Biology Practice Test 4

Biology Practice Test 4 is designed to help students strengthen their understanding of key biological concepts, theories, and processes for competitive entry tests like MDCAT, NUMS, AKU, UET, ECAT, NTS, as well as FSC Board Exams. This test covers topics from human anatomy, physiology, microbiology, and ecology, helping students improve accuracy and retention.

PLS Academy

Get Access to 20 thousands+ MCQs Including Topical MCQs, Practice Tests, Mock Tests, Solved Past Papers, Flashcards, Notes, FLPS, and Much More.

UNLOCK PREMIUM🔐

1242

Created by Ali Durrani

MDCAT Practice Tests

Biology Practice Test 4

This is the Free Access to Limited MCQs. Enroll to PLS Boost Premium Bundle to Get More MCQs HERE

1 / 100

Category: Biology Ch 6 Class 11

Which of the following structure primarily helps in attachment of bacteria on various surfaces?

Flagella

Pili

Both of these

None of these

2 / 100

Category: Biology Ch 9 Class 12

Tobacco plants, resistant to a nematode, have been developed by the introduction of DNA that produces (in the host cells):

PMC Practice 11
Biology
Biotechnology
Elimination Tool:

A) Both sense and antisense RNA

B) A particular hormone

C) An antifeedant

D) A toxic protein

3 / 100

Category: Biology Ch 4 Class 12

Gametes in animals are produced by

Mitosis

RedMeiosis

BlueFission

Apomixis

4 / 100

Category: Biology Ch 5 Class 11

There are 3 stages of HIV infection, which sequence is correct

PMC Sample 1
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) AIDS, Chronic HIV, Acute HIV

B) Chronic HIV, AIDS, Acute HIV

C) Acute HIV, Chronic HIV, AIDS

D) all of them

5 / 100

Category: Biology

Q4 A condition with abnormal amount of fats is called:

A. anorexia

B. botulism

C. piles

D. obesity

6 / 100

Category: Biology Ch 9 Class 12

The genetically engineered vaccine is available for which of the following hepatitis virus?

PMC Practice 5
Biology
Biotechnology
Elimination Tool:

A) HBV

B) HAV

C) HCV

D) Options A and B are correct

7 / 100

Category: Biology Ch 14 Class 11

How many ml of blood is pumped by each contraction of the heart?

NUMS 2016
Biology
Transport
Elimination Tool:

A) 80 ml

B) 90 ml

C) 70 ml

D) 60 ml

8 / 100

Category: Biology Ch 1 Class 12

Among the followings which is the most longest supportive cell?

Tracheids

Sclereids

Trachea

Collenchyma cells

9 / 100

Category: Biology Ch 7 Class 12

Exchange of segments between homologous chromosomes is called:

UHS 2012
Biology
Cell Cycle
Elimination Tool:

A) Segregation

B) Independent assortment

C) Crossing over

D) Mutation

10 / 100

Category: Biology

The light dependent reaction of photosynthesis occurs in:

NUMS Mock 2
Biology
Bioenergetics

A) Stroma of chloroplast

B) Guard cells of stomata

C) Thylakoid membrane of chloroplast

D) Cytoplasm of leaf cell

11 / 100

Category: Biology Ch 3 Class 12

The 1st human hormone produced by recombinant DNA technology was:

NUMS 2016
Biology
Coordination and Control
Elimination Tool:

A) Estrogen

B) Testosterone

C) Cortisone

D) Insulin

12 / 100

Category: Biology Ch 12 Class 12

Development of bark in plants and skin in animals is a method for

Providing support

Protection from enemies

Reducing water loss

Helping in food production

13 / 100

Category: Biology Ch 8 Class 12

When both the alleles of a gene pair are same, the organism is said to be:

PMC 2020
Biology
Variation and Genetics
Elimination Tool:

A) Heterozygous

B) Genotype

C) Homozygous

D) Phenotype

14 / 100

Category: Biology Ch 10 Class 11

Coelom is lined by

Parietal mesoderm

Visceral mesoderm

Mesoderm

Both A & B

15 / 100

Category: Biology Ch 6 Class 12

Which of the following is NOT the part of RNA?

NTS 2018
Biology
Chromosomes and DNA
Elimination Tool:

A) Nitrogenous bases

B) Ribose Sugars

C) Deoxyribose Sugars

D) Phosphate groups

16 / 100

Category: Biology

Optimum pH for action of pepsin and salivary amylase is

NUMS Mock 2
Biology
Nutrition

A) 3.5 and 7.7 respectively

B) 1.8 and 6.8 respectively

C) 6.8 and 7.4 respectively

D) 1.8 and 7.4 respectively

17 / 100

Category: Biology Ch 6 Class 11

If lipopolysaccharides did not appear in the wall of bacteria on staining then it will be known as ________.

UHS 2018
Biology
Kingdom Prokaryote
Elimination Tool:

A) Gram negative

B) Gram positive

C) Capsule

D) Both Gram positive & negative

18 / 100

Category: Biology Ch 8 Class 11

Which of the following group represent pathological fungi?

Mushrooms morels and truffles

Rusts smuts and molds

Penicillium

All of these

19 / 100

Category: Biology Ch 11 Class 11

Which of the following is a chemical link between catabolism and anabolism?

AMP

ADP

ATP

All of these

20 / 100

Category: Biology Ch 10 Class 12

Carolus Linnaeus was believer of

Special creation

Natural selection

Catastrophism

. Inheritance of acquired characters

21 / 100

Category: Biology Ch 4 Class 11

A group of ribosomes attached to mRNA is known as

Polymer

Polypeptide

Polysomes

Monomer

22 / 100

Category: Biology Ch 3 Class 12

The correct option about spinal nerves is:

NUMS 2020
Biology
Coordination and Control
Elimination Tool:

A) 33 pairs

B) Mostly mixed nerves

C) Dorsal root contains sensory neurons

D) Ventral root contains motor neurons

E) C and D both

23 / 100

Category: Biology Ch 9 Class 12

Commonly used restriction enzyme is

pSC 101

pBR 322

EcoRI

All of these

24 / 100

Category: Biology Ch 4 Class 11

Percentage of proteins in cell membrane is

20-40%

40-50%

60-80%

80-100%

25 / 100

Category: Biology Ch 9 Class 12

A single stranded nucleotide sequence that will hybridize into a certain piece of DNA is

Primer

Probe

Genome

Both a & b

26 / 100

Category: Biology

Q.24 When was the bacteriopbage phenomena rediscovered by D’Herelle?

A. 1918

B. 1917

C. 1920

D. 1990

27 / 100

Category: Biology Ch 14 Class 11

The function of papillary muscles is to:

NUMS 2020
Biology
Transport
Elimination Tool:

A) Move blood from semilunar valve into pulmonary vein

B) Prevent the backward flow of blood from the ventricle

C) Push the blood from right atrium to left atrium

D) Push the blood from left atrium to aorta

28 / 100

Category: Biology Ch 14 Class 11

Which of the following blood vessels have the highest pressure of blood?

NUMS 2020
Biology
Transport
Elimination Tool:

A) Aorta

B) Pulmonary arteries

C) Pulmonary veins

D) Vena Cava

29 / 100

Category: Biology Ch 13 Class 11

Gaseous exchange in plants takes place through the:

NUMS 2020
Biology
Gaseous Exchange
Elimination Tool:

A) Stomata

B) Mesophyll

C) Endoderm

D) Xylem

30 / 100

Category: Biology

A man who has type AB blood cannot father a child with type ___ blood, because he would pass on either the ___ or the B allele to all of his offspring.

NUMS Mock 4
Biology
Variation and Genetics

A) A,O

B) O,A

C) B, O

D) B, A

31 / 100

Category: Biology Ch 12 Class 11

Optimum pH for action of pepsin and salivary amylase is

NTS 2016 DUHS & JSMU
Biology
Nutrition
Elimination Tool:

A) 3.5 and 7.7 respectively

B) 1.8 and 6.8 respectively

C) 6.8 and 7.4 respectively

D) 1.8 and 7.4 respectively

32 / 100

Category: Biology

Q.33 The presence of peptidoglycan in Gram positive bacteria is

A. 40% of dry weight

B. 50% of dry weight

C. 10% of dry weight

D. 80%% of dry weight

33 / 100

Category: Biology Ch 9 Class 12

Genetic engineering has been successfully used for producing;

UHS 2019
Biology
Biotechnology
Elimination Tool:

A) Animals, with inferior traits.

B) Transgenic mice for testing safety of polio vaccine before use in humans

C) Animals, that have the same genetic constitution.

D) None of the above

34 / 100

Category: Biology Ch 2 Class 11

% of water in brain cells is

20%

80%

85%

90%

35 / 100

Category: Biology Ch 3 Class 11

Antibodies can be digested by using which of the following types of enzymes?

PMC Sample 3
Biology
Enzymes
Elimination Tool:

A) Lipase

B) Protease

C) Amylase

D) Polymerase

36 / 100

Category: Biology Ch 5 Class 11

The shape of the tobacco mosaic virus is:

NUMS 2016
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Spring shape

B) Rod shape

C) Comma shape

D) Spherical shape

37 / 100

Category: Biology

5 different amino acids, numbered 1, 2, 3, 4, and 5, below from the following sequence in the path of a polypeptide chain:

1-2-3-4-2-5-3

Messenger RNA codon, which correspond to the amino acids, are:
amino acid 1 UGU

amino acid 2 GAU

amino acid 3 CAC

amino acid 4 UAG

amino acid 5 AAG

Which one of the following DNA bases sequences could provide the code for the given section of the polypeptide?

NUMS Mock 2
Biology
Biological Molecules

A) ACACTTGTGATGCTATTCGTG

B) ACACUAGUGAUGCUAUUCGUG

C) ACACTAGTGATGCTAAACGTG

D) ACACTAGTGATCCTATTCGTG

38 / 100

Category: Biology Ch 3 Class 12

At the induction of action potential opening of Na+ gate with influx of Na+ is a _________ processes:

Active transport

Passive transport.

Diffusion

none of these.

39 / 100

Category: Biology

The passageways of the respiratory system have mucous secreting cells called:

NUMS Mock 3
Biology
Gaseous Exchange

A) Tracheal cells

B) Goblet cells

C) Surfactant cells

D) Pleural cells

40 / 100

Category: Biology Ch 8 Class 12

If we cross round yellow seeded plant with green wrinkled seeded plants, what will be phenotypic ratio at F2 generation?

NUMS 2019 Cancelled
Biology
Variation and Genetics
Elimination Tool:

A) 9:3:3:1

B) 9:4:3:2

C) 3:9:3:1

D) 8:3:3:2

41 / 100

Category: Biology Ch 2 Class 11

Human cells maintain concentration gradients across their plasma membranes, such that there is a high sodium concentration outside the cell and a high potassium concentration inside the cell.

Suppose that within the cell membrane are sodium leak channels or carrier proteins. These channels would allow sodium to:

NTS 2017
Biology
Biological Molecules
Elimination Tool:

A) move out of the cell by simple diffusion

B) move into the cell by simple diffusion

C) move out of the cell by facilitated diffusion

D) move into the cell by facilitated diffusion

42 / 100

Category: Biology

Q47 The T-lymphocytes and B-lymphocytes are the major cells of the:

A. Thymus

B. Lymph nodes

C. Adrenal glands

D. Lymphatic vessels

43 / 100

Category: Biology Ch 7 Class 11

Which of the following is used as a biological weapon?

PMC 2021 Tested
Biology
Kingdom Protista
Elimination Tool:

A) Radiation

B) All of these

C) Chemicals

D) Virus

44 / 100

Category: Biology

Which of the following will not undergo aldol condensation?

NUMS Mock 2
Chemistry
Aldehydes and Ketones

A) Acetaldehyde

B) Propanaldehyde

C) Benzaldehyde

D) Trideuteroacetaldehyde

45 / 100

Category: Biology Ch 12 Class 11

Of the following, which one has more variety of nutrition?

Animals

Bacteria

Plants

Fungi

46 / 100

Category: Biology Ch 14 Class 11

75% osmotic pressure of blood is maintained by:

NUMS 2015
Biology
Transport
Elimination Tool:

A) Globulin

C) Fibrinogen

B) Prothrombin

D) Albumin

47 / 100

Category: Biology Ch 9 Class 12

A single gene can be amplified by using:

NUMS 2019 Reconduct
Biology
Biotechnology
Elimination Tool:

A) DNA fingerprinting

B) Polymerase Chain Reaction

C) Gel Electrophoresis

D) Recombinant DNA technology

48 / 100

Category: Biology Ch 2 Class 12

Which one of the following forms the blk of exoskeleton of an arthropod?

Epicuticle

Procuticle

Ectocuticle

None of these

49 / 100

Category: Biology Ch 5 Class 11

The genome of viruses is composed of

NTS 2019
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) DNA

B) RNA

C) Protien

D) Both A and B

50 / 100

Category: Biology

Golgi complex is responsible for the formation of secretory granules in _____ cell.

NUMS Mock 4
Biology
Cell Structure and Function

A) Stomach

B) Liver

C) Pancreatic

D) Muscle

51 / 100

Category: Biology Ch 9 Class 12

This enzyme is used to cut DNA molecule in rDNA technology

PMC Sample 2
Biology
Biotechnology
Elimination Tool:

A) ligase

B) phosphatase

C) ribonuclease

D) restriction enzyme

52 / 100

Category: Biology Ch 2 Class 12

Number of bones in the skull:

NUMS 2016
Biology
Support and Movement
Elimination Tool:

A) 22

B) 26

C) 24

D) 28

53 / 100

Category: Biology Ch 2 Class 12

Epinasty is controlled by

Gibberellins

Abscisins

Auxins

Cytokinins

54 / 100

Category: Biology Ch 4 Class 12

Amniocentesis is performed between the:

NTS 2011
Biology
Reproduction
Elimination Tool:

A) 16th and 18th week of gestation

B) 1st and 2nd week of gestation

C) 30th and 32nd week of gestation

D) 37th and 38th week of gestation

55 / 100

Category: Biology Ch 7 Class 11

Freshwater protozoans pump out excess water by a special structure called:

NUMS 2017
Biology
Kingdom Protista
Elimination Tool:

A) Oral groove

B) Contractile vacuole

C) Vesicle

D) Vacuole

56 / 100

Category: Biology

The gene which controls the ABO group has how many alleles in an individual?

NUMS Mock 3
Biology
Variation and Genetics

A) 1.

B) 2.

C) 3.

D) 4.

57 / 100

Category: Biology Ch 6 Class 12

Which of the following can be blocked, if one wants to stop translation of mRNA?

NUMS 2019 Reconduct
Biology
Chromosomes and DNA
Elimination Tool:

A) RNA polymerase

B) Helicase

C) Elongation factor

D) Primase

58 / 100

Category: Biology Ch 6 Class 11

The cell membrane of a bacterial cell often invaginates to produce membranous structures referred to as:

NUMS 2017
Biology
Kingdom Prokaryote
Elimination Tool:

A) Centrosomes

B) Mesosomes

C) Dictyosomes

D) Polysomes

59 / 100

Category: Biology

Egg-Laying mammals are called:

NUMS Mock 3
Biology
Reproduction

B) Protozoa

C) Chordata

D) Monotremes

E) Both A and D

60 / 100

Category: Biology Ch 6 Class 12

The number of base pairs in a complete helical turn is/are:

NUMS 2020
Biology
Chromosomes and DNA
Elimination Tool:

A) 1

B) 5

C) 10

D) 15

61 / 100

Category: Biology

Q.48 Octopus belongs to phylum mollusca because:

A. It has suckers and tentacles.

B. It has a soft body covered by a shell.

C. It has a soft, unsegmented body with a thin, flexible internal shell

D. It has a soft, segmented body with a head and a foot.

62 / 100

Category: Biology Ch 10 Class 12

Lamarck is best known for his theory of:

NUMS 2016
Biology
Evolution
Elimination Tool:

A) Inheritances

B) Dominance

C) Inheritance of acquired characteristics

D) All of the above

63 / 100

Category: Biology Ch 10 Class 12

Homology means

PMC Sample 3
Biology
Evolution
Elimination Tool:

A) similiarity in characteristics resulting from common ancestors

B) similarity in function from acquired characterists

C) study of different ograns but with similar functions

D) study of similar ograns but with different functions

64 / 100

Category: Biology

Q.51 The water splitting step of photosynthesis is called?

A Hydrolysis

B. Chemiosmosis

C. Photolysis

D. Photosynthesis

65 / 100

Category: Biology Ch 2 Class 12

The number of vertebrate in horse neck are:

NUMS 2014
Biology
Support and Movement
Elimination Tool:

A) 5

B) 6

C) 7

D) 10

66 / 100

Category: Biology Ch 12 Class 11

Autotrophic organisms can exist in an exclusively ______ environment.

Organic

Inorganic

Wet

Terrestrial

67 / 100

Category: Biology Ch 8 Class 12

In ‘Complete Dominance’:

PMC 2020
Biology
Variation and Genetics
Elimination Tool:

A) Different alleles of a gene are both expressed in heterozygous condition

B) One allele (R) is completely dominant over the other (r) and the presence of the recessive allele is functionally hidden, so the heterozygote (Rr) has the same round phenotype as (RR) homozygote.

C) The phenotype of the heterozygote is intermediate between phenotypes of the two homozygotes

D) Gene mutations may produce many different alleles of a gene

68 / 100

Category: Biology Ch 3 Class 11

A three dimensional dcavity bearing a specific charge by which the enzyme reacts with its substrate is called

Active site

Binding site

Catalytic site

Allosteric site

69 / 100

Category: Biology

Below the point at which the cotyledons are attached, the embryo axis is called _______.

NUMS Mock 2
Biology
Kingdom Plantae

A) Radicle

B) Epicotyl

C) Hypocotyl

D) Coleoptile

70 / 100

Category: Biology Ch 4 Class 11

Which of the following is not a basic unit of the cell?

NUMS 2016
Biology
Cell Structure and Function
Elimination Tool:

A) Cell wall

B) Cell membrane

C) Nucleus

D) Ribosome

71 / 100

Category: Biology Ch 6 Class 11

A bacterial cell envelope of mollicutes does not include?

PMC Sample 1
Biology
Kingdom Prokaryote
Elimination Tool:

A) Slime

B) Capsule

C) Cell wall

D) Cell membrane

72 / 100

Category: Biology Ch 6 Class 11

Coccobacillus has a shape similar to

Diplobacillus

Sarcina

Egg

None of these

73 / 100

Category: Biology

Q.54 First cardiac sound is associated with:

A. Closure of tricuspid and bicuspid valves

B. Closure of semilunar valves

C. Opening of tricuspid valves

D. Opening of semilunar valves

74 / 100

Category: Biology Ch 13 Class 11

The structural and functional unit of the lungs is:

PMC Practice 2
Biology
Gaseous Exchange
Elimination Tool:

A) Alveoli

B) Trachea

C) Bronchiole

D) Bronchus

75 / 100

Category: Biology Ch 11 Class 11

Estimating relative CO2 consumption or O2 release during photosynthesis at different wavelengths of light, is termed as:

NUMS 2019 Reconduct
Biology
Bioenergetics
Elimination Tool:

A) Action spectrum

B) Absorption spectrum

C) Dark reaction

D) Light reaction

76 / 100

Category: Biology

Q.31 The movement of minerals or water via extracellular pathway is known as:

A. Symplast

B. Apoplast

C. Vascular

D. None of these

77 / 100

Category: Biology Ch 6 Class 11

Which one of the following sets includes the bacterial diseases?

NUMS 2014
Biology
Kingdom Prokaryote
Elimination Tool:

A) Cholera, typhoid, mumps

B) Tetanus, tuberculosis, measles

C) Malaria, mumps, poliomyelitis

D) Diphtheria, leprosy, plague

78 / 100

Category: Biology

Q.50 How does each photoexcited electron pass from PS1 to PS2?

A. ETC

B. chemiosmosis

C. photolysis

D. photosynthesis

79 / 100

Category: Biology Ch 2 Class 12

Which of the following bones are present in the palm of the hand:

NTS 2010
Biology
Support and Movement
Elimination Tool:

A) Carpals

B) Metacarpals

C) Phalanges

D) Tarsal

80 / 100

Category: Biology Ch 3 Class 12

Direction of reflex action is from:

NUMS 2019 Reconduct
Biology
Coordination and Control
Elimination Tool:

A) Receptor to sensory neuron to motor neuron and then through associative neurons to effect.

B) Receptor to sensory neuron to associative neuron and then through motor neurons to effector.

C) Effector to sensory neuron to associative neuron and then through motor neurons to Receptor.

D) Effector to sensory neuron to motor neuron and then through associative neurons to Receptor.

81 / 100

Category: Biology Ch 7 Class 12

Spread of tumor cells and establishment of secondary areas of growth is

Benign tumors

Cancer

Metastasis

Epistasis

82 / 100

Category: Biology Ch 10 Class 11

Aschelminthes is also known as

Protozoans

Eumatazoa

Nematodes

Protoctist ancestors

83 / 100

Category: Biology Ch 5 Class 11

Other name for Kingdom monera is:

Protoctista

Prokaryotae

Archae

None of these

84 / 100

Category: Biology Ch 3 Class 11

Optimum temperature for enzymes of human body is:

NUMS 2018
Biology
Enzymes
Elimination Tool:

A) 90 F

B) 95 F

C) 98 F

D) 100 F

85 / 100

Category: Biology Ch 13 Class 11

Pharynx leads air into _____ through glottis.

NTS 2012
Biology
Gaseous Exchange
Elimination Tool:

A) Trachea

B) Bronchus

C) Alveoli

E) Larynx

86 / 100

Category: Biology Ch 7 Class 12

The second stage of the Prophase of Meiosis, following Leptotene, during which homologous chromosomes begin to pair is called:

NTS 2019
Biology
Cell Cycle
Elimination Tool:

A) Anaphase

B) Zygotene

D) Pachytene

C) Diplotene

87 / 100

Category: Biology Ch 8 Class 12

Continuous variations in a population were first observed by:

NUMS 2015
Biology
Variation and Genetics
Elimination Tool:

A) Mendel

B) Correns

C) Nilsson

D) Darwin

88 / 100

Category: Biology Ch 4 Class 11

Magnifying power of electron microscope as compared to eye is

500 X

250000X

500000X

250X

89 / 100

Category: Biology Ch 9 Class 11

The most successful land adapting plants are:

NUMS 2020
Biology
Kingdom Plantae
Elimination Tool:

A) Mosses

B) Ferns

C) Gymnosperms

D) Angiosperms

90 / 100

Category: Biology Ch 10 Class 12

Consider the following statements about biological communities.

I. Their members share a common gene pool

II. The community remains stable even though some physical aspect of the environment may undergo a change

III. It consists of all the populations living in a particular area.

IV. A community interacts with a non-living environment and both function together to form an ecosystem

Which two of the above statements are true?

NTS 2014
Biology
Evolution
Elimination Tool:

A) 1 and 2

B) 1 and 3

D) 2 and 3

E) 3 and 4

91 / 100

Category: Biology Ch 2 Class 12

Unpaired facial bones are:

NUMS 2018
Biology
Support and Movement
Elimination Tool:

A) Maxilla, Zygomatic

B) Palatine, Inferior concha

C) Nasal, Lacrimal

D) Mandible, Vomer

92 / 100

Category: Biology Ch 5 Class 11

Organisms of which of the following kingdom have absorptive mode of nutrition:

Prokaryotae

Protoctista

Animalia

Fungi

93 / 100

Category: Biology Ch 2 Class 11

Peptide bonds are formed between:

NUMS 2014
Biology
Biological Molecules
Elimination Tool:

A) Hydrogen groups of adjacent amino acids

B) Non-functional groups of the amino acids

C) Carboxyl groups and amino groups

D) Functional groups and hydrogen groups of adjacent amino acids

94 / 100

Category: Biology

Q.5 Which statement is incorrect?

A. In short day plants red light prevents flowering

B. In long day plants for red light promotes flowering

C. Leaf unrolling occurs in grasses

D. Henbane is a short-day plant

95 / 100

Category: Biology Ch 3 Class 12

Which of the following is antagonist to Auxin in terms of promotion of stem growth?

Gibberellins

Cytokinins

Abscisic Acid

none of these.

96 / 100

Category: Biology Ch 6 Class 11

The presence of peptidoglycan in gram-positive bacteria is:

PMC Practice 3
Biology
Kingdom Prokaryote
Elimination Tool:

A) 40% of dry weight

B) 50% of dry weight

D) 80% of dry weight

C) 10% of dry weight

97 / 100

Category: Biology Ch 1 Class 12

Marine fish can keep their internal environment hypertonic with respect to the surrounding salty water by retaining.

Excessive urea which will increase their internal solute concentration and prevent body shrinkage in hypertonic environment

Trimethyl alanine

Ammonia

Trimethylamine oxide

98 / 100

Category: Biology Ch 1 Class 12

Which of the following statement about Homeostasis is incorrect

There is a definite control system that regulates the homeostatic activities

Homeostatic mechanisms keep the internal environment fixed despite of wide changes in external environment

Because of this the fluctuations of internal environment are of extremely narrow range as compared to that of external environment

All are correct

99 / 100

Category: Biology Ch 5 Class 12

Typical symptoms like enlarged breasts and small testis in male are attributed to:

UHS 2015
Biology
Growth and Development
Elimination Tool:

A) Down’s Syndrome

B) Turner’s Syndrome

C) Klinefelter’s Syndrome

D) Phenylketonuria

100 / 100

Category: Biology Ch 6 Class 11

A type of bacterial cell that is completely surrounded by flagella is called:

PMC Practice 5
Biology
Kingdom Prokaryote
Elimination Tool:

A) Diplococcus

B) Tetrad

C) Peritrichous

D) Munotrichous

Your score is

The average score is 61%

Structured Practice for Best Entry Test Preparation

This topic-wise and chapter-wise practice test allows students to focus on individual biology concepts, including diagrams, processes, and conceptual questions. Regular practice enhances understanding, sharpens problem-solving skills, and builds confidence to tackle both board and competitive exam questions efficiently.

Free Resources for Best Entry Test Preparation

Students can access free Biology Practice Test 4 to systematically improve knowledge, recall, and problem-solving abilities. This test is suitable for FSC Board Exams as well as major entry tests, helping students perform better in the biology section. PLS Academy provides these resources to support students in their preparation.

JazakAllah