Biology Practice Test 4

Biology Practice Test 4 is designed to help students strengthen their understanding of key biological concepts, theories, and processes for competitive entry tests like MDCAT, NUMS, AKU, UET, ECAT, NTS, as well as FSC Board Exams. This test covers topics from human anatomy, physiology, microbiology, and ecology, helping students improve accuracy and retention.

PLS Academy

Get Access to 20 thousands+ MCQs Including Topical MCQs, Practice Tests, Mock Tests, Solved Past Papers, Flashcards, Notes, FLPS, and Much More.

UNLOCK PREMIUM🔐

1244

Created by Ali Durrani

MDCAT Practice Tests

Biology Practice Test 4

This is the Free Access to Limited MCQs. Enroll to PLS Boost Premium Bundle to Get More MCQs HERE

1 / 100

Category: Biology

Q.15 Genes that affect growth rate in humans influencing both weight and height are?

A. Codominant

B. Epistasis

C. Polygene

D. Pleiotrop

2 / 100

Category: Biology

Why do some vegetables lose water when salt is applied to them?

NUMS Mock 3
Biology
Transport

A) Due to the less negative water potential of the external environment than the cell.

B) Due to the more negative water potential of the external environment that the cell

C) . Due to the less positive water potential of the external environment than the cell

D) Due to more positive water potential of the external environment than the cell

3 / 100

Category: Biology

Q.30 This group of animals has three bones in the ear.

A. Reptiles

B. Mammals

C. Both reptiles and mammals

D. Birds and mammals

4 / 100

Category: Biology Ch 4 Class 11

Who opposed the idea the cell is an empty space bounded by thick wall?

Lorenz Oken

Schwann

Robert Brown

Rudolph Virchow

5 / 100

Category: Biology Ch 13 Class 12

Overgrazing results in:

NUMS 2019 Cancelled
Biology
Man and His Environment
Elimination Tool:

A) Totally barren lands

B) Good pastured lands

C) Salinity

D) Rocky areas

6 / 100

Category: Biology Ch 6 Class 12

A fern has _____ pairs of chromosomes.

NTS 2012
Biology
Chromosomes and DNA
Elimination Tool:

A) 23

B) 40

C) 500

D) 13

7 / 100

Category: Biology

Lock and Key Model for enzyme action propose by Emil Fischer suggests that:

NUMS Mock 4
Biology
Enzymes

A) Enzymes are unbiased for the substrate

B) Enzymes can modify their active sites

C) Enzymes are restricted to one reaction type

D) An enzyme can catalyze variety of reactions

8 / 100

Category: Biology Ch 3 Class 12

Gibberellins may be substituted for _____ light, therefore promote flowering in long day plants.

White

Red

Blue

Green

9 / 100

Category: Biology Ch 2 Class 12

Unpaired facial bones are:

NUMS 2018
Biology
Support and Movement
Elimination Tool:

A) Maxilla, Zygomatic

B) Palatine, Inferior concha

C) Nasal, Lacrimal

D) Mandible, Vomer

10 / 100

Category: Biology

Q.52 A chromosome in which a centromere stays at one end is called?

A. Metacentric

Telocentric

C. Acrocentric

D. All of these

11 / 100

Category: Biology Ch 11 Class 12

Legume plants are the hosts to

Rhizobium

Mycorrhiza

Lichen

Algae

12 / 100

Category: Biology Ch 5 Class 11

What type of virus is the smallpox virus?

PMC Sample 1
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) DNA enveloped virus

B) RNA enveloped virus

C) DNA virus

D) RNA naked virus

13 / 100

Category: Biology Ch 3 Class 12

The 1st human hormone produced by recombinant DNA technology was:

NUMS 2016
Biology
Coordination and Control
Elimination Tool:

A) Estrogen

B) Testosterone

C) Cortisone

D) Insulin

14 / 100

Category: Biology Ch 10 Class 12

Which one is NOT a continuous trait?

NUMS 2019 Reconduct
Biology
Evolution
Elimination Tool:

A) Human height

B) Tongue rolling

C) Wheat grain color

D) Human skin color

15 / 100

Category: Biology Ch 9 Class 12

DNA analysis is done to

Diagnose viral infections

Identify criminals

Determine evolution

All of these

16 / 100

Category: Biology Ch 1 Class 12

Which of the following structure in plant’s body is called excretophores?

Stem

Leaves

Flowers

Roots

17 / 100

Category: Biology Ch 6 Class 11

The causing agent of the tuberculosis that grows very well in poor living conditions and malnutrition is:

NUMS 2019 Cancelled
Biology
Kingdom Prokaryote
Elimination Tool:

A) Spirobacterium

B) Mycobacterium

C) E.Coli

D) Staphylococcus

18 / 100

Category: Biology

Q.7 A neuron located in the cential hervous system that projects its axon outside the CNS is called:

A. Motor nerve

B. Sensory nerve

C. Both A and B

D. Mixed nerve

19 / 100

Category: Biology Ch 4 Class 12

The primary oocyte in mammals has which of the following structures around it:

NUMS 2014
Biology
Reproduction
Elimination Tool:

A) Zona Pellucida

B) Zona Vasculosa

C) Zona radiata

D) None of them

20 / 100

Category: Biology

Choose the term from the following which is NOT a part of gene therapy?

NUMS Mock 2
Biology
Biotechnology

A) Bone marrow transplant

B) Retrovirus

C) DNA Fingerprinting

D) Somatic cells

21 / 100

Category: Biology

Pathway of energy used by muscles converted from food is:

NUMS Mock 3
Biology
Bioenergetics
Support and Movement

A) Food-ATP-creatine phosphate- protein

B) Food-glycogen- ATP-creatine phosphate

C) Food-glycogen-creatine phosphate- ATP

D) Food-protein-creatine phosphate- ATP

22 / 100

Category: Biology

Q.18 Which of these is not a reflex action?

A, Secretion of sweat

B. salivation

C. Flexion due to needle prick

D. blinking of eyes due to strong light

23 / 100

Category: Biology Ch 6 Class 11

Which of the following has a chain arrangement?

Streptobacillus

Streptococci

Staphylococci

Both A and B

24 / 100

Category: Biology Ch 8 Class 12

An X to A ratio of ⅖ in drosophila produces:

NUMS 2020
Biology
Variation and Genetics
Elimination Tool:

A) Sterile female

B) Fertile female

C) Male

D) Both male and female but sterile

25 / 100

Category: Biology Ch 9 Class 11

Chlorophyta is considered to be closest to plants but do not resemble plants in having:

NUMS 2020
Biology
Kingdom Plantae
Elimination Tool:

A) Chlorophyll a and b

B) Starch as stored food

C) Cellulose cell wall

D) Multicellular sex organs

26 / 100

Category: Biology Ch 6 Class 12

Phenotype is:

PMC 2020
Biology
Chromosomes and DNA
Elimination Tool:

A) The genetic component i.e. the genes in an individual for a particular trait

B) Partner of gene pair

C) The form of appearance of a trait

D) The position of a gene on the chromosome

27 / 100

Category: Biology Ch 6 Class 12

An individual has an additional sex chromosome. Which syndrome does he have?

NUMS 2014
Biology
Chromosomes and DNA
Elimination Tool:

A) Down's syndrome

B) Turner's syndrome

C) Jacob's syndrome

D) Klinefelter's syndrome

28 / 100

Category: Biology

Golgi complex is responsible for the formation of secretory granules in _____ cell.

NUMS Mock 4
Biology
Cell Structure and Function

A) Stomach

B) Liver

C) Pancreatic

D) Muscle

29 / 100

Category: Biology Ch 3 Class 11

Lock and Key model was proposed by

Emil Fischer

Koshland

Robin Williams

Rudolph Virchow

30 / 100

Category: Biology Ch 6 Class 11

The first bacterium isolated was

Coccus

Bacillus

Vibrio

Spirochete

31 / 100

Category: Biology

The element in basic structure of proteins which differentiate them from carbohydrates is?

NUMS Mock 1
Biology
Biological Molecules

A) Carbon.

B) Hydrogen.

C) Nitrogen.

D) None of these options is correct.

32 / 100

Category: Biology Ch 13 Class 12

Process ensuring the survival of species over long periods of time, even though individual members of the species die.

UHS 2018
Biology
Man and His Environment
Elimination Tool:

A) Reproduction

B) Adaptability

C) Mitosis

D) Respiration

33 / 100

Category: Biology Ch 8 Class 11

Fungi store surplus food in the form of

UHS 2010
Biology
Kingdom Fungi
Elimination Tool:

A) Cellulose

B) Glycogen

C) Starch

D) Both B and C

34 / 100

Category: Biology

Q.60 Which of the following statements correctly describes how the host cell membrane is changed by viral replication?

A. Pores develop.

B. Glycocalyx layer is formed.

C. Membrane is resynthesized

D. Viral proteins are acquired

35 / 100

Category: Biology

Q.22 Which of the following is false about conjugation?

A. It forms a bridge between two bacterial cells

B. It involves transport of genetic material via vectors

C. It is a form of sexual reproduction

D. Both A and B

36 / 100

Category: Biology Ch 8 Class 12

Ahmed’s blood CANNOT clot properly; he was diagnosed with hemophilia A. He passed this trait to his grandson through his:

NUMS 2019 Reconduct
Biology
Variation and Genetics
Elimination Tool:

A) Wife

B) Son

C) Daughter

D) Brother

37 / 100

Category: Biology Ch 11 Class 11

FADH2 is produced during which step of Krebs cycle?

NUMS 2015
Biology
Bioenergetics
Elimination Tool:

A) When Isocitrate is converted into alpha – ketoglutarate

B) When alpha – Ketogluterate is converted into Succinate

C) When Succinate is converted into Fumarate

D) When Fumarate is converted into Maltose

38 / 100

Category: Biology Ch 9 Class 11

Prosopis glandulosa is the botanical name of _______.

NTS 2016 SMBBMC
Biology
Kingdom Plantae
Elimination Tool:

A) Chhui mui

B) Kikar

C) Bauble

D) Devi

39 / 100

Category: Biology Ch 3 Class 12

The gland known as the “gland of emergency” is the:

NTS 2014
Biology
Coordination and Control
Elimination Tool:

A) Pituitary

B) Adrenal

C) Thyroid

D) Parathyroid

40 / 100

Category: Biology Ch 3 Class 11

Lock and Key Model for enzyme action propose by Emil Fischer suggests that:

PMC 2020
Biology
Enzymes
Elimination Tool:

A) Enzymes are unbiased for the substrate

B) Enzymes can modify their active sites

C) Enzymes are restricted to one reaction type

D) An enzyme can catalyze variety of reactions

41 / 100

Category: Biology Ch 8 Class 12

Which of the following condition is hybrid A. TT B. Tt C. tt D. All of these

All of these

42 / 100

Category: Biology Ch 12 Class 11

A part of the digestive system that is not in contact with food is the:

NTS 2017
Biology
Nutrition
Elimination Tool:

A) Small intestine

C) Liver

B) Stomach

D) Large intestine

43 / 100

Category: Biology Ch 7 Class 12

During the formation of an ovum nondisjunction of the sex chromosomes occurred the ovum was then fertilized by a normal Y-bearing sperm cell which one of the following shows the sex chromosome complement of the resulting zygote?

NTS 2015 DUHS and JSMU
Biology
Cell Cycle
Elimination Tool:

A) XO

B) XXY

C) XXXY

D) XXYY

44 / 100

Category: Biology Ch 9 Class 11

Which of the following is true in angiosperm life cycle?

NTS 2014
Biology
Kingdom Plantae
Elimination Tool:

A) Gametophyte are photosynthetic and partially independent than sporophyte

B) Sporophytes are totally dependent on gametophytes

C) Gametophytes are totally dependent on sporophytes

D) Both gametophytes and sporophytes are totally dependent on each other

45 / 100

Category: Biology Ch 5 Class 12

Which of the following is NOT a function of Abscisic acid?

PMC Sample 3
Biology
Growth and Development
Elimination Tool:

A) Inhibits stem and root growth during drought.

B) Closing of stomata during wilting.

C) Inhibits flowering in long-day plants

D) Promotes bud initiation during growth season.

46 / 100

Category: Biology

The enzyme found in saliva responsible for the digestion of carbohydrates is:

NUMS Mock 4
Biology
Enzymes

A) Lysozyme

B) Amylase

C) Pepsin

D) Trypsinogen

47 / 100

Category: Biology Ch 3 Class 11

An activated enzyme consisting of polypeptide chain and a cofactor is called:

Apoenzyme

Holoenzyme

Activated enzyme

Both b and c

48 / 100

Category: Biology Ch 4 Class 11

Percentage of proteins in cell membrane is

20-40%

40-50%

60-80%

80-100%

49 / 100

Category: Biology Ch 1 Class 12

Marine fish can keep their internal environment hypertonic with respect to the surrounding salty water by retaining.

Excessive urea which will increase their internal solute concentration and prevent body shrinkage in hypertonic environment

Trimethyl alanine

Ammonia

Trimethylamine oxide

50 / 100

Category: Biology Ch 12 Class 12

Evolution of vascular bundles in plants and skeleton in animals is an adaptation for

Hdrospheric ecosystem

Aquatic ecosystem

Terrestrial ecosystem

All of these

51 / 100

Category: Biology

Q.14 Aschelminthes is also known as which of the following?

A. Protozoans

B. Eumetazoa

C. Protoctist ancestors

D. Nematodes

52 / 100

Category: Biology Ch 4 Class 11

Who first observed and thus hypothesized that new cells are formed from previously existing living cell?

Theodor Schwann and Schleiden

Rudolph Virchows

Louis Pasteur

Both b and c

53 / 100

Category: Biology Ch 9 Class 12

The DNA that has been altered and which now contains length of nucleotides from two different organisms is called a:

PMC 2020
Biology
Biotechnology
Elimination Tool:

A) Plasmid

B) Combined DNA

C) Vector

D) Recombinant DNA

54 / 100

Category: Biology Ch 5 Class 12

The fate of each blastomere is foretold. What will that cleavage be?

PMC Sample 2
Biology
Growth and Development
Elimination Tool:

A) Spiral and indeterminate

B) Radial and determinate

C) Radial and indeterminate

D) Spiral and determinate

55 / 100

Category: Biology Ch 8 Class 11

A plant disease which is not caused by a fungus is:

NUMS 2015
Biology
Kingdom Fungi
Elimination Tool:

A) Red rot of Sugarcane

B) Late blight of Potato

C) Black rot of crucifers

D) Brown rust of wheat

56 / 100

Category: Biology Ch 13 Class 12

Study of environmental relations is called:

NUMS 2018
Biology
Man and His Environment
Elimination Tool:

A) Physiology

B) Pulmonology

C) Morphology

D) Ecology

57 / 100

Category: Biology Ch 9 Class 11

The first cell of the sporophyte generation is

Oospore

Spore mother cel

Spore

Gamete

58 / 100

Category: Biology Ch 8 Class 11

Oyster mushroom is an example of predator fungi which attack on

Pin warms

Tape worms

Round worms

Platehelminthes

59 / 100

Category: Biology Ch 7 Class 12

Interphase of meiosis lacks

G0 phase

G1 phase

G2 phase

S phase

60 / 100

Category: Biology Ch 3 Class 12

The _____ is the main nutritional part and it’s concerned with the biosynthesis of materials necessary for neurons.

NUMS 2019 Reconduct
Biology
Coordination and Control
Elimination Tool:

A) Nerves

B) Axon

C) Soma

D) Dendrites

61 / 100

Category: Biology Ch 7 Class 12

Spread of tumor cells and establishment of secondary areas of growth is

Benign tumors

Cancer

Metastasis

Epistasis

62 / 100

Category: Biology Ch 3 Class 11

In 1959, Koshland proposed which of the following?

PMC Practice 1
Biology
Enzymes
Elimination Tool:

A) Unit membrane model

B) Fluid mosaic model

C) Reflective index model

D) Induced fit model

63 / 100

Category: Biology Ch 1 Class 11

The branch of biology which deals with the study of social behavior and communal life of human beings living in any environment is called :

Environmental biology

Human biology

Both b and c

64 / 100

Category: Biology Ch 8 Class 11

Asexual spores of fungi are called:

NUMS 2020
Biology
Kingdom Fungi
Elimination Tool:

A) Conidiospores

B) Zygospores

C) Ascospores

D) Basidiospores

65 / 100

Category: Biology Ch 5 Class 12

Meristems are group of cells that

Allow the surrounding region to divide

Provide nutrition

. Help in movement

Retain the potential to divide

66 / 100

Category: Biology Ch 10 Class 12

Archaebacteria can survive at

150?C

300?C

120?C

200?C

67 / 100

Category: Biology Ch 10 Class 12

Choose the correct combination:

NUMS 2019 Cancelled
Biology
Evolution
Elimination Tool:

A) Darwin – survival of the fittest

B) Darwin – no extinction

C) Lamarck – acquired transmission

D) Both Darwin – survival of the fittest and Lamark – acquired transmission

68 / 100

Category: Biology Ch 11 Class 11

Its membranes are the sites where sunlight energy is trapped and where glucose is formed.

Which organelle is this?

NUMS 2014
Biology
Bioenergetics
Elimination Tool:

A) Chloroplast

B) Leucoplast

C) Chromoplast

D) Cytosol

69 / 100

Category: Biology Ch 7 Class 11

In which of the following growth phases, the number of bacteria increases the most rapidly?

NTS 2018
Biology
Kingdom Protista
Elimination Tool:

A) Lag phase

B) Log phase

C) Stationary phase

D) Death / Decline phase

70 / 100

Category: Biology Ch 13 Class 12

In oceans of tropical regions

Temperature of surface water is 40?C and 10?C at depth

Temp of surface water is 25?C and 5?C at depth

Surface water 50?C and depth 20?C

Surface water 10?C and depth 15?C

71 / 100

Category: Biology Ch 1 Class 12

In a hot summer after noon, if your body’s Homeostatic machinery keep your internal temperature quite lower than that of external than this is an example of

Positive feed back

Negative feed back

. Feed back

Osmoregulation

72 / 100

Category: Biology Ch 8 Class 12

A continuously varying trait is encoded by alleles of two or more different genes located at different loci, all influencing the same trait in an additive way is known as ________.

NUMS 2019 Cancelled
Biology
Variation and Genetics
Elimination Tool:

A) Poly traits

B) Polygenes

C) Multiple alleles

D) Different gene

73 / 100

Category: Biology Ch 3 Class 12

All of the following hormones are secreted from anterior lobe of pituitary gland BUT:

NUMS 2019 Reconduct
Biology
Coordination and Control
Elimination Tool:

A) Somatotropin hormone

B) Thyroid stimulating hormone

C) Antidiuretic hormone

D) Gonadotrophic hormone

74 / 100

Category: Biology

5 different amino acids, numbered 1, 2, 3, 4, and 5, below from the following sequence in the path of a polypeptide chain:

1-2-3-4-2-5-3

Messenger RNA codon, which correspond to the amino acids, are:
amino acid 1 UGU

amino acid 2 GAU

amino acid 3 CAC

amino acid 4 UAG

amino acid 5 AAG

Which one of the following DNA bases sequences could provide the code for the given section of the polypeptide?

NUMS Mock 2
Biology
Biological Molecules

A) ACACTTGTGATGCTATTCGTG

B) ACACUAGUGAUGCUAUUCGUG

C) ACACTAGTGATGCTAAACGTG

D) ACACTAGTGATCCTATTCGTG

75 / 100

Category: Biology Ch 7 Class 12

During meiosis, the homologous chromosomes come together and form pairs, this process is called:

PMC 2020
Biology
Cell Cycle
Elimination Tool:

A) Linkage

B) Synapsis

C) Pairing

D) Crossing over

76 / 100

Category: Biology Ch 4 Class 12

Luteinizing hormone, which is produced by the pituitary gland, promotes ovulation and stimulate the ovaries to produce:

NUMS 2019 Cancelled
Biology
Reproduction
Elimination Tool:

A) Estrogen

B) Estrogen and progesterone

C) Progesterone

D) Oxytocin

77 / 100

Category: Biology Ch 10 Class 12

Which condition can be explained by Lamarckism?

PMC Sample 1
Biology
Evolution
Elimination Tool:

A) How giraffes got their long neck

B) How humans lost their tail

C) How humans became bipedal

D) all of these

78 / 100

Category: Biology Ch 4 Class 11

Which of the statement about cell membrane is not true?

It contains protein molecules embedded in lipid bilayer

It is a differentially permeable membrane.

It contains charged pores thus ions being charged particles cross cell membrance much easier than neutral particles.

It may get infolded to engulf solid or liquid material.

79 / 100

Category: Biology Ch 12 Class 12

Which statement is incorrect?

Average rainfall in temperate deciduous forests is 750-1500mm

empera ture of coniferous alpine and boreal forests is upto 10 degrees

Northern coniferous forests are called Taiga

Coniferous forests located at high latitude are alpine

80 / 100

Category: Biology Ch 5 Class 12

he only promoter of Leaf’s senescence in the following plant hormones is:

PMC Practice 9
Biology
Coordination and Control
Growth and Development
Elimination Tool:

A) Gibberellins

B) Cytokinins

C) Auxins

D) Abscisic acid

81 / 100

Category: Biology Ch 9 Class 12

The genetically Engineered vaccine is not available for which of the following?

PMC Practice 8
Biology
Biotechnology
Elimination Tool:

A) HAV

B) HBV

C) HCV

D) HDV

82 / 100

Category: Biology Ch 12 Class 11

In planaria, numerous small branches which end blindly are called as

Digestive tract

Intestinal caeca

Hepatic caeca

Both B & C

83 / 100

Category: Biology Ch 2 Class 12

Which of the following plays the major role in providing support to young herbaceous parts of the plant:

Living cells of epidermis with higher turgor pressure.

Living cells of cortex and pith with higher turgor pressure.

Collenchyma cells

All of these

84 / 100

Category: Biology Ch 4 Class 12

Which one is not a day neutral plant?

Cucumber

Maize

Cotton

Tobacco

85 / 100

Category: Biology

Which of the following bones are present in the palm of the hand:

NUMS Mock 3
Biology
Support and Movement

A) Carpals

B) Metacarpals

C) Phalanges

D) Tarsal

86 / 100

Category: Biology Ch 1 Class 12

Which of the following occurs in the body in response to the secretion of Glucagon?

NUMS 2020
Biology
Homeostasis
Elimination Tool:

A) Conversion of glucose to glycogen in liver cells

B) Decrease in blood glucose concentration

C) Increased uptake of glucose by muscle cells

D) Production of cyclic AMP in target cells

87 / 100

Category: Biology

Q.50 Which of the following hormones is essential for the production of sperms?

A. LH
B. Estrogen
C. Gonadotrophin hormones
D. Testosterone

A. LH

B. Estrogen

C. Gonadotrophin hormones

D. Testosterone

88 / 100

Category: Biology Ch 11 Class 11

Of the following which one is not an energy releasing process?

Glycolysis

Respiration

Photosynthesis

Kreb's cycle

89 / 100

Category: Biology

Q.11 Which of the following statement regarding lecithin is correct?

A. Contain only one fatty acid

B. Choline attached with phosphatidic acid at carbon 3

C. Phosphate group is positively charged

D. Have five carbon glycerol molecules

90 / 100

Category: Biology

A/An ______ is an organism that makes ATP by aerobic respiration if oxygen is present, but is capable of switching to fermentation if oxygen is absent.

NUMS Mock 4
Biology
Nutrition

A) Cellular anaerobe

B) Respiratory anaerobe

C) Obligate anaerobe

D) Facultative anaerobe

91 / 100

Category: Biology

Q.2 The set of all genes in any population is termed as?

A. population pool

B. species pool

C. gene pool

D. all of these

92 / 100

Category: Biology Ch 5 Class 11

Viruses resemble living things because they:

NTS 2017
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Circulate

B) Move

C) Reproduce

D) Are crystalline

93 / 100

Category: Biology Ch 3 Class 11

Optimal temperature of enzymes present in human body is

27?C

37?C

47?C

30?C

94 / 100

Category: Biology Ch 7 Class 11

Which type of chlorophyll is found in all types of algae?

NUMS 2015
Biology
Kingdom Protista
Elimination Tool:

A) Chlorophyll a

B) Chlorophyll b

C) Chlorophyll c

D) Chlorophyll d

95 / 100

Category: Biology Ch 1 Class 12

Right kidney is slightly lower than left kidney due to:

NUMS 2018
Biology
Homeostasis
Elimination Tool:

A) Heart

B) Liver

D) Lungs

C) Pancreas

96 / 100

Category: Biology

Q.2 Prokaryotic and eukaryotic cells generally have which of the following features in common?

A. Cell wall made of cellulose

B. Presence of linear chromosome

C. Presence of ribosomes

D. Presence of nucleus

97 / 100

Category: Biology Ch 7 Class 12

DNA is synthesized and chromosome number is doubled in

G1 phase

S phase

G2 phase

G0 phase

98 / 100

Category: Biology Ch 12 Class 11

Nitrogen

Magnesium

Iron

Both A and B

99 / 100

Category: Biology Ch 5 Class 12

The fate of each blastomere is foretold. What will that cleavage be?

PMC Practice 9
Biology
Growth and Development
Elimination Tool:

A) Spiral and indeterminate

B) Radial and indeterminate

C) Radial and determinate

D) Spiral and determinate

100 / 100

Category: Biology Ch 11 Class 11

Many substances which are urgently required by the cell while cell absorbs them against the concentration gradient by utilizing energy in the form of:

NUMS 2019 Reconduct
Biology
Bioenergetics
Elimination Tool:

A) ATP

B) Heat

C) GTP

D) Light

Your score is

The average score is 61%

Structured Practice for Best Entry Test Preparation

This topic-wise and chapter-wise practice test allows students to focus on individual biology concepts, including diagrams, processes, and conceptual questions. Regular practice enhances understanding, sharpens problem-solving skills, and builds confidence to tackle both board and competitive exam questions efficiently.

Free Resources for Best Entry Test Preparation

Students can access free Biology Practice Test 4 to systematically improve knowledge, recall, and problem-solving abilities. This test is suitable for FSC Board Exams as well as major entry tests, helping students perform better in the biology section. PLS Academy provides these resources to support students in their preparation.

JazakAllah