Biology Practice Test 4

Biology Practice Test 4 is designed to help students strengthen their understanding of key biological concepts, theories, and processes for competitive entry tests like MDCAT, NUMS, AKU, UET, ECAT, NTS, as well as FSC Board Exams. This test covers topics from human anatomy, physiology, microbiology, and ecology, helping students improve accuracy and retention.

PLS Academy

Get Access to 20 thousands+ MCQs Including Topical MCQs, Practice Tests, Mock Tests, Solved Past Papers, Flashcards, Notes, FLPS, and Much More.

UNLOCK PREMIUM🔐

1244

Created by Ali Durrani

MDCAT Practice Tests

Biology Practice Test 4

This is the Free Access to Limited MCQs. Enroll to PLS Boost Premium Bundle to Get More MCQs HERE

1 / 100

Category: Biology

Q44 Study of fossils is called

A. Mammalogy

B. Paleontology

C. Herpetology

D. Ornithology

2 / 100

Category: Biology Ch 7 Class 11

Most of the photosynthesis on earth is carried by

Kelps

Gymnosperms

Angiosperms

Algae

3 / 100

Category: Biology Ch 4 Class 11

Who first observed and thus hypothesized that new cells are formed from previously existing living cell?

Theodor Schwann and Schleiden

Rudolph Virchows

Louis Pasteur

Both b and c

4 / 100

Category: Biology Ch 6 Class 12

Which is incorrect?

Chromosomes 1st observed by walther Fleming

Chromosomal theory of inheritance 1st formulated by Walter Sutton

1st evidence of hereditary nature of DNA provided by Friedrich Meischer

. Sex chromosomes discovered by Thomas Hunt Morgan

5 / 100

Category: Biology Ch 12 Class 11

Certain types of whales are also ______ feeder.

Fluid

Macrophagous

Filter

None of these

6 / 100

Category: Biology Ch 10 Class 12

Which of the following concepts is attributed to Lamarck?

NUMS 2014
Biology
Evolution
Elimination Tool:

A) Struggle for existence

B) Survival of the fittest

C) Inheritance of acquired characters

D) Cells come from pre-existing cells

7 / 100

Category: Biology Ch 5 Class 12

In multicellular plants cell division occur by

Binary fission

Conjugation

Meiosis

Mitosis

8 / 100

Category: Biology Ch 4 Class 11

In which type of cells, cell wall is not present?

PMC 2020
Biology
Cell Structure and Function
Elimination Tool:

A) Plant cells

B) Fungal cells

C) Bacterial cells

D) Liver cells

9 / 100

Category: Biology

Gel electrophoresis is a technique:

NUMS Mock 1
Biology
Biotechnology

A) Employed by forensic scientist to assist in the identification of the individuals by their respective type of DNA

B) Collect all the genes found in one complete set of chromosome

C) Is a technique to separate different sizeds fragment of charge bearing polymers (proteins, RNA or DNA)

D) Grows single cell or a group of cells in a glass ware on artificial medium under aseptic conditions

10 / 100

Category: Biology Ch 10 Class 11

Which group of organisms has the following features?

I. three pairs of jointed legs

II. three-part segmented body

III. one pair of antennae

NTS 2017
Biology
Kingdom Animalia
Elimination Tool:

A) arachnids

B) crustaceans

C) Insects

D) myriapods

11 / 100

Category: Biology Ch 1 Class 12

Humans maintain their body temperature within a narrow limit due to their _____ characteristics.

NUMS 2019 Cancelled
Biology
Homeostasis
Elimination Tool:

A) Ectothermic

B) Endothermic

C) Heterothermic

D) Hypothermic

12 / 100

Category: Biology Ch 8 Class 11

Fungi whose growth is favored by fire is called:

NTS 2016 SMBBMC
Biology
Kingdom Fungi
Elimination Tool:

A) Pyrophilus

B) Prophilus

C) Philus

D) Prephylus

13 / 100

Category: Biology Ch 3 Class 11

The structure of an enzyme is altered by:

Irreversible inhibitor

Reversible inhibitor

Competitive inhibitor

Non-competitive inhibitor

14 / 100

Category: Biology Ch 10 Class 12

Archaebacteria can survive at

150?C

300?C

120?C

200?C

15 / 100

Category: Biology Ch 9 Class 12

Gel electrophoresis is a technique:

PMC 2020
Biology
Biotechnology
Elimination Tool:

A) Employed by forensic scientist to assist in the identification of the individuals by their respective type of DNA

B) Collect all the genes found in one complete set of chromosome

C) Is a technique to separate different sizeds fragment of charge bearing polymers (proteins, RNA or DNA)

D) Grows single cell or a group of cells in a glass ware on artificial medium under aseptic conditions

16 / 100

Category: Biology Ch 6 Class 11

Who discovered the bacteria causing tuberculosis and also developed various techniques of media preparation and maintenance of pure culture?

Robert Koch

Louis Pasteur

Alexander Fleming

Leeuwenhoek

17 / 100

Category: Biology Ch 12 Class 11

Chlorosis refers to the lack of:

NUMS 2016
Biology
Nutrition
Elimination Tool:

A) Growth

B) Chlorophyll

C) Yellowing of leaf margin

D) Width of leaf

18 / 100

Category: Biology

Q.68 Enzymes are globular proteins because

A. They have a primary structure.

B. They have a secondary structure.

C They have a tertiary structure,

D. All of the above.

19 / 100

Category: Biology

Most enzymes have an optimum temperature of around:

NUMS Mock 4
Biology
Enzymes

A) 30 C

B) 40 C

C) 50 C

D) 20 C

20 / 100

Category: Biology Ch 6 Class 12

Mutations can occur in:

NUMS 2016
Biology
Chromosomes and DNA
Elimination Tool:

A) DNA

B) Protein

C) RNA

D) A and C

21 / 100

Category: Biology Ch 5 Class 11

Second major form of hepatitis is:

NUMS 2015
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Hepatitis A

B) Hepatitis B

C) Hepatitis C

D) Hepatitis D

22 / 100

Category: Biology Ch 2 Class 11

When the hydroxyl group, -OH, of the carboxyl group, -COOH, of an amino acid is linked with the hydrogen of the amino group, -NH2, of another amino acid, ______ is released and a peptide bond is formed.

NUMS 2019 Reconduct
Biology
Biological Molecules
Elimination Tool:

A) NH3

B) CO2

C) H2O

D) O2

23 / 100

Category: Biology Ch 6 Class 11

Which of the following structure provides greater pathogenicity to the bacteria?

Capsule

Slime

Cell Wall

Cell membrane

24 / 100

Category: Biology

Q.20 Cytochromes are electron transport intermediates containing?

A. myoglobin

B. heam

C. globulin

D. fibrin

25 / 100

Category: Biology Ch 13 Class 12

Geothermal energy is

. Energy obtained from nuclear fuel

Energy obtained from burning natural fuels

Heat energy trapped underground

Energy obtained from blowing hot winds

26 / 100

Category: Biology Ch 8 Class 12

A cross between F1 hybrids and either of parents is called:

NUMS 2014
Biology
Variation and Genetics
Elimination Tool:

A) Back cross

B) Test cross

C) Reverse cross

D) None of the above

27 / 100

Category: Biology Ch 6 Class 12

Chromosome is made of

2 chromatids +1 centromere +secondary constriction

1 chromated + 1 centromere + primary constriction

2 chromatids + 1 centromere + primary constriction

2 chromatids + 2 centromere + secondary constriction

28 / 100

Category: Biology Ch 1 Class 12

Right kidney is slightly lower than left kidney due to:

NUMS 2018
Biology
Homeostasis
Elimination Tool:

A) Heart

B) Liver

D) Lungs

C) Pancreas

29 / 100

Category: Biology

Q.56 During cyclic photophosphorylation, electrons are diverted back to:

A. Plastoquinone

B. Cytochrome complex

C. Plastocyanin

D. Ferredoxin

30 / 100

Category: Biology Ch 3 Class 12

Type of neurons found exclusively in CNS are:

Sensory neurons

Motor neurons

Associative neurons

None of these

31 / 100

Category: Biology Ch 7 Class 11

The drfinite shape to ciliates is given by

Pellicle

Penicle

Calcium

Cell wall

32 / 100

Category: Biology Ch 2 Class 12

Pectoral fins are enlarged in:

NUMS 2015
Biology
Support and Movement
Elimination Tool:

A) Whales

B) Sharks

C) Skates

D) Plaice

33 / 100

Category: Biology Ch 1 Class 12

In osmosis water molecules move from area of _______ to _______ through semipermeable memberane

Higher solute concentration to lower solute concentration

Lower solute concentration to higher solute concentration

Lower solvent concentration to higher solvent concentration

All of these

34 / 100

Category: Biology Ch 7 Class 11

Chalk is gradually formed of dead

Actinopods

Foraminiferans

Apicomplexans

Radiolarians

35 / 100

Category: Biology Ch 4 Class 11

Whone is not the function of endoplasmic reticulum?

Nerve impulse conduction

Transport of material

Mechanical support

Synthesis of conjugated molecules

36 / 100

Category: Biology Ch 5 Class 11

Numerous opportunist diseases might attack people suffering from the following diseases?

PMC 2020
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Measles

B) Influenza

C) Hepatitis A

D) AIDS

37 / 100

Category: Biology Ch 12 Class 12

Development of bark in plants and skin in animals is a method for

Providing support

Protection from enemies

Reducing water loss

Helping in food production

38 / 100

Category: Biology

Q.52 The plasma pool of antibodies is synthesized from:

A. T- lymphocytes

B. Plasma cells

C. B- lymphocytes

D. Fibroblasts

39 / 100

Category: Biology Ch 3 Class 11

Due to the similarity of structure, competitive inhibitors may be selected by the _______ site.

NUMS 2019 Reconduct
Biology
Enzymes
Elimination Tool:

A) Catalytic

B) Active

C) Binding

D) Allosteric

40 / 100

Category: Biology

The excretion of hypertonic urine in humans is associated best with the:

NUMS Mock 1
Biology
Homeostasis

A) Glomerular capsule

B) Proximal convoluted tubule

C) Loop of Henle

D) Distal convoluted tubule

41 / 100

Category: Biology Ch 11 Class 11

The point at which there is no net exchange of gases between leaves and atmosphere is known as

Neutral point

Compensation point

Parallel point

Competitive point

42 / 100

Category: Biology Ch 11 Class 11

Stroma of chloroplast carries the fixation of:

NUMS 2014
Biology
Bioenergetics
Elimination Tool:

A) Nitrogen

B) Oxygen

C) Carbon monoxide

D) Carbon dioxide

43 / 100

Category: Biology Ch 12 Class 11

Nitrogen

Magnesium

Iron

Both A and B

44 / 100

Category: Biology Ch 10 Class 12

The genetic change in a population caused by natural selection is called?

PMC Sample 1
Biology
Evolution
Elimination Tool:

A) polymorphism

B) specialization

C) gene linkage

D) adaptation

45 / 100

Category: Biology

Which of the following compounds possesses a single covalent bond between carbon and hydrogen?

NUMS Mock 4
Chemistry
Hydrocarbons

A) CH4

B) C2H2

C) C2H4

D) All of the above

46 / 100

Category: Biology Ch 12 Class 11

Earthworm is an example of ______ feeder

Detritus

Fluid

Macrophageus

Filter

47 / 100

Category: Biology Ch 11 Class 11

Dark reaction of photosynthesis takes place in _______ of chloroplast.

NUMS 2020
Biology
Bioenergetics
Elimination Tool:

A) Thylakoids

B) Grana

C) Intergrana

D) Stroma

48 / 100

Category: Biology Ch 11 Class 11

NAD is an example of ______:

NUMS 2020
Biology
Bioenergetics
Elimination Tool:

A) Mononucleotide

B) Dinucleotide

C) Tri nucleotide

D) Tetra nucleotide

49 / 100

Category: Biology Ch 3 Class 11

The enzyme found in saliva responsible for the digestion of carbohydrates is:

NTS 2018
Biology
Enzymes
Elimination Tool:

A) Lysozyme

B) Amylase

C) Pepsin

D) Trypsinogen

50 / 100

Category: Biology Ch 6 Class 12

A fern has _____ pairs of chromosomes.

NTS 2012
Biology
Chromosomes and DNA
Elimination Tool:

A) 23

B) 40

C) 500

D) 13

51 / 100

Category: Biology Ch 10 Class 12

If allele frequency for a dominant allele is 0.4. What will be the number of heterogeneous individuals if the population is of 100 individuals with diploid traits.

NUMS 2015
Biology
Evolution
Elimination Tool:

A) 36

B) 48

C) 52

D) 74

52 / 100

Category: Biology

Which was the first virus to be successfully crystalized?

NUMS Mock 1
Biology
Bio-diversity | Variety of Life

A) TMV

B) Smallpox

C) Poliovirus

D) Adenovirus

53 / 100

Category: Biology Ch 12 Class 11

Puccinia is a parasitic:

Plant

Fungus

Animal

Algae

54 / 100

Category: Biology Ch 7 Class 12

Which of the following statements is true about metaphase?

PMC 2021 Tested
Biology
Cell Cycle
Elimination Tool:

A) Chromosomes are thickest during this phase

B) Chromosomes are shortest during this phase

C) Chromosomes are longest during this phase

D) Chromosomes are shortest and thickest during this phase

55 / 100

Category: Biology Ch 13 Class 12

Flow of energy in an ecosystem is:

NUMS 2014
Biology
Man and His Environment
Elimination Tool:

A) Unidirectional

B) Tridirectional

C) Multidirectional

D) Bidirectional

56 / 100

Category: Biology Ch 9 Class 12

In prokaryotes only one type of RNA polymerase is present, while ______ types of RNA polymerase are present in eukaryotes.

NUMS 2019 Reconduct
Biology
Biotechnology
Elimination Tool:

A) Two

B) Three

C) Four

D) Five

57 / 100

Category: Biology

Q.38 Which of the following best describes a coenzyme?

A. Covalently bonded non-protein part of an enzyme

B. Cofactor consists of metal ions

C. Loosely bonded non-protein part of an enzyme

D. Both A and B

58 / 100

Category: Biology

Q.5 Evaporation of water from aerial parts of plants is called:

A. ascent ofI Sap

B. deplasmolysis

C. deplasmolysis

D. none of these

59 / 100

Category: Biology Ch 10 Class 11

All of the following are coelomates except

Deuterosomes

Proterosomes

Hemichordates

Aschelminthes

60 / 100

Category: Biology Ch 1 Class 12

In a marine environment, the ion secreted by the kidney is:

NUMS 2020
Biology
Homeostasis
Elimination Tool:

A) Na+

B) K+

C) Mg2+

D) Cl-

61 / 100

Category: Biology Ch 2 Class 11

Which of the statement is not true for compounds like glycoprotein and glycolipids?

They are conjugated molecules of carbohydrates

Both have role in the extra cellular matrix of animals and bacterial cell wall

They are components of biological membranes.

Both are produced and secreted by endoplasmic reticulum

62 / 100

Category: Biology Ch 10 Class 12

Theory of Lamarck was based on:

NTS 2011
Biology
Evolution
Elimination Tool:

A) Adaptive modifications

B) Adaptive radiations

C) Both A and B

D) None of the above

63 / 100

Category: Biology Ch 13 Class 12

In air % of oxygen and carbon dioxide is

Oxygen 20%, CO2 0.03%

Oxygen 50%, CO2 50%

Oxygen 30%, CO2 0.05%

Oxygen 25%, CO2 0.02%

64 / 100

Category: Biology Ch 3 Class 11

Cyanide for enzymes act as:

NUMS 2018
Biology
Enzymes
Elimination Tool:

A) Substrate

C) Cofactor

B) Prosthetic group

D) Inhibitor

65 / 100

Category: Biology Ch 8 Class 12

In which of the following cases, genotypic and phenotypic ratio will remain same in F2 generation

Law of independent assortment

Law of Segregation

Test cross

Incomplete dominance.

66 / 100

Category: Biology Ch 4 Class 12

The primary oocyte in mammals has which of the following structures around it:

NUMS 2014
Biology
Reproduction
Elimination Tool:

A) Zona Pellucida

B) Zona Vasculosa

C) Zona radiata

D) None of them

67 / 100

Category: Biology Ch 2 Class 11

The disease caused by nutritional deficiency is:

NTS 2018
Biology
Biological Molecules
Elimination Tool:

A) Hepatitis

B) Cholera

C) Malaria

D) Beriberi

68 / 100

Category: Biology Ch 3 Class 11

In which of the following location enzymes controlling cellular respiration are present?

Nucleus

Chlorophast

Milochondria

Ribosome

69 / 100

Category: Biology Ch 7 Class 11

The nucleoid is found only in certain species of:

PMC 2021 Tested
Biology
Kingdom Protista
Elimination Tool:

A) Gram positive bacteria

B) Both gram positive and gram negative bacteria

C) Gram negative bacteria

D) All bacteria

70 / 100

Category: Biology Ch 4 Class 12

Only one ovary is functional at a time in:

NUMS 2015
Biology
Reproduction
Elimination Tool:

A) Human

B) Eagle

C) Chicken

D) Pigeon and human

71 / 100

Category: Biology Ch 2 Class 12

In an annelids, the contraction of circular muscle results in:

Lengthening of the body.

Shortening of the body.

Widening of body

Thinning of body

72 / 100

Category: Biology Ch 5 Class 11

Which of the Euglenas (a Protoctista) character resembles that of animals:

They can move

They lack cell wall

They do not have chlorophyll

Both a and b

73 / 100

Category: Biology Ch 7 Class 11

Stentor is a/an

Ciliate

Foraniniferan

Actinopods

Apicomplexan

74 / 100

Category: Biology Ch 7 Class 12

The phase of mitosis in which sister chromatids move towards opposite poles:

UHS 2019
Biology
Cell Cycle
Elimination Tool:

A) Anaphase

B) Metaphase

C) Prophase

D) Telophase

75 / 100

Category: Biology

Q.28 The enzyme which plays important role in HIV pathogenesis

A. RNA polymerase I

B. DNA polymerase II

C. Reverse Transcriptase I

D. Reverse Transcriptase

76 / 100

Category: Biology Ch 5 Class 12

A bean seed contains all of the following except:

NTS 2012
Biology
Growth and Development
Elimination Tool:

A) A seed coat

B) An epicotyl

C) A hypocoty

D) A hypha

77 / 100

Category: Biology Ch 13 Class 12

Conversion of ammonium into nitrates is:

UHS 2018
Biology
Man and His Environment
Elimination Tool:

A) Nitrification

B) Nitrogen Fixation

C) Ammonification

D) Denitrification

78 / 100

Category: Biology

Q.49 Another name for the sex cell is:

A. Hormone

B. Gamete

C. Zygote

D. Testicle

79 / 100

Category: Biology

Which of the following will not undergo aldol condensation?

NUMS Mock 2
Chemistry
Aldehydes and Ketones

A) Acetaldehyde

B) Propanaldehyde

C) Benzaldehyde

D) Trideuteroacetaldehyde

80 / 100

Category: Biology Ch 12 Class 12

Productivity of an ecosystem is indicated by

Number of plants in that ecosystem

The density of that ecosystem

Consumption of carbon dioxide and evolve of oxygen

Both a and b

81 / 100

Category: Biology

Q.36 Parkinson’s disease is caused by cell death, which produces ____________.

A. Acetylcholine

B. Serotonin

C. Dopamine

D. Adrenaline

82 / 100

Category: Biology

Q.63 Which hormone is produced mainly by corpus luteum in she ovary following ovulation?

A. Progesterone

B. FSH

C.LH

D. Chorionic gonadotrophic hormone

83 / 100

Category: Biology Ch 6 Class 11

A Dutch scientist firstly observed very small creatures in

PMC Practice 6
Biology
Kingdom Prokaryote
Elimination Tool:

A) Vinegar

B) Saliva

C) Rain water

D) All of Above

84 / 100

Category: Biology

Q.61 These are properties of lipids_________________

A. Insoluble in water and soluble in fat solvent.

B. High energy content

C. Structural component of cell membrane

D. All of these

85 / 100

Category: Biology

Photosystems are located in _

A. Stroma

B. Chloroplast envelope

C. Thylakoid membranes

D. The intergrana

86 / 100

Category: Biology Ch 12 Class 11

A part of the digestive system that is not in contact with food is the:

NTS 2017
Biology
Nutrition
Elimination Tool:

A) Small intestine

C) Liver

B) Stomach

D) Large intestine

87 / 100

Category: Biology

Arrange the following according to the level of protein structures:

a) lysozyme, b) haemoglobin, c) insulin, d) hairs.

NUMS Mock 4
Biology
Biological Molecules

A) c, d, a, b

B) a, b, c, d

C) d, c, b, a

D) a, d, c, b

88 / 100

Category: Biology

Q.27 The stimulus for the production of more gastrin hormone from the gastric endocrine lining is:

A. Protein content of the food

B. Carbohydrate content of the food

C. Lipid content of the food

D. Partially digested food nutrients

89 / 100

Category: Biology

Q.51 The water splitting step of photosynthesis is called?

A Hydrolysis

B. Chemiosmosis

C. Photolysis

D. Photosynthesis

90 / 100

Category: Biology Ch 9 Class 11

Which of the following is true in angiosperm life cycle?

NTS 2014
Biology
Kingdom Plantae
Elimination Tool:

A) Gametophyte are photosynthetic and partially independent than sporophyte

B) Sporophytes are totally dependent on gametophytes

C) Gametophytes are totally dependent on sporophytes

D) Both gametophytes and sporophytes are totally dependent on each other

91 / 100

Category: Biology Ch 3 Class 11

If more substrate to already occurring enzymatic reaction is added more enzyme activity is seen because:

There is probably more substrate present than there is enzyme.

There is probably more enzayme available than there is substrate.

There is probably more product present than there is either substrate or enzyme.

The enzyme substrate complex is probably failing to form during the reaction.

92 / 100

Category: Biology Ch 3 Class 12

Lymph nodes are not present:

NUMS 2020
Biology
Coordination and Control
Elimination Tool:

A) Neck region

B) Axilla

C) Groin

D) Spleen

93 / 100

Category: Biology

The type of plastids found in roots of plants are _____.

NUMS Mock 4
Biology
Cell Structure and Function

A) Chloroplasts

B) Chromoplasts

C) Leucoplasts

D) All of these options are correct

94 / 100

Category: Biology

The diagram represents two liquids, separated by a membrane through which osmosis can occur.

What movement of molecules will occur?

NUMS Mock 3
Biology
Transport

A) Molecules of dissolved substance move from left to right.

B) Molecules of dissolved substance move from right to left.

C) Overall, water molecules move from left to right.

D) Overall, water molecules move from right to left.

95 / 100

Category: Biology

5 different amino acids, numbered 1, 2, 3, 4, and 5, below from the following sequence in the path of a polypeptide chain:

1-2-3-4-2-5-3

Messenger RNA codon, which correspond to the amino acids, are:
amino acid 1 UGU

amino acid 2 GAU

amino acid 3 CAC

amino acid 4 UAG

amino acid 5 AAG

Which one of the following DNA bases sequences could provide the code for the given section of the polypeptide?

NUMS Mock 2
Biology
Biological Molecules

A) ACACTTGTGATGCTATTCGTG

B) ACACUAGUGAUGCUAUUCGUG

C) ACACTAGTGATGCTAAACGTG

D) ACACTAGTGATCCTATTCGTG

96 / 100

Category: Biology Ch 4 Class 12

In asexual reproduction offspring are produced by

Meiosis

Mitosis

Both a and b

None of these

97 / 100

Category: Biology Ch 6 Class 11

Which of the following is not a sterilization method for the control of bacteria?

PMC Practice 4
Biology
Kingdom Prokaryote
Elimination Tool:

A) Radiation

C) High temperature

B) Filtration

D) Antiseptic

98 / 100

Category: Biology Ch 1 Class 11

Group of living organisms of the same species living in the same place at the same time is called

Community

Ecosystem

Biome

99 / 100

Category: Biology

Now-a-days every newborn gets regular shots of vaccine for polio. It contains _________ for polio to make a child immune against this disease.

NUMS Mock 4
Biology
Bio-diversity | Variety of Life

A) Antibiotics

B) Antibodies

C) Antigens

D) Antisera

100 / 100

Category: Biology Ch 8 Class 12

Filial is a Latin word. It means

Spring

Issue

Progeny

Descendent

Your score is

The average score is 61%

Structured Practice for Best Entry Test Preparation

This topic-wise and chapter-wise practice test allows students to focus on individual biology concepts, including diagrams, processes, and conceptual questions. Regular practice enhances understanding, sharpens problem-solving skills, and builds confidence to tackle both board and competitive exam questions efficiently.

Free Resources for Best Entry Test Preparation

Students can access free Biology Practice Test 4 to systematically improve knowledge, recall, and problem-solving abilities. This test is suitable for FSC Board Exams as well as major entry tests, helping students perform better in the biology section. PLS Academy provides these resources to support students in their preparation.

JazakAllah