Biology Practice Test 4

Biology Practice Test 4 is designed to help students strengthen their understanding of key biological concepts, theories, and processes for competitive entry tests like MDCAT, NUMS, AKU, UET, ECAT, NTS, as well as FSC Board Exams. This test covers topics from human anatomy, physiology, microbiology, and ecology, helping students improve accuracy and retention.

PLS Academy

Get Access to 20 thousands+ MCQs Including Topical MCQs, Practice Tests, Mock Tests, Solved Past Papers, Flashcards, Notes, FLPS, and Much More.

UNLOCK PREMIUM🔐

1244

Created by Ali Durrani

MDCAT Practice Tests

Biology Practice Test 4

This is the Free Access to Limited MCQs. Enroll to PLS Boost Premium Bundle to Get More MCQs HERE

1 / 100

Category: Biology

_____ are more common in human males and females.

NUMS Mock 3
Biology
Variation and Genetics

A) X-linked dominant traits

B) X-linked recessive traits

C) Y-linked dominant traits

D) Autosomal linked recessive traits

2 / 100

Category: Biology Ch 1 Class 12

Which organ is called the body thermostat?

NUMS 2020
Biology
Homeostasis
Elimination Tool:

A) Pituitary gland

B) Kidneys

C) Hypothalamus

D) Adrenal gland

3 / 100

Category: Biology Ch 3 Class 11

A/An _______ is mostly a non-protein chemical compound that is required for the protein’s biological activity.

NTS 2019
Biology
Enzymes
Elimination Tool:

A) Active site

B) Substrate

C) Cofactor

D) Enzyme

4 / 100

Category: Biology Ch 11 Class 11

Estimating relative CO2consumption or O2release during photosynthesis at different wavelengths of light, is termed as:

NUMS 2015
Biology
Bioenergetics
Elimination Tool:

A) Action spectrum

B) Absorption spectrum

C) Dark reaction

D) Light reaction

5 / 100

Category: Biology

How many ml of blood is pumped by each contraction of the heart?

NUMS Mock 1
Biology
Transport

A) 80 ml

B) 90 ml

C) 70 ml

D) 60 ml

6 / 100

Category: Biology Ch 10 Class 11

Scales are present in:

NUMS 2015
Biology
Kingdom Animalia
Elimination Tool:

A) Fishes

B) Reptiles

C) Birds

E) A and B

7 / 100

Category: Biology Ch 3 Class 11

The active site of an enzyme:

Never changes

Forms no chemical bond with substrate

Determined by structure and the specificity of the enzyme.

They are non specific in their action.

8 / 100

Category: Biology

Q.16 Example of convergent evolution is

A. Forelimbs of man and bat

B. Wings of birds and insects

C. Darwin's finches

D. All of above

9 / 100

Category: Biology Ch 8 Class 12

What is the risk of color blind baby boy in a family when mother is color blind but father is normal?

NUMS 2019 Cancelled
Biology
Variation and Genetics
Elimination Tool:

A) 25%

B) 50%

C) 75%

D) 100%

10 / 100

Category: Biology Ch 12 Class 11

Undigested food in cockroach is stored in:

NUMS 2015
Biology
Nutrition
Elimination Tool:

A) Crop

B) Rectum

C) Gizzard

D) Crop & Rectum

11 / 100

Category: Biology

The wings of the birds and forelegs of a horse are ______ structures.

NUMS Mock 3
Biology
Evolution

A) Analogous

B) Homologous

C) Vestigial

D) Evolutionary convergent

12 / 100

Category: Biology Ch 10 Class 11

Organs which produce voice in birds is:

NUMS 2016
Biology
Kingdom Animalia
Elimination Tool:

A) Larynx

C) Syrinx

B) Pharynx

D) Both A and C

13 / 100

Category: Biology Ch 14 Class 11

Atherosclerosis is disease of:

NTS 2016 SMBBMC
Biology
Transport
Elimination Tool:

A) Immune system

B) Arterial wall

C) Venal wall

D) Lungs

14 / 100

Category: Biology Ch 8 Class 11

Which of the following component is found in the cell wall of fungi?

UHS 2012
Biology
Kingdom Fungi
Elimination Tool:

A) Cellulose

B) Chitin

C) Proteins

D) Glycerol

15 / 100

Category: Biology

Q.67 Interaction between genes occupying different loci is:

A. Dominance

B. Pleiotropy

C. Epistasis

D. Gene linkage

16 / 100

Category: Biology Ch 8 Class 11

Fungi whose growth is favored by fire is called:

NTS 2016 SMBBMC
Biology
Kingdom Fungi
Elimination Tool:

A) Pyrophilus

B) Prophilus

C) Philus

D) Prephylus

17 / 100

Category: Biology Ch 10 Class 12

Many scientists believe that one of the following is evolutionary origin(s) of animals, plants and fungi?

NTS 2013
Biology
Evolution
Elimination Tool:

A) Protists

B) Algae

C) Bacteria

D) Protozoans

18 / 100

Category: Biology Ch 10 Class 11

The system well – developed in the acoelomate is

Excretory system

Nervous system

Both of these

Transport system

19 / 100

Category: Biology Ch 7 Class 12

Which of the following statements concerning nucleolus is correct?

NTS 2014
Biology
Cell Cycle
Elimination Tool:

A) It disappears at the time of cell division

B) There is only one nucleolus in every cell

C) It plays important role in the synthesis of ribonucleic acid and ribosomes in prokaryotic cells

D) It helps in destroying worn-out organelles

20 / 100

Category: Biology Ch 1 Class 11

A large regional community primarily determined by climate is called :

Population

Community

Biome

Habitat

21 / 100

Category: Biology

In chemiosmosis, the proton (H+) moves from _______.

NUMS Mock 4
Biology
Bioenergetics

A) Stroma to Lumen

B) Cytoplasm to Stroma

C) Lumen to Stroma

D) Stroma to cytoplasm

22 / 100

Category: Biology Ch 12 Class 11

Bile is used in:

NUMS 2016
Biology
Nutrition
Elimination Tool:

A) Protein digestion

B) Starch digestion

C) Fat emulsification

D) Both A and B

23 / 100

Category: Biology Ch 2 Class 11

A complex substance which on hydrolysis yields polyhydroxy aldehyde or ketone subunits is called:

Lipid

Carbohydrate

Protein

Carotein

24 / 100

Category: Biology Ch 11 Class 11

Exposure to ______ light is effective in photosynthesis as it enables guard cells to take up K+ and open the stomata.

NUMS 2015
Biology
Bioenergetics
Elimination Tool:

A) Red

B) Blue

C) Green

D) Orange

25 / 100

Category: Biology Ch 1 Class 12

The water content of mammalian blood is regulated by antidiuretic hormone(ADH). In which part of the nephron does regulation occur ?

NTS 2015 SMBBMC
Biology
Homeostasis
Elimination Tool:

A) The ascending limb of the loop of gentle

B) The collecting duct

C) The descending limb of the loop of gentle

D) The proximal convoluted tubule

26 / 100

Category: Biology Ch 11 Class 11

The point at which there is no net exchange of gases between leaves and atmosphere is known as

Neutral point

Compensation point

Parallel point

Competitive point

27 / 100

Category: Biology Ch 4 Class 11

Which of the following cell organelles involved in the synthesis of cell wall and middle lamella?

PMC 2020
Biology
Cell Structure and Function
Elimination Tool:

A) Endoplasmic reticulum

B) Golgi apparatus

C) Lysosomes

D) Peroxisomes

28 / 100

Category: Biology Ch 11 Class 11

First stable compound during Calvin cycle is:

PMC 2020
Biology
Bioenergetics
Elimination Tool:

A) 3-phosphoglycerate

B) Glyceraldehyde 3 – phosphate

C) 1, 3 bisphosphoglycerate

D) Ribulose bisphosphate

29 / 100

Category: Biology Ch 13 Class 12

An area previously supporting life is made barren, the subsequent recolonization is called ______.

UHS 2018
Biology
Man and His Environment
Elimination Tool:

A) Climax community

B) Pioneer succession

C) Primary succession

D) Secondary succession

30 / 100

Category: Biology Ch 10 Class 11

Aschelminthes is also known as

Protozoans

Eumatazoa

Nematodes

Protoctist ancestors

31 / 100

Category: Biology

Q.20 Of the following, which one is not the characteristic of kingdom animalia:

A. All animals are ingestive heterotrophs

B. All animals are diploid

C. All animals are eukaryotes

D. All animals are developed from dissimilar haploid gametes e.g. larger sperm and small egg

32 / 100

Category: Biology

The function of respiratory passage, Cilia is to keep the airways clear of:

NUMS Mock 4
Biology
Gaseous Exchange

A) Carbon dioxide

B) Oxygen

C) Dust

D) Carbon Monoxide

33 / 100

Category: Biology Ch 10 Class 11

An organism appears to be a segmented worm. Upon observation, it is determined that the organism has a closed circulation, a mouth, and an anus and does not have an exoskeleton. The organism most likely belongs to the phylum:

NTS 2010
Biology
Kingdom Animalia
Elimination Tool:

A) Mollusca

B) Annelida

C) Echinodermata

D) Arthropoda

34 / 100

Category: Biology

What type of atom is the carbon atom?

NUMS Mock 2
Biology
Biological Molecules

A) Divalent

B) Monovalent

C) Trivalent

D) Tetravalent

35 / 100

Category: Biology Ch 2 Class 11

The melting point of unsaturated fatty acids:

NUMS 2019 Reconduct
Biology
Biological Molecules
Elimination Tool:

A) Increases with increase in double bonds

B) Decreases with increase in double bonds

C) Rises in some and falls in others

D) There is no relationship between unsaturation and melting point

36 / 100

Category: Biology Ch 2 Class 11

When the concentration of the external medium is equal to the concentration of the internal medium of a cell, the situation is called:

NUMS 2017
Biology
Biological Molecules
Elimination Tool:

A) Hypertonic

B) Hypotonic

C) Isotonic

D) Heterotonic

37 / 100

Category: Biology Ch 6 Class 11

In which of the following phases of bacterial growth, is the death rate more rapid than the multiplication rate?

NTS 2016 SMBBMC
Biology
Kingdom Prokaryote
Elimination Tool:

A) Stationary phase

B) LAG phase

C) Decline phase

D) LOG phase

38 / 100

Category: Biology Ch 10 Class 11

Select an anamniote from the following:

PMC 2020
Biology
Kingdom Animalia
Elimination Tool:

A) Snake

B) Parrot

C) Frog

D) Crocodile

39 / 100

Category: Biology Ch 4 Class 11

Autophagosomes are

Those lysosomes which eat parts of their own cells to generate energy.

Those lysosomes which eat old and worn out cellular organelles.

Lysosomes which help in extracellular digestion

Both a and b

40 / 100

Category: Biology

Q37 An entire skeletal muscle is surrounded by

A. Sarcolemma

B. Epimysium

C. Both A and B

D. Microtubules

41 / 100

Category: Biology Ch 1 Class 12

The technique used for the non-surgical removal of kidney stones is called:

NUMS 2016
Biology
Homeostasis
Elimination Tool:

A) Ultrasound

B) Lithotripsy

C) Dialysis

D) X-rays

42 / 100

Category: Biology Ch 7 Class 11

Which of the following is TRUE about Amoebae?

PMC 2020
Biology
Kingdom Protista
Elimination Tool:

A) They have flagella

B) They are multicellular

C) They do not cause any disease in humans

D) They move by forming specialized cytoplasmic projections called pseudopodia

43 / 100

Category: Biology Ch 9 Class 12

Which of the following is NOT true for genes used in recombinant DNA technology?

NUMS 2019 Reconduct
Biology
Biotechnology
Elimination Tool:

A) It can isolated from chromosome

B) It can be synthesized chemically

C) It can be made from protein

D) It can be made from mRNA

44 / 100

Category: Biology Ch 13 Class 11

In most birds air sacs are _____ in number

45 / 100

Category: Biology Ch 4 Class 11

Which one of the following organelles is required for aerobic respiration?

NTS 2018
Biology
Cell Structure and Function
Elimination Tool:

A) Nucleus

B) Mitochondrion

C) Endoplasmic reticulum

D) Plastids

46 / 100

Category: Biology Ch 9 Class 12

Which one of the following is made up of radioactively labelled nucleotides?

UHS 2015
Biology
Biotechnology
Elimination Tool:

A) Phage DNA

B) Genomic Library

C) Recombinant DNA

D) Gene Probe

47 / 100

Category: Biology Ch 6 Class 12

Which is incorrect?

Chromosomes 1st observed by walther Fleming

Chromosomal theory of inheritance 1st formulated by Walter Sutton

1st evidence of hereditary nature of DNA provided by Friedrich Meischer

. Sex chromosomes discovered by Thomas Hunt Morgan

48 / 100

Category: Biology Ch 3 Class 11

Extreme change in pH results in:

Change in ionization of amino acids at the active site of the enzyme.

Change in the ionization of the substrate.

Denaturation of the enzyme

IncreaseIncrease in the reaction rate. in the reaction rate.

49 / 100

Category: Biology Ch 2 Class 11

Which type of protein structure contains the three dimensional structure?

NTS 2013
Biology
Biological Molecules
Elimination Tool:

A) Primary

B) Secondary

C) Tertiary

D) Quaternary

50 / 100

Category: Biology Ch 4 Class 11

During digesting the phagocytosed food particles vesicles formed from fusion of phagocytic vacuole with the enzymes secreted by Golgi apparantus are called

Lysosomes

Primary lysosomes

Secondary lysosomes

Food vacuole

51 / 100

Category: Biology Ch 1 Class 12

Which of the following statement about Homeostasis is incorrect

There is a definite control system that regulates the homeostatic activities

Homeostatic mechanisms keep the internal environment fixed despite of wide changes in external environment

Because of this the fluctuations of internal environment are of extremely narrow range as compared to that of external environment

All are correct

52 / 100

Category: Biology Ch 2 Class 11

Antibodies are

NUMS 2019 Cancelled
Biology
Biological Molecules
Elimination Tool:

A) Primary proteins

B) Secondary proteins

C) Tertiary proteins

D) Quaternary proteins

53 / 100

Category: Biology Ch 12 Class 12

Which statement about profundal zone is correct?

Plants are unable to anchor but enough light penetrates to support photosynthesis

Phytoplanktons in this region are cyanobacteria

Decomposers and detritus feeders inhabit it

Water lilies are abundant

54 / 100

Category: Biology Ch 4 Class 12

Treponema pallidum causes:

NUMS 2016
Biology
Reproduction
Elimination Tool:

A) Syphilis

B) Gonorrhoea

C) AIDS

D) Herpes

55 / 100

Category: Biology Ch 4 Class 12

The primary oocyte in mammals has which of the following structures around it:

NUMS 2014
Biology
Reproduction
Elimination Tool:

A) Zona Pellucida

B) Zona Vasculosa

C) Zona radiata

D) None of them

56 / 100

Category: Biology

All of the followings are the effects of red light on plant, EXCEPT:

NUMS Mock 2
Biology
Growth and Development

A) Causes epicotyl (plumule) hook to unbend

B) Induces increase in leaf area

C) Elongation of internodes is promoted

D) Stimulate flowering in long day plants

57 / 100

Category: Biology Ch 6 Class 12

The diploid human chromosome set has:

NTS 2016 SMBBMC
Biology
Chromosomes and DNA
Elimination Tool:

A) 22 pairs of autosomes and 1 pair of sex chromosomes

B) 22 pairs of autosomes and XY chromosomes

C) 22 pairs of autosomes and XX chromosomes

D) Haploid somatic cells and diploid germinal cells

58 / 100

Category: Biology Ch 3 Class 12

Direction of reflex action is from:

NUMS 2019 Reconduct
Biology
Coordination and Control
Elimination Tool:

A) Receptor to sensory neuron to motor neuron and then through associative neurons to effect.

B) Receptor to sensory neuron to associative neuron and then through motor neurons to effector.

C) Effector to sensory neuron to associative neuron and then through motor neurons to Receptor.

D) Effector to sensory neuron to motor neuron and then through associative neurons to Receptor.

59 / 100

Category: Biology Ch 11 Class 11

Estimating relative CO2 consumption or O2 release during photosynthesis at different wavelengths of light, is termed as:

NUMS 2019 Reconduct
Biology
Bioenergetics
Elimination Tool:

A) Action spectrum

B) Absorption spectrum

C) Dark reaction

D) Light reaction

60 / 100

Category: Biology Ch 1 Class 11

A structure formed by groups of similar cells organized into loose sheetsor bundles performing similar functions is called as:

An organ

An organism

A Tissue

A Cell

61 / 100

Category: Biology Ch 9 Class 11

The scientific name of potato is Solanum tuberosum and that of brinjal is Solanum melongena. This indicates that both potato and brinjal are members of the

NTS 2014
Biology
Kingdom Plantae
Elimination Tool:

A) Same species but different genera

B) Same genus but different classes

C) Same species but different classes

D) Same genus but different species

62 / 100

Category: Biology Ch 13 Class 12

In air nitrogen is

57%

20%

79%

30%

63 / 100

Category: Biology Ch 7 Class 11

The disease caused by Protozoal infection is:

NTS 2018
Biology
Kingdom Protista
Elimination Tool:

A) Rickets

B) Goiter

C) Malaria

D) Beri-beri

64 / 100

Category: Biology Ch 5 Class 11

The long chains of HIV-proteins are cut down by proteases enzyme of ______.

PMC Sample 2
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) HIV virus

B) Host proteases

C) Both viral and host proteases

D) None of these options is correct

65 / 100

Category: Biology Ch 6 Class 12

The phenomenon known as crossing-over occurs during:

NTS 2017
Biology
Chromosomes and DNA
Elimination Tool:

A) Mitosis

B) Meiosis

C) Geographic distribution

D) Active transport

66 / 100

Category: Biology Ch 5 Class 11

Syphilis is caused by:

NUMS 2018
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Coccus

B) Bacillus

C) Spirillum

D) Spirochete

67 / 100

Category: Biology

Q43 Which cells produce oogonia in ovary?

A. Stromal cells

B. Epithelial cells

C. Germ cells

D. Theca cells

68 / 100

Category: Biology

Q.9 The linkage formed when one molecule of glucose combines with one molecule of fructose is:

A. 1, 2-glycosidic linkage

B. 1, 6-glycosidic linkage

C. 1, 4-glycosidic linkage

D. 1,3-glycosidic linkage

69 / 100

Category: Biology Ch 6 Class 12

The number of base pairs in a complete helical turn is/are:

NUMS 2020
Biology
Chromosomes and DNA
Elimination Tool:

A) 1

B) 5

C) 10

D) 15

70 / 100

Category: Biology Ch 12 Class 12

Development of bark in plants and skin in animals is a method for

Providing support

Protection from enemies

Reducing water loss

Helping in food production

71 / 100

Category: Biology Ch 1 Class 12

Which of the following occurs in the body in response to the secretion of Glucagon?

NUMS 2020
Biology
Homeostasis
Elimination Tool:

A) Conversion of glucose to glycogen in liver cells

B) Decrease in blood glucose concentration

C) Increased uptake of glucose by muscle cells

D) Production of cyclic AMP in target cells

72 / 100

Category: Biology Ch 4 Class 11

Who first observed and thus hypothesized that new cells are formed from previously existing living cell?

Theodor Schwann and Schleiden

Rudolph Virchows

Louis Pasteur

Both b and c

73 / 100

Category: Biology Ch 3 Class 12

Normal resting membrane potential of a neuron is

50 mv

60 mv

70 mv

80 mv

74 / 100

Category: Biology Ch 4 Class 12

Which organ(s) in the male reproductive system produce gametes?

NUMS 2018
Biology
Reproduction
Elimination Tool:

A) Vas deferens

B) Malpighian tubule system

C) Seminiferous tubules

D) Ejaculatory duct

75 / 100

Category: Biology Ch 1 Class 11

The atoms of different elements combine with each other through ionic or covalent bonding to produce compounds this stable form is called:

An organ

Tissue

Both a and c

76 / 100

Category: Biology Ch 13 Class 11

A disease caused by gradual breakdown of the thin walls of alveoli is;

UHS 2019
Biology
Gaseous Exchange
Elimination Tool:

A) Tuberculosis

B) Asthma

C) Emphysema

D) Bronchitis

77 / 100

Category: Biology Ch 11 Class 11

Cyanides are potent poisons of the living organism and can kill by inhibiting _____, essential for cellular respiration:

NUMS 2020
Biology
Bioenergetics
Elimination Tool:

A) Cytochrome oxidases

B) Dehydrogenases

C) Hydrolases

D) Nucleases

78 / 100

Category: Biology Ch 12 Class 12

Desert ecosystem of Mianwali is

Thar

Thal

Cholistan

None

79 / 100

Category: Biology Ch 9 Class 12

By PCR we mean:

UHS 2018
Biology
Biotechnology
Elimination Tool:

A) Polymerase chronic reaction

B) Polymerase chain reaction

C) Polymerase copy reaction

D) Polymerase cross reaction

80 / 100

Category: Biology

Q.28 The enzyme which plays important role in HIV pathogenesis

A. RNA polymerase I

B. DNA polymerase II

C. Reverse Transcriptase I

D. Reverse Transcriptase

81 / 100

Category: Biology Ch 13 Class 11

Chest cavity is bounded by ribs and muscles on the sides, while the floor of chest cavity is called:

NUMS 2015
Biology
Gaseous Exchange
Elimination Tool:

A) Pleura

B) Alveoli

C) Chest cage

D) Diaphragm

82 / 100

Category: Biology Ch 2 Class 11

Which of the following has the ability to develop ester linkage with the OH group of Pentose sugar?

NUMS 2017
Biology
Biological Molecules
Elimination Tool:

A) Purine

B) Pyrimidine

C) H3PO4

D) HNO3

83 / 100

Category: Biology Ch 3 Class 12

Which one of the following is a neurotransmitter?

NUMS 2020
Biology
Coordination and Control
Elimination Tool:

A) Dopamine

B) Hydrochloric acid

C) Sodium ions

D) Calcium ions

84 / 100

Category: Biology Ch 6 Class 12

Chromosome is made of

2 chromatids +1 centromere +secondary constriction

1 chromated + 1 centromere + primary constriction

2 chromatids + 1 centromere + primary constriction

2 chromatids + 2 centromere + secondary constriction

85 / 100

Category: Biology

Q.65 How are flat worms not similar to round worms?

A. They are both acoelomates

B. They are both triploblastic.

C. They both show bilateral symmetry.

D. They are both worms.

86 / 100

Category: Biology Ch 13 Class 12

Hydroelectricity is generated by using ______ of falling water.

Potential energy

Gravitational energy

Kinetic energy

. All of these

87 / 100

Category: Biology Ch 11 Class 11

During the first three steps of glycolysis, glucose is converted to Fructose 1, 6-diphosphate by the rearrangement of the molecule and addition of two phosphate groups. The phosphate comes from?

NTS 2015 SMBBMC
Biology
Bioenergetics
Elimination Tool:

A) Phospholipids of the membrane

B) ADP

C) inorganic phosphates

D) ATP

88 / 100

Category: Biology Ch 10 Class 11

Filter feeders extract food particles from:

NUMS 2014
Biology
Kingdom Animalia
Elimination Tool:

A) Water

B) Soil

C) Air

D) Blood

89 / 100

Category: Biology

Q.32 In the ascent of sap, water moves up in:

A. Xylem

B. Cambium

C. Phloem

D. Endodermis

90 / 100

Category: Biology Ch 9 Class 11

The simplest of all bryophytes are

Thallophytes

Embryophytes

Mosses

Liverworts

91 / 100

Category: Biology

In the commercial manufacture of insulin, a human gene is inserted into which one of the following?

NUMS Mock 1
Biology
Biotechnology

A) A chromosome of a human cell

B) A protein molecule in a yeast cell

C) The DNA of a bacterium

D) The nucleic acid in a virus

92 / 100

Category: Biology

They serve as a scaffold for formation of higher order chromatin structure:

NUMS Mock 2
Biology
Cell Structure and Function

A) Nucleosome

B) Nucleus

C) Chromosomes

D) Histones

93 / 100

Category: Biology Ch 6 Class 12

Highly condensed portions of the chromatin are called:

NTS 2011
Biology
Chromosomes and DNA
Elimination Tool:

A) Euchromatin

B) Heterochromatin

C) Nucleosome

D) Super coils

94 / 100

Category: Biology

Q.64 All of the following are the attributes of evolution except:

A. O3 began to filter UV radiations

B. Some organisms began to utilized O2 in the start of evolution

C. Nutrient supply is abundant

D. The reducing atmosphere slowly become oxidizing atmosphere

95 / 100

Category: Biology Ch 5 Class 12

In multicellular plants cell division occur by

Binary fission

Conjugation

Meiosis

Mitosis

96 / 100

Category: Biology Ch 6 Class 11

Which of the following has a chain arrangement?

Streptobacillus

Streptococci

Staphylococci

Both A and B

97 / 100

Category: Biology

Q.26 Most carbon dioxide is transported in the form of:

A. Carboxyhemoglobin

B. Lipids

C. Bicarbonate ions

D. Chemicals

98 / 100

Category: Biology Ch 7 Class 11

Identify the correctly matched pair relating to a term and its meaning/function/example:

NTS 2017
Biology
Kingdom Protista
Elimination Tool:

A) nitrogen cycle… Rhizopus

B) denitrifying bacteria..change protein to ammonia

C) biosphere.. where life exists

D) lithosphere…water,air and soil.on the surface of earth

99 / 100

Category: Biology

5 different amino acids, numbered 1, 2, 3, 4, and 5, below from the following sequence in the path of a polypeptide chain:

1-2-3-4-2-5-3

Messenger RNA codon, which correspond to the amino acids, are:
amino acid 1 UGU

amino acid 2 GAU

amino acid 3 CAC

amino acid 4 UAG

amino acid 5 AAG

Which one of the following DNA bases sequences could provide the code for the given section of the polypeptide?

NUMS Mock 2
Biology
Biological Molecules

A) ACACTTGTGATGCTATTCGTG

B) ACACUAGUGAUGCUAUUCGUG

C) ACACTAGTGATGCTAAACGTG

D) ACACTAGTGATCCTATTCGTG

100 / 100

Category: Biology Ch 10 Class 11

Bipinnaria is the larval form of:

NUMS 2014
Biology
Kingdom Animalia
Elimination Tool:

A) Coelenterate

B) Potychaeta

C) Echinodermata

D) Cestoda

Your score is

The average score is 61%

Structured Practice for Best Entry Test Preparation

This topic-wise and chapter-wise practice test allows students to focus on individual biology concepts, including diagrams, processes, and conceptual questions. Regular practice enhances understanding, sharpens problem-solving skills, and builds confidence to tackle both board and competitive exam questions efficiently.

Free Resources for Best Entry Test Preparation

Students can access free Biology Practice Test 4 to systematically improve knowledge, recall, and problem-solving abilities. This test is suitable for FSC Board Exams as well as major entry tests, helping students perform better in the biology section. PLS Academy provides these resources to support students in their preparation.

JazakAllah