mock 1
Biology
Nutrition

A) Proteins and carbohydrates

B) Fats and proteins

C) Fats and carbohydrates

D) Vitamins and fats

87 / 100

Category: Biology Ch 11 Class 11

Which of the following is a chemical link between catabolism and anabolism?

AMP

ADP

ATP

All of these

88 / 100

Category: Biology Ch 4 Class 11

A group of cells performing same function are known as:

NUMS 2016
Biology
Cell Structure and Function
Elimination Tool:

A) Organelles

B) Tissues

C) A system

D) Both A and B

89 / 100

Category: Biology Ch 14 Class 11

Fibrinogen is necessary for:

NUMS 2014
Biology
Transport
Elimination Tool:

A) Metabolism

B) Respiration

C) Reproduction

D) Clotting

90 / 100

Category: Biology Ch 10 Class 12

Mating with non-relatives is known as?

PMC Sample 2
Biology
Evolution
Elimination Tool:

A) Inbreeding

B) Outbreeding

C) Breeding

D) None of these options is correct

91 / 100

Category: Biology Ch 3 Class 12

Lymph nodes are not present:

NUMS 2020
Biology
Coordination and Control
Elimination Tool:

A) Neck region

B) Axilla

C) Groin

D) Spleen

92 / 100

Category: Biology Ch 10 Class 11

The only aquatic arthropods:

PMC Sample 1
Biology
Kingdom Animalia
Elimination Tool:

A) Crustaceans

B) Arachnids

C) Myriapods

D) Gastopods

93 / 100

Category: Biology Ch 9 Class 12

Some transgenic bacteria produce a dipeptide sweetener called

Ultrasweet

Disweet

Monosweet

Neutrasweet

94 / 100

Category: Biology

Q4 A condition with abnormal amount of fats is called:

A. anorexia

B. botulism

C. piles

D. obesity

95 / 100

Category: Biology Ch 10 Class 11

Coelom is a cavity lined by:

NUMS 2016
Biology
Kingdom Animalia
Elimination Tool:

A) Mesoderm

B) Endoderm

D) Ectoderm

C) Epiderm

96 / 100

Category: Biology

Q.21 All of the following are true for platyhelminthes except:

A. Flatworms

B. Triploblastic

C. Coelomates

D. Bilateral symmetry

97 / 100

Category: Biology

The spectrum of He is expected to be similar to that of:

NUMS Mock 4
Chemistry
Atomic Structure

A) Hydrogen

B) Sodium

C) Oxygen

D) Li+

98 / 100

Category: Biology Ch 3 Class 11

The active site of an enzyme:

Never changes

Forms no chemical bond with substrate

Determined by structure and the specificity of the enzyme.

They are non specific in their action.

99 / 100

Category: Biology Ch 9 Class 12

The genetically engineered vaccine is available for which of the following hepatitis virus?

PMC Practice 5
Biology
Biotechnology
Elimination Tool:

A) HBV

B) HAV

C) HCV

D) Options A and B are correct

100 / 100

Category: Biology

_______ is involved in lipid synthesis/metabolism.

NUMS Mock 4
Biology
Cell Structure and Function

A) Smooth endoplasmic reticulum

B) Rough endoplasmic reticulum

C) Mitochondria

D) Vacuoles

Your score is

The average score is 61%

Structured Practice for Best Entry Test Preparation

This topic-wise and chapter-wise practice test allows students to focus on individual biology concepts, including diagrams, processes, and conceptual questions. Regular practice enhances understanding, sharpens problem-solving skills, and builds confidence to tackle both board and competitive exam questions efficiently.

Free Resources for Best Entry Test Preparation

Students can access free Biology Practice Test 4 to systematically improve knowledge, recall, and problem-solving abilities. This test is suitable for FSC Board Exams as well as major entry tests, helping students perform better in the biology section. PLS Academy provides these resources to support students in their preparation.

JazakAllah