Biology Practice Test 4

Biology Practice Test 4 is designed to help students strengthen their understanding of key biological concepts, theories, and processes for competitive entry tests like MDCAT, NUMS, AKU, UET, ECAT, NTS, as well as FSC Board Exams. This test covers topics from human anatomy, physiology, microbiology, and ecology, helping students improve accuracy and retention.

PLS Academy

Get Access to 20 thousands+ MCQs Including Topical MCQs, Practice Tests, Mock Tests, Solved Past Papers, Flashcards, Notes, FLPS, and Much More.

UNLOCK PREMIUM🔐

1244

Created by Ali Durrani

MDCAT Practice Tests

Biology Practice Test 4

This is the Free Access to Limited MCQs. Enroll to PLS Boost Premium Bundle to Get More MCQs HERE

1 / 100

Category: Biology Ch 11 Class 11

Estimating relative CO2 consumption or O2 release during photosynthesis at different wavelengths of light, is termed as:

NUMS 2019 Reconduct
Biology
Bioenergetics
Elimination Tool:

A) Action spectrum

B) Absorption spectrum

C) Dark reaction

D) Light reaction

2 / 100

Category: Biology Ch 6 Class 12

Haploid and monoploid numbers of chromosomes of hexaploid wheat are:

NTS 2014
Biology
Chromosomes and DNA
Elimination Tool:

A) 21 and 42

B) 7 and 21

C) 21 and 7

D) 42 and 21

3 / 100

Category: Biology Ch 2 Class 12

Which of the following bones are present in the palm of the hand:

NTS 2010
Biology
Support and Movement
Elimination Tool:

A) Carpals

B) Metacarpals

C) Phalanges

D) Tarsal

4 / 100

Category: Biology Ch 1 Class 12

Which of the following statement about conifers is correct?

Stored excretory products in vacuoles, at a concentration that leads to crystal formation.

ccumulate waste in leaves, which fall in autumn.

Production of black wood in the center.

Excrete some of the waste materials directly into soil, occasionally using them as a chemical weapon against other competing plants.

5 / 100

Category: Biology Ch 2 Class 11

The melting point of unsaturated fatty acids:

NUMS 2019 Reconduct
Biology
Biological Molecules
Elimination Tool:

A) Increases with increase in double bonds

B) Decreases with increase in double bonds

C) Rises in some and falls in others

D) There is no relationship between unsaturation and melting point

6 / 100

Category: Biology

Q.36 The ETC in plants consists of an electron carrier called?

A. Pq

B. Pc

C. Pt

D.Po

7 / 100

Category: Biology Ch 10 Class 12

Which one is NOT a continuous trait?

NUMS 2019 Reconduct
Biology
Evolution
Elimination Tool:

A) Human height

B) Tongue rolling

C) Wheat grain color

D) Human skin color

8 / 100

Category: Biology

The system responsible for fighting the pathogens is:

NUMS Mock 4
Biology
Transport

A) Muscular System

B) Endocrine System

C) Nervous System

D) Immune System

9 / 100

Category: Biology

Which of the following photosystems is involved in cyclic photophosphorylation?

NUMS Mock 2
Biology
Bioenergetics

A) PS II

B) PS I

C) PS I and PS II

D) PS III

10 / 100

Category: Biology Ch 10 Class 12

Who developed a theory of natural selection essentially identical to Darwin’s

Hardy-Weinberg

Alfred Wallace

Malthus

Lyell

11 / 100

Category: Biology Ch 9 Class 11

Which one of the following types of cell are found in secondary xylem of angiosperms?

NTS 2015 DUHS and JSMU
Biology
Kingdom Plantae
Elimination Tool:

A) Tracheids parenchyma fibres collenchyma but no vessels

B) Vessels tracheids parenchyma collenchyma but no fibres

C) Vessels tracheids fibres collenchyma but no parenchyma

D) Vessels tracheids fibres parenchyma but no collenchyma

12 / 100

Category: Biology Ch 6 Class 12

In semi-conservative replication

. Sequence of original duplex is conserved after one round of replication

Gererate DNA copies of entirely new molecules

Parental DNA become completely dispersed

Each strand of daughter molecules will be a mixture of old and new

13 / 100

Category: Biology Ch 7 Class 11

Brown algae are also known as

Phaeophyta

Rhodophyta

Pyrrophyta

Chrysophyta

14 / 100

Category: Biology

Q.29 Fluid secreted by Sertoli cells provides sperms with which of the following ?

A. Liquid medium

B. Protection

C. Nourishment

D. All of these

15 / 100

Category: Biology Ch 8 Class 11

Yeasts, the unicellular fungi belongs mostly to the group:

UHS 2018
Biology
Kingdom Fungi
Elimination Tool:

A) Deuteromycota

C) Basidiomycota

B) Zygomycota

D) Ascomycota

16 / 100

Category: Biology

The photosynthetic pigments of plants are arranged as clusters in thylakoid membranes. The reaction centers of these clusters consist of _____ molecules.

NUMS Mock 3
Biology
Bioenergetics

A) Chlorophyll

B) ATP

C) Carotenoids

D) Glucose

17 / 100

Category: Biology Ch 5 Class 11

Viruses are ______ smaller than bacteria

10 – 100 times

10 – 1000 times

1000 – 10000 times

18 / 100

Category: Biology

Q.9 This is a reduced compound

A. CO2

B. O2

C. NADH

D. NAD

19 / 100

Category: Biology Ch 5 Class 12

In cystic fibrosis, liposomes-microscopic vesicles are sued which are coated with:

UHS 2015
Biology
Growth and Development
Elimination Tool:

A) Healthy Gene

B) Chromosome

D) Carbohydrate

C) Protein

20 / 100

Category: Biology Ch 12 Class 11

Puccinia commonly destroys

Corn

Tomato

Dodder

Wheat

21 / 100

Category: Biology Ch 11 Class 11

FADH2 is produced during which step of Krebs cycle?

NUMS 2015
Biology
Bioenergetics
Elimination Tool:

A) When Isocitrate is converted into alpha – ketoglutarate

B) When alpha – Ketogluterate is converted into Succinate

C) When Succinate is converted into Fumarate

D) When Fumarate is converted into Maltose

22 / 100

Category: Biology

The region where the impulse moves from one neuron to another is called ______.

NUMS Mock 4
Biology
Coordination and Control

A) Axon

B) Dendrites

C) Synapse

D) Thalamus

23 / 100

Category: Biology Ch 5 Class 12

All of the followings are the effects of red light on plant, EXCEPT:

NTS 2016 SMBBMC
Biology
Growth and Development
Elimination Tool:

A) Causes epicotyl (plumule) hook to unbend

B) Induces increase in leaf area

C) Elongation of internodes is promoted

D) Stimulate flowering in long day plants

24 / 100

Category: Biology Ch 3 Class 12

Which one of the following is common to all neurons?

PMC 2020
Biology
Coordination and Control
Elimination Tool:

A) A cell body which contains a nucleus

B) A thick myelin sheath

C) Presence of node of Ranvier

D) Presence of Schwann cells

25 / 100

Category: Biology Ch 6 Class 11

Apparently which bacteria is more resistant to antibiotics?

NUMS 2017
Biology
Kingdom Prokaryote
Elimination Tool:

A) Gram-positive bacteria

B) Gram-negative bacteria

C) Both Gram-negative and positive bacteria

D) None of these options are correct

26 / 100

Category: Biology Ch 12 Class 11

Stunted growth of roots is due to the deficiency of _____ in plants

Potassium

Magnesium

Phosphorus

Iron

27 / 100

Category: Biology Ch 6 Class 11

A group of 8 cocci is called

Diplococci

Octococci

Tetrad

Sarcina

28 / 100

Category: Biology Ch 7 Class 11

Trypanosoma is a human parasite causing

UHS 2010
Biology
Kingdom Protista
Elimination Tool:

A) African sleeping sickness

B) European sleeping sickness

C) Indonesian sleeping sickness

D) American sleeping sickness

29 / 100

Category: Biology

DNA fingerprinting is basically done for:

NUMS Mock 1
Biology
Biotechnology

A) DNA cloning

B) DNA analysis

C) DNA sequencing

D) DNA splicing

30 / 100

Category: Biology Ch 1 Class 11

The study of fossils is called:

Environmental Biology

Historical biology

Palaeontology

Social biology

31 / 100

Category: Biology Ch 10 Class 12

What is in q2 Hardy Weinberg equilibrium?

NTS 2019
Biology
Evolution
Elimination Tool:

A) Frequency of the dominant allele

B) Frequency of the recessive allele

C) Frequency of both alleles

D) Number of both alleles

32 / 100

Category: Biology Ch 3 Class 12

Which of the following statement about neuron is incorrect?

They not only conduct impulses but also generate them.

They are not the only cellular component of nervous system.

They may show limited regenerative capabilities.

Like all the living cell, when they mature and divide to form similar cells.

33 / 100

Category: Biology Ch 12 Class 11

Milk drinking babies have an additional enzyme called:

NUMS 2016
Biology
Nutrition
Elimination Tool:

A) Rennin

B) Amylase

C) Lipase

D) None of these options are correct

34 / 100

Category: Biology Ch 4 Class 12

Hydra reproduces asexually by:

NUMS 2014
Biology
Reproduction
Elimination Tool:

A) Binary fission

B) Multiple fission

D) Regeneration

C) Budding

35 / 100

Category: Biology Ch 4 Class 11

Movement of the material across the cell membrane which does not requiring expenditure of metabolic energy is called

Active transport

Passive transport

Co-transport

Counter transport

36 / 100

Category: Biology Ch 9 Class 11

Which of the following of bryophytes are the simplest one?

Porella

Funaria

Anthocerus

Polytrichum

37 / 100

Category: Biology

Q.13 The frequency of allele if it is evolutionary successful is?

A. increased

B. Enzymes

C. no change

D. All of these

38 / 100

Category: Biology

Many scientists believe that one of the following is evolutionary origin(s) of animals, plants and fungi?

NUMS Mock 1
Biology
Evolution

A) Protists

B) Algae

C) Bacteria

D) Protozoans

39 / 100

Category: Biology Ch 4 Class 11

Chief material present in the cell wall of plants, fungal, and prokaryotic cells is:

NUMS 2020
Biology
Cell Structure and Function
Elimination Tool:

A) Proteins

B) Lipids

C) Polysaccharides

D) Phospholipids

40 / 100

Category: Biology Ch 9 Class 11

What is the strengthening material of the prokaryotic cell wall?

PMC Practice 7
Biology
Kingdom Plantae
Elimination Tool:

A) Cellulose

B) Chitin

C) Silica waxes and lignin

D) Peptidoglycan or murein

41 / 100

Category: Biology Ch 8 Class 12

Hybrid black Guinea pigs are crossed with each other. The resulting offsprings will be:

NUMS 2016
Biology
Variation and Genetics
Elimination Tool:

A) All black

B) All white

C) 3 black, 1 white

D) 3 white, 1 black

42 / 100

Category: Biology

Q.49 Another name for the sex cell is:

A. Hormone

B. Gamete

C. Zygote

D. Testicle

43 / 100

Category: Biology Ch 7 Class 12

Which is a feature of malignant tumor?

Localized

Little deleterious effect

Few mitosis

Metastasize

44 / 100

Category: Biology Ch 10 Class 12

Consider the following statements about biological communities.

I. Their members share a common gene pool

II. The community remains stable even though some physical aspect of the environment may undergo a change

III. It consists of all the populations living in a particular area.

IV. A community interacts with a non-living environment and both function together to form an ecosystem

Which two of the above statements are true?

NTS 2014
Biology
Evolution
Elimination Tool:

A) 1 and 2

B) 1 and 3

D) 2 and 3

E) 3 and 4

45 / 100

Category: Biology

Q.65 Which one of the following is the attribute of Lamarckism?

A. Natural selection

B. Inheritance of acquired characteristics

C. Struggle for existence

D. Production of more individuals

46 / 100

Category: Biology

Which substance might include this molecule?

NUMS Mock 4
Biology
Biological Molecules

A) Cellulose

B) Cholesterol

C) Glycerol

D) Insulin

47 / 100

Category: Biology

Which of the following enzymes is used to join DNA fragments?

NUMS Mock 4
Biology
Chromosomes and DNA

A) DNA polymerase

B) Ligase

C) Primase

D) Endonuclease

48 / 100

Category: Biology Ch 5 Class 12

Vegetative roots and shoots grow by

Determinate growth

Primary growth only

Indeterminate growth

None of these

49 / 100

Category: Biology Ch 14 Class 11

Identify the only cells in leaf epidermis, which are NOT connected to other cells by plasmodesmata and are involved in photosynthesis.

NUMS 2019 Reconduct
Biology
Transport
Elimination Tool:

A) Epidermal cells

B) Spongy mesophyll cells

C) Guard cells

D) Palisade mesophyll cells

50 / 100

Category: Biology Ch 8 Class 12

The type of gene interaction in which the effect caused by a gene at one locus interfere with the effect caused by another gene at another locus is known as:

NUMS 2018
Biology
Variation and Genetics
Elimination Tool:

A) Pleiotropy

B) Epistasis

C) Polygenic inheritance

D) Gene linkage

51 / 100

Category: Biology Ch 10 Class 11

The radial symmetry is found in the animals of

Protozoa

Porifera

Cnidaria

All of these

52 / 100

Category: Biology Ch 7 Class 11

The only group of algae having no flagellated motile cells at any stage is :

Chrysophyta

Phaeophyta

Pyrrophyta

Rhodophyta

53 / 100

Category: Biology Ch 2 Class 11

5 different amino acids, numbered 1, 2, 3, 4, and 5, below from the following sequence in the path of a polypeptide chain:

1-2-3-4-2-5-3

Messenger RNA codon, which correspond to the amino acids, are:
amino acid 1 UGU

amino acid 2 GAU

amino acid 3 CAC

amino acid 4 UAG

amino acid 5 AAG

Which one of the following DNA bases sequences could provide the code for the given section of the polypeptide?

NTS 2015 DUHS and JSMU
Biology
Biological Molecules
Elimination Tool:

A) ACACTTGTGATGCTATTCGTG

B) ACACUAGUGAUGCUAUUCGUG

C) ACACTAGTGATGCTAAACGTG

D) ACACTAGTGATCCTATTCGTG

54 / 100

Category: Biology Ch 3 Class 12

The only promoter of leaf senescence in the following plant hormones is:

Gibberellins

Cytokinins

Auxins

Abscisic Acid

55 / 100

Category: Biology Ch 3 Class 11

The lock and key model of enzyme action was proposed by:

PMC Sample 3
Biology
Enzymes
Elimination Tool:

A) Louis Pasteur

B) Emil Fischer

C) Daniel Koshland

D) Urey Miller

56 / 100

Category: Biology Ch 12 Class 11

In human gut, chylomicrons are formed by the combination of:

NUMS 2020
Biology
Nutrition
Elimination Tool:

A) Proteins and carbohydrates

B) Fats and proteins

C) Fats and carbohydrates

D) Vitamins and fats

57 / 100

Category: Biology

Which of the following basic structural level of proteins is indicated by an association of two alpha and two beta chains in the haemoglobin molecule?

NUMS Mock 4
Biology
Biological Molecules

A) Primary structure

B) Secondary structure

C) Tertiary structure

D) Quatenary Structure

58 / 100

Category: Biology

Q.16 Example of convergent evolution is

A. Forelimbs of man and bat

B. Wings of birds and insects

C. Darwin's finches

D. All of above

59 / 100

Category: Biology Ch 4 Class 11

Which of the following is NOT the function of cell membranes?

NTS 2018
Biology
Cell Structure and Function
Elimination Tool:

A) Protection of cytoplasm

B) Regulating the passage of different molecules

C) Protein synthesis

D) Cellular communication

60 / 100

Category: Biology Ch 1 Class 12

The human body maintains all of its cells’ internal concentration _____ to internal body fluid.

NUMS 2019 Cancelled
Biology
Homeostasis
Elimination Tool:

A) Isotonic

B) Hypotonic

C) Hypertonic

D) Hyposmotic

61 / 100

Category: Biology Ch 5 Class 12

In multicellular plants cell division occur by

Binary fission

Conjugation

Meiosis

Mitosis

62 / 100

Category: Biology Ch 3 Class 12

Type of neurons found exclusively in CNS are:

Sensory neurons

Motor neurons

Associative neurons

None of these

63 / 100

Category: Biology Ch 4 Class 12

Which statement is incorrect?

Climacteric is burst of respiratory activity in fruit ripening

It is associated with ethane production C

It helps in fruit set

It helps in fruit ripening

64 / 100

Category: Biology

Q43 The animals in which there are separate male and female individuals are called?

A. Unisexual

B. bisexual

C. Asexual

D. hermaphrodite

65 / 100

Category: Biology Ch 3 Class 11

Lock and Key model was proposed by

Emil Fischer

Koshland

Robin Williams

Rudolph Virchow

66 / 100

Category: Biology Ch 1 Class 12

Rapid movement of leaves of mimosa on touching is an example of :

Turgor movement

Nastic movement

Tropic movements.

Growth movement

67 / 100

Category: Biology Ch 8 Class 12

When phenotype of a heterozygote is in between the phenotypes of both the homozygous parents, it is called:

NUMS 2016
Biology
Variation and Genetics
Elimination Tool:

A) Incomplete dominance

B) Epistasis

C) Pleiotropy

D) Codominance

68 / 100

Category: Biology

Q.2 The set of all genes in any population is termed as?

A. population pool

B. species pool

C. gene pool

D. all of these

69 / 100

Category: Biology Ch 12 Class 12

Mountains of Koh Hindukush come under

Tundra

Grass land

Tropical forests

Temperate deciduous

70 / 100

Category: Biology Ch 8 Class 11

The Fungal Cell wall contains:

NUMS 2018
Biology
Kingdom Fungi
Elimination Tool:

A) Peptidoglycan

B) Chitin

C) Suberin

D) Cutin

71 / 100

Category: Biology Ch 10 Class 12

Choose the correct combination:

NUMS 2019 Cancelled
Biology
Evolution
Elimination Tool:

A) Darwin – survival of the fittest

B) Darwin – no extinction

C) Lamarck – acquired transmission

D) Both Darwin – survival of the fittest and Lamark – acquired transmission

72 / 100

Category: Biology Ch 9 Class 11

The release of droplets of water from hydathodes is called:

PMC 2021 Tested
Biology
Kingdom Plantae
Elimination Tool:

A) Respiration

B) Guttation

C) Vaporization

D) Transportation

73 / 100

Category: Biology Ch 13 Class 12

Geothermal energy is

. Energy obtained from nuclear fuel

Energy obtained from burning natural fuels

Heat energy trapped underground

Energy obtained from blowing hot winds

74 / 100

Category: Biology

As pH of blood decreases, H+ ions increases, which combine the proteins part of hemoglobin, to decrease its ability to bind with:

NUMS Mock 2
Biology
Gaseous Exchange

A) O2

B) CO2

C) CO

D) H2

75 / 100

Category: Biology Ch 1 Class 12

Ureter open into the urinary bladder through:

NUMS 2018
Biology
Homeostasis
Elimination Tool:

A) Pelvis

C) Ureteral orifices

B) Hilus

D) Urethral orifices

76 / 100

Category: Biology

Q40 How is pyruvate produced in anaerobic conditions?

A. Alcoholic fermentation

B. Lactic acid fermentation

C. Respiration

D. Both A and B

77 / 100

Category: Biology Ch 10 Class 12

Evolutionary relationships amongst species are reflected in their:

NUMS 2016
Biology
Evolution
Elimination Tool:

A) DNA and proteins

B) RNA and proteins

C) DNA and genes

D) DNA and RNA

78 / 100

Category: Biology

Q.21 All of the following are true for platyhelminthes except:

A. Flatworms

B. Triploblastic

C. Coelomates

D. Bilateral symmetry

79 / 100

Category: Biology Ch 13 Class 12

The productivity of aquatic ecosystem is determined by:

NUMS 2016
Biology
Man and His Environment
Elimination Tool:

A) Water

B) Light and nutrients

C) Light

D) Nutrients

80 / 100

Category: Biology Ch 4 Class 12

Which one of the following represents the changes that occur in the ovary and the uterus approximately every 28 days involving ovulation with the breakdown and loss of the lining of the uterus?

PMC 2020
Biology
Reproduction
Elimination Tool:

A) Ovulation

B) Menstrual cycle

C) Uterine cycle

D) Embryo formation

81 / 100

Category: Biology Ch 10 Class 12

Which one of the following pairs represents an analogous feature?

NUMS 2018
Biology
Evolution
Elimination Tool:

A) Elephant tusks and human incisors

B) Teleost erythrocyte and mammalian erythrocyte

C) Insect wing and bat wing

D) Mole forelimb and bird wing

82 / 100

Category: Biology Ch 9 Class 11

What is an example of sperms of liverworts, mosses, ferns which move towards archegonia, in response to nucleic acid released by the ovum?

PMC Practice 7
Biology
Kingdom Plantae
Elimination Tool:

A) Chemotropic movement

B) Chemonastic movement

C) Haptonastic movement

D) Chemotactic movement

83 / 100

Category: Biology

To overcome infertility, which technique is used?

NUMS Mock 4
Biology
Reproduction

A) In vitro fertilization

B) In vivo fertilization

C) Both Options A and B are correct

D) None of these options is correct

84 / 100

Category: Biology

It is a method for rapid production of a very large number of copies of a particular fragment of DNA:

NUMS Mock 2
Biology
Biotechnology

A) Gel electrophoresis

B) Polymerase chain reaction

C) DNA extraction

D) Recombination

85 / 100

Category: Biology Ch 7 Class 12

Asexual offsprings can be produced by:

PMC 2021 Tested
Biology
Cell Cycle
Elimination Tool:

A) Mitosis

B) Meiosis

C) None of these

D) Both

86 / 100

Category: Biology Ch 8 Class 11

Antibiotics are produced by fungi and certain bacteria of group:

UHS 2013
Biology
Kingdom Fungi
Elimination Tool:

A) Actinomycetes

B) Oomycetes

C) Ascomycetes

D) Basidiomycetes

87 / 100

Category: Biology Ch 13 Class 12

In nitrogen fixation, nitrogen is converted to:

NUMS 2019 Cancelled
Biology
Man and His Environment
Elimination Tool:

A) Nitrate ions and ammonia

B) Atomic nitrogen

C) Urea

D) All of these

88 / 100

Category: Biology Ch 7 Class 12

Which statement is not true about phragmoplast?

Formed from vesicle originating from Golgi apparatus

Present in plants only

Formed at the end of anaphase

Centre of dividing cell

89 / 100

Category: Biology Ch 5 Class 11

Mark the one Kingdom having the most conspicuous living organisms?

NTS 2018
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Monera

B) Protista

C) Animalia

D) Plantae

90 / 100

Category: Biology Ch 6 Class 12

Which statement correctly describes the transcription of DNA?

PMC 2020
Biology
Chromosomes and DNA
Elimination Tool:

A) It produces amino acids

B) It produces messenger RNA

C) It results in increased DNA synthesis

D) It is a semi conservative process

91 / 100

Category: Biology Ch 6 Class 12

The particular array of chromosomes that an individual possesses is called its:

PMC 2020
Biology
Chromosomes and DNA
Elimination Tool:

A) Genotype

B) Phenotype

C) Karyotype

D) Allele

92 / 100

Category: Biology Ch 3 Class 12

_________ is sometimes given by injection as an emergency treatment in cardiac arrest:

NUMS 2020
Biology
Coordination and Control
Elimination Tool:

A) Acetylcholine

B) Dopamine

C) Serotonin

D) Epinephrine

93 / 100

Category: Biology Ch 8 Class 11

Aspergillosis is a fungal infection and occurs only in _______:

NUMS 2020
Biology
Kingdom Fungi
Elimination Tool:

A) Male

B) Female

C) AIDS patient

D) Athletes

94 / 100

Category: Biology Ch 8 Class 11

The ecological role of fungi as decomposers is paralleled only by

UHS 2010
Biology
Kingdom Fungi
Elimination Tool:

A) Prions

B) Algae

C) Bacteria

D) Viruses

95 / 100

Category: Biology

Which component enters into mitochondria after glycolysis?

NUMS Mock 1
Biology
Bioenergetics

A) Pyruvate

B) Acetate

C) Oxaloacetate

D) Acetyl – CoA

96 / 100

Category: Biology Ch 6 Class 12

During DNA replication ______ attaches the fragment to the lagging strand.

NUMS 2019 Reconduct
Biology
Chromosomes and DNA
Elimination Tool:

A) Ligase

B) Invertase

C) Helicase

D) Topoisomerase

97 / 100

Category: Biology

Q.25 The substrate of the trypsin is:

A. Proteins

B. Dipeptides

C. Polypeptides

D. Amino acids

98 / 100

Category: Biology

Q.66 Which one of the following is a non-protein group covalently bonded to a few respiratory enzymes among others?

A. Nicotine adenine dinucleotide

B. Flavin adenine dinucleotide

C. Nicotinamide adenine dinucleotide phosphate

D. All of the above

99 / 100

Category: Biology Ch 2 Class 11

Which of the following is an unsaturated fatty acid?

PMC 2020
Biology
Biological Molecules
Elimination Tool:

A) Oleic acid

B) Palmitic acid

C) Butyric acid

D) Acetic acid

100 / 100

Category: Biology Ch 9 Class 11

The flower of family gramineae process contain two scales below ovary which are called:

NUMS 2014
Biology
Kingdom Plantae
Elimination Tool:

A) Glumes

B) Lemma and palea

C) Lodicule

D) Rochella

Your score is

The average score is 61%

Structured Practice for Best Entry Test Preparation

This topic-wise and chapter-wise practice test allows students to focus on individual biology concepts, including diagrams, processes, and conceptual questions. Regular practice enhances understanding, sharpens problem-solving skills, and builds confidence to tackle both board and competitive exam questions efficiently.

Free Resources for Best Entry Test Preparation

Students can access free Biology Practice Test 4 to systematically improve knowledge, recall, and problem-solving abilities. This test is suitable for FSC Board Exams as well as major entry tests, helping students perform better in the biology section. PLS Academy provides these resources to support students in their preparation.

JazakAllah