Biology Practice Test 4

Biology Practice Test 4 is designed to help students strengthen their understanding of key biological concepts, theories, and processes for competitive entry tests like MDCAT, NUMS, AKU, UET, ECAT, NTS, as well as FSC Board Exams. This test covers topics from human anatomy, physiology, microbiology, and ecology, helping students improve accuracy and retention.

PLS Academy

Get Access to 20 thousands+ MCQs Including Topical MCQs, Practice Tests, Mock Tests, Solved Past Papers, Flashcards, Notes, FLPS, and Much More.

UNLOCK PREMIUM🔐

1244

Created by Ali Durrani

MDCAT Practice Tests

Biology Practice Test 4

This is the Free Access to Limited MCQs. Enroll to PLS Boost Premium Bundle to Get More MCQs HERE

1 / 100

Category: Biology Ch 2 Class 11

Reactive parts of an amino acid are:

NUMS 2015
Biology
Biological Molecules
Elimination Tool:

A) Alpha carbon & amino group

C) Carboxyl & R group

B) Amino group & carboxyl group

D) R group & alpha carbon

2 / 100

Category: Biology

Q.56 During cyclic photophosphorylation, electrons are diverted back to:

A. Plastoquinone

B. Cytochrome complex

C. Plastocyanin

D. Ferredoxin

3 / 100

Category: Biology

Q.51 The heavy and light chains of an antibody molecule is held together by:

A. H-bonds

B. Disulphide bridges

C. Ionic interactions

D. Hydrophobic interactions

4 / 100

Category: Biology Ch 5 Class 12

Apical meristems are located at

Tips of leaves

Tips of flowers

Tips of roots and stems

Tips of roots only

5 / 100

Category: Biology

The spectrum of He is expected to be similar to that of:

NUMS Mock 4
Chemistry
Atomic Structure

A) Hydrogen

B) Sodium

C) Oxygen

D) Li+

6 / 100

Category: Biology Ch 6 Class 12

The true E.Coli replicating enzyme is

DNA polymerase I

DNA polymerase II

DNA polymerase III

All of these

7 / 100

Category: Biology

Q.38 Which of the following best describes a coenzyme?

A. Covalently bonded non-protein part of an enzyme

B. Cofactor consists of metal ions

C. Loosely bonded non-protein part of an enzyme

D. Both A and B

8 / 100

Category: Biology Ch 4 Class 12

Fallopian tube in humans is important for:

NUMS 2018
Biology
Reproduction
Elimination Tool:

A) Ovulation

B) Primary oocyte

D) Ova

C) Secondary oocyte

9 / 100

Category: Biology

A group of biologically active molecules formed from amino acids which interact with the surface of the lipid bilayer of cell membranes are called:

NUMS Mock 3
Biology
Biological Molecules

A) Integral Proteins

B) Peripheral proteins

C) Cell wall

D) Plasmodesmata

10 / 100

Category: Biology Ch 9 Class 11

Which characteristic led to the evolution of seed?

NUMS 2020
Biology
Kingdom Plantae
Elimination Tool:

A) Heterogamous condition

B) Development of heterospory

C) Embryo formation

D) Protection of reproductive cells

11 / 100

Category: Biology

Q.9 The linkage formed when one molecule of glucose combines with one molecule of fructose is:

A. 1, 2-glycosidic linkage

B. 1, 6-glycosidic linkage

C. 1, 4-glycosidic linkage

D. 1,3-glycosidic linkage

12 / 100

Category: Biology

Which component enters into mitochondria after glycolysis?

NUMS Mock 1
Biology
Bioenergetics

A) Pyruvate

B) Acetate

C) Oxaloacetate

D) Acetyl – CoA

13 / 100

Category: Biology

The excretion of hypertonic urine in humans is associated best with the:

NUMS Mock 1
Biology
Homeostasis

A) Glomerular capsule

B) Proximal convoluted tubule

C) Loop of Henle

D) Distal convoluted tubule

14 / 100

Category: Biology

The idea that opposed the idea of abiogenesis was proposed by?

NUMS Mock 4
Biology
Cell Structure and Function

A) Robert Hooke

B) Robert Brown

C) Rudolph Virchow

D) Lorenz Oken

15 / 100

Category: Biology Ch 10 Class 11

Organs which produce voice in birds is:

NUMS 2016
Biology
Kingdom Animalia
Elimination Tool:

A) Larynx

C) Syrinx

B) Pharynx

D) Both A and C

16 / 100

Category: Biology Ch 5 Class 12

Intercalary meristems are of

Permanent nature

Temporary nature

Some are permanent some temporary

None of these

17 / 100

Category: Biology Ch 11 Class 11

Where do the light – dependent reactions of photosynthesis occur?

NTS 2016 SMBBMC
Biology
Bioenergetics
Elimination Tool:

A) In the guard cells of the stomata

B) Stroma of chloroplast

C) In the thylakoid membrane of chloroplast

D) Cytoplasm of leaf cell

18 / 100

Category: Biology Ch 8 Class 11

Ecological role of fungi as decomposers is only paralleled by

Blue green algae

Cyanobacteria

Bacteria

Virus

19 / 100

Category: Biology Ch 12 Class 11

Which enzyme present in the stomach curdles the milk?

NUMS 2016
Biology
Nutrition
Elimination Tool:

A) Rennin

B) Trypsin

C) Pepsin

D) Lipase

20 / 100

Category: Biology Ch 6 Class 11

In which phase of bacterial growth, does divison at an exponential rate occur?

NUMS 2020
Biology
Kingdom Prokaryote
Elimination Tool:

A) Lag phase

B) Log phase

C) Stationary phase

D) Decline phase

21 / 100

Category: Biology Ch 10 Class 11

The only aquatic arthropods:

PMC Sample 1
Biology
Kingdom Animalia
Elimination Tool:

A) Crustaceans

B) Arachnids

C) Myriapods

D) Gastopods

22 / 100

Category: Biology Ch 4 Class 12

Which characteristic is not of identical twins

. Produced by separation of two blastomeres

Have different genetic makeup

Produced asexually

Produced when embryo is at two cell stage

23 / 100

Category: Biology Ch 2 Class 11

Human cells maintain concentration gradients across their plasma membranes, such that there is a high sodium concentration outside the cell and a high potassium concentration inside the cell.

Suppose that within the cell membrane are sodium leak channels or carrier proteins. These channels would allow sodium to:

NTS 2017
Biology
Biological Molecules
Elimination Tool:

A) move out of the cell by simple diffusion

B) move into the cell by simple diffusion

C) move out of the cell by facilitated diffusion

D) move into the cell by facilitated diffusion

24 / 100

Category: Biology Ch 2 Class 11

Which bond provides stability to complex carbohydrate molecules?

C-H

C-O

C-C

C-N

25 / 100

Category: Biology

Q43 Which cells produce oogonia in ovary?

A. Stromal cells

B. Epithelial cells

C. Germ cells

D. Theca cells

26 / 100

Category: Biology Ch 4 Class 11

Suggest which among the following is not a function attributed to endoplasmic reticulum?

PMC 2020
Biology
Cell Structure and Function
Elimination Tool:

A) Detoxification of poisons and drugs

B) Digestion/egestion of foreign materials outside the cell

C) Manufacture of fat and lipid molecules

D) Biogenesis of membrane proteins

27 / 100

Category: Biology Ch 6 Class 12

Particular array of chromosomes that an individual processes is called its:

NUMS 2019 Reconduct
Biology
Chromosomes and DNA
Elimination Tool:

A) Nucleosome

B) Gene pool

C) Karyotype

D) Centromere

28 / 100

Category: Biology Ch 1 Class 12

As an excretory organ, liver:

PMC 2020
Biology
Homeostasis
Elimination Tool:

A) Detoxifies many chemical poisons

B) Produces ammonia for excretion by the kidneys

C) Produces urea and uric acids from the nitrogen of amino acids

D) All of the above

29 / 100

Category: Biology Ch 6 Class 11

Which of the following has a chain arrangement?

Streptobacillus

Streptococci

Staphylococci

Both A and B

30 / 100

Category: Biology Ch 6 Class 11

The first bacterium isolated was

Coccus

Bacillus

Vibrio

Spirochete

31 / 100

Category: Biology Ch 10 Class 12

Flagella might have arisen through the ingestion of

Cyano-bacteria

Spirochetes

Chlamydomonas

Paramecium

32 / 100

Category: Biology Ch 5 Class 11

Organisms of which of the following kingdom have absorptive mode of nutrition:

Prokaryotae

Protoctista

Animalia

Fungi

33 / 100

Category: Biology Ch 3 Class 12

The prolactin hormone, responsible for the activation of mammary glands to start producing milk, is a hormone of the:

NTS 2010
Biology
Coordination and Control
Elimination Tool:

A) Pituitary gland

B) Pancreas

C) Thyroid gland

D) Thymus gland

34 / 100

Category: Biology Ch 5 Class 12

The cells in our body are all genetically identical, apart from the:

PMC 2020
Biology
Growth and Development
Elimination Tool:

A) Somatic cells

B) Reproductive cells

D) White blood cells

C) Muscle fibers

35 / 100

Category: Biology Ch 6 Class 12

DNA contains

Purines (A and G) pyrimidines (U and (c)

Purines (T and (c) pyrimidines (A and G)

Purines (A and (c) pyrimidines (U and G)

Purines (A and G) pyrimidines (T and (c)

36 / 100

Category: Biology Ch 9 Class 12

Taq polymerase is extracted from a bacterium

Floral aquaticus

Taq aquaticus

Thermus floral

Thermus aquaticus

37 / 100

Category: Biology Ch 11 Class 11

Light reaction takes place on/in

Thylakoid

Storma

Chloroplast

Grana

38 / 100

Category: Biology Ch 5 Class 12

Meristems are group of cells that

Allow the surrounding region to divide

Provide nutrition

. Help in movement

Retain the potential to divide

39 / 100

Category: Biology Ch 5 Class 11

HIV is a:

NUMS 2018
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Virus

B) Prions

C) Viroid

D) Venom

40 / 100

Category: Biology

The table shows the characteristics of the blood in one blood vessel in the body.

Which blood vessel contains blood with these characteristics?

NUMS Mock 1
Biology
Transport

A) Aorta

B) Pulmonary artery

C) Pulmonary vein

D) Vena cava

41 / 100

Category: Biology Ch 5 Class 11

Which of the Euglenas (a Protoctista) character resembles that of animals:

They can move

They lack cell wall

They do not have chlorophyll

Both a and b

42 / 100

Category: Biology Ch 1 Class 12

Which part of the brain regulates body temperature?

NTS 2016 SMBBMC
Biology
Homeostasis
Elimination Tool:

A) Cerebellum

B) Cerebrum

C) Hypothalamus

D) Medulla

43 / 100

Category: Biology Ch 5 Class 12

Lateral meristems are present in

All plants

Gymnosperms and dicots

Monocots

In aquatic plants

44 / 100

Category: Biology Ch 10 Class 11

Archaeopteryx is a connecting link between:

NUMS 2014
Biology
Kingdom Animalia
Elimination Tool:

A) Amphibians and reptiles

B) Reptiles and birds

C) Birds and mammals

D) None of these

45 / 100

Category: Biology Ch 9 Class 11

Which of the following is not a parasitic fungus of plants?

NUMS 2015
Biology
Kingdom Plantae
Elimination Tool:

A) Rust

B) Mildews

C) Armillaria

D) None of the given options

46 / 100

Category: Biology Ch 12 Class 12

Weather refers to

Short-term fluctuations in temperature, cloud cover, wind and precipitation

It prevails over periods of hrs or days

Overall patterns of weather that prevail from year to year

. Both a and b

47 / 100

Category: Biology Ch 1 Class 12

Which of the following structure in plant’s body is called excretophores?

Stem

Leaves

Flowers

Roots

48 / 100

Category: Biology Ch 13 Class 11

Gaseous exchange in plants takes place through the:

NUMS 2020
Biology
Gaseous Exchange
Elimination Tool:

A) Stomata

B) Mesophyll

C) Endoderm

D) Xylem

49 / 100

Category: Biology Ch 1 Class 12

In osmosis water molecules move from area of _______ to _______ through semipermeable memberane

Higher solute concentration to lower solute concentration

Lower solute concentration to higher solute concentration

Lower solvent concentration to higher solvent concentration

All of these

50 / 100

Category: Biology Ch 9 Class 11

Excess water in plants is forced out in the form of droplets through?

PMC 2021 Tested
Biology
Kingdom Plantae
Elimination Tool:

A) Lenticles

B) Stomata

C) Hydathodes

D) Cuticle

51 / 100

Category: Biology

5 different amino acids, numbered 1, 2, 3, 4, and 5, below from the following sequence in the path of a polypeptide chain:

1-2-3-4-2-5-3

Messenger RNA codon, which correspond to the amino acids, are:
amino acid 1 UGU

amino acid 2 GAU

amino acid 3 CAC

amino acid 4 UAG

amino acid 5 AAG

Which one of the following DNA bases sequences could provide the code for the given section of the polypeptide?

NUMS Mock 2
Biology
Biological Molecules

A) ACACTTGTGATGCTATTCGTG

B) ACACUAGUGAUGCUAUUCGUG

C) ACACTAGTGATGCTAAACGTG

D) ACACTAGTGATCCTATTCGTG

52 / 100

Category: Biology Ch 4 Class 12

In human females, oocytes are held in the second metaphase until ________.

NUMS 2019 Reconduct
Biology
Reproduction
Elimination Tool:

A) Death

B) Birth

C) Ovulation

D) Fertilization

53 / 100

Category: Biology Ch 3 Class 12

Diameter of an artery can be changed by:

NUMS 2015
Biology
Coordination and Control
Elimination Tool:

A) Nervous stimulation

B) Chemical stimulation

C) Both chemical and nervous stimulation

D) None of the given options

54 / 100

Category: Biology Ch 1 Class 12

When a frog is kept in water for some time it sheds a thin covering of skin called ____

NUMS 2014
Biology
Homeostasis
Elimination Tool:

A) Cuboidal epithelium

B) Squamous epithelium

C) Columnar epithelium

D) Ciliated epithelium

55 / 100

Category: Biology

Q.26 Two pea plants are crossed. One plant is homozygous dominant for purple flowers, and the other is homozygous recessive for white lowers. What fraction of the F2 population will have white lowers?

A. 1/4

B. 1/2

C. 1/8

D. 1/16

56 / 100

Category: Biology Ch 10 Class 12

Who developed a theory of natural selection essentially identical to Darwin’s

Hardy-Weinberg

Alfred Wallace

Malthus

Lyell

57 / 100

Category: Biology

Q.49 Gastric secretion is stimulated by:

A. Gastrin

B. Cholecystokinin

C. Secretin

D. Pancreozymin

58 / 100

Category: Biology Ch 9 Class 12

A single gene can be amplified by using:

NUMS 2019 Reconduct
Biology
Biotechnology
Elimination Tool:

A) DNA fingerprinting

B) Polymerase Chain Reaction

C) Gel Electrophoresis

D) Recombinant DNA technology

59 / 100

Category: Biology Ch 14 Class 11

Antibodies are actually:

NUMS 2016
Biology
Transport
Elimination Tool:

A) Globular proteins

B) Glycoproteins

C) Fibrous proteins

D) Glycolipids

60 / 100

Category: Biology Ch 11 Class 11

What is the function of Ribulose?

PMC 2020
Biology
Bioenergetics
Elimination Tool:

A) Intermediates in photosynthesis

B) Respiratory fuel

C) Intermediates in cellular respiration

D) Component of DNA and RNA

61 / 100

Category: Biology Ch 7 Class 11

Which of the following statement about eiliates in incorrect?

Contain mainly unicellular organisms.

Their contractile vacoule is respobsible for water regulation.

They are even capable of sexual reproduction.

Diploid nucleus being smaller is responsible for cells metabolism and growth while polyploidy nucleus functions in sexual process.

62 / 100

Category: Biology

Which type of protein structure contains the three dimensional structure?

NUMS Mock 3
Biology
Biological Molecules

A) Primary

B) Secondary

C) Tertiary

D) Quaternary

63 / 100

Category: Biology Ch 1 Class 12

________ are animals that do not adjust their internal osmolality and are isotonic with their environment.

NUMS 2019 Cancelled
Biology
Homeostasis
Elimination Tool:

A) Osmoconformers

B) Osmoregulators

C) Thermoregulators

D) Thermoconformers

64 / 100

Category: Biology Ch 2 Class 12

The movement of plants in response to touch stimulus is called:

NTS 2012
Biology
Support and Movement
Elimination Tool:

A) Hydrotropism

B) Chemotropism

C) Geotropism

D) Thigmotropism

65 / 100

Category: Biology Ch 4 Class 11

The first layer of cell wall which is formed is:

Primary wall

Secondary wall

Middle lamella

All of these

66 / 100

Category: Biology Ch 4 Class 12

Viviparous animals are those in which

. Internal fertilization with external development in eggs

Internal fertilization with internal development inside female body

Internal fertilization and internal development followed by hatching of egg

External fertilization with external development

67 / 100

Category: Biology Ch 1 Class 12

Negative feedback mechanism is the characteristic of which class?

NUMS 2020
Biology
Homeostasis
Elimination Tool:

A) Class Fish

B) Class Amphibia

C) Class Reptilia

D) Class Mammalia

68 / 100

Category: Biology

Which processes are essential in making nitrogen from dead plant material available to growing plants?

ammonification
deamination
nitrification
nitrogen fixation
NUMS Mock 2
Biology
Man and His Enviornment

A) I, II and III only

B) I, II and IV only

C) I, III and IV only

D) II, III and IV only

69 / 100

Category: Biology Ch 1 Class 12

The disease in which patients passed urine that rapidly turned black on exposure to air is called:

NTS 2011
Biology
Homeostasis
Elimination Tool:

A) Phenylketonuria

B) Alkaptonuria

C) Sickle cell anemia

D) Hemophilia

70 / 100

Category: Biology Ch 9 Class 12

Protoplasts are plant cells from which

. Cell walls are removed

Nucleus is removed

New organelles are added

Vacuoles are taken out

71 / 100

Category: Biology Ch 9 Class 12

The Plasmid pBR322 has antibiotic resistance genes for:

UHS 2019
Biology
Biotechnology
Elimination Tool:

A) Streptomycin

B) Ampicillin and Tetracycline

C) Tetracycline and mxycycline

D) Ampicillin

72 / 100

Category: Biology Ch 9 Class 11

The first cell of the sporophyte generation is

Oospore

Spore mother cel

Spore

Gamete

73 / 100

Category: Biology Ch 3 Class 11

A substance which binds at the active site of the enzyme but does not result in the formation of the products is called:

Irreversible inhibitor

Reversible inhibitor

Competitive inhibitor

Non-competitive inhibitor

74 / 100

Category: Biology Ch 9 Class 12

Organisms that have had a foreign gene inserted into them are

Transformed organisms

Transgenic organisms

Transfigured organisms

Recombinant organisms

75 / 100

Category: Biology Ch 5 Class 11

Recent studies on HIV reveal that the virus infects and multiplies in _____ but does NOT cause disease in them.

NUMS 2019 Reconduct
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Monkeys

B) Cats

C) Horses

D) Dogs

76 / 100

Category: Biology Ch 12 Class 11

Midgut in cockroach is a short narrow tube called

Hepatic caeca

Gizzard

Stomach

Rectum

77 / 100

Category: Biology

Q.21 The spent energy in the form pf ADP is regeneratèd by mitochondria into which of the following forni?

A. AMP

B.ATP

C.ADP

D.All of these

78 / 100

Category: Biology Ch 1 Class 11

A series of hypothesis supported by the results of many tests is called

Scientific law

Theory

Deduction

79 / 100

Category: Biology

The only possible treatment in end stage renal failure is:

NUMS Mock 3
Biology

A) Hemodialysis

B) Peritoneal dialysis

C) Lithotripsy

D) Kidney transplantation

80 / 100

Category: Biology Ch 10 Class 11

Leptocardii is a group of:

NUMS 2015
Biology
Kingdom Animalia
Elimination Tool:

A) Urochordata

B) Cephalochordata

C) Vertebrata

D) Mollusca

81 / 100

Category: Biology

Q.44 When calcium gates of the smooth endoplasmic reticulum are open, then calcium is released into:

A. Cytosol

B. Organelle lumen

C. Nucleoplasm

D. Directly taken up by myofilament

82 / 100

Category: Biology

During cell division, the spindle fibres get attached to condensing chromosome at a highly differentiated region. This region is called as:

NUMS Mock 1
Biology
Cell Cycle

A) Chromosome

B) Chromocentre

C) Centriole

D) Kinetochore

83 / 100

Category: Biology

The Porifera are pore – bearing animals, commonly called:

NUMS Mock 3
Biology
Kingdom Animalia

A) Corals

B) Sponges

C) Hydras

D) Anemones

84 / 100

Category: Biology

Q.13 The frequency of allele if it is evolutionary successful is?

A. increased

B. Enzymes

C. no change

D. All of these

85 / 100

Category: Biology Ch 6 Class 12

Which of the following enzymes is used to join DNA fragments?

NTS 2016 DUHS & JSMU
Biology
Chromosomes and DNA
Elimination Tool:

A) DNA polymerase

B) Ligase

C) Primase

D) Endonuclease

86 / 100

Category: Biology Ch 12 Class 11

Undigested food in cockroach is stored in:

NUMS 2015
Biology
Nutrition
Elimination Tool:

A) Crop

B) Rectum

C) Gizzard

D) Crop & Rectum

87 / 100

Category: Biology Ch 6 Class 11

Which of the following statement is incorrect regarding germ theory of diseases postulated by Robert Koch?

A specific organism can always be found in association with a given disease

The organism can be isolated and grown in pure culture in the laboratories

The pure culture cannot produce the disease when inoculated into susceptible animal however the causative organism isolated from pure culture can do so.

It is possible to recover the organism in pure culture from the experimentally infected animals.

88 / 100

Category: Biology

_________ is the exact position of a gene on the chromosome.

NUMS Mock 3
Biology
Chromosomes and DNA

A) Trait

B) Centromere

C) Genotype

D) Locus

89 / 100

Category: Biology Ch 3 Class 12

On land, frogs are:

NUMS 2014
Biology
Coordination and Control
Elimination Tool:

A) Hypermetric

B) Cerebral cortex

C) Normal sighted

D) None of these

90 / 100

Category: Biology

Q.3 Which statement about cell membrane is incorrect?

A. Proteins are embedded in lipid bilayer

B. Cholesterol molecules are present in hydrophobic core

C. Central core is hydrophobic

D. Carbohydrates are present on both inner and outer face of the membrane

91 / 100

Category: Biology Ch 3 Class 11

An enzyme increases the speed of a reaction:

NTS 2012
Biology
Enzymes
Elimination Tool:

A) by adding activation energy requirements

B) by lowering the activation energy requirements

C) by decreasing the concentration of products

D) by increasing the concentration of products

92 / 100

Category: Biology Ch 6 Class 12

Within the chromosomes, each chromatid contains ______ DNA molecule:

NUMS 2020
Biology
Chromosomes and DNA
Elimination Tool:

A) One

B) Two

C) Three

D) Half

93 / 100

Category: Biology Ch 12 Class 11

Which of the following nutrients is incorrectly paired with its function in a plant?

NTS 2016 SMBBMC
Biology
Nutrition
Elimination Tool:

A) Potassium – Formation of cell wall.

B) Magnesium – Constituent of chlorophyll.

C) Nitrogen – Constituent of protein.

D) Phosphorus – Component of nucleic acid.

94 / 100

Category: Biology

Q.54 Structures that were once functional in the past but no longer serve a purpose due to evolutionary adaptations and physiological changes are referred to as?

A Vestigial
B. Analogous structures
C. Homologous structures
D. None of these

A Vestigial

B. Analogous structures

C. Homologous structures

D. None of these

95 / 100

Category: Biology Ch 9 Class 11

Below the point at which the cotyledons are attached, the embryo axis is called _______.

NTS 2016 SMBBMC
Biology
Kingdom Plantae
Elimination Tool:

A) Radicle

B) Epicotyl

C) Hypocotyl

D) Coleoptile

96 / 100

Category: Biology Ch 6 Class 12

Chromosomes are composed of

40% protein and 60% DNA

50% protein and 50% DNA

70% protein and 30% DNA

60% protein and 40% DNA

97 / 100

Category: Biology Ch 5 Class 11

It is very stable and allows viruses to exist in water, air, and the ground.

PMC Sample 1
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Nucleoproteins

B) Nucleocapsid

C) Tail of virus

D) Capsid

98 / 100

Category: Biology

Pathway of energy used by muscles converted from food is:

NUMS Mock 3
Biology
Bioenergetics
Support and Movement

A) Food-ATP-creatine phosphate- protein

B) Food-glycogen- ATP-creatine phosphate

C) Food-glycogen-creatine phosphate- ATP

D) Food-protein-creatine phosphate- ATP

99 / 100

Category: Biology Ch 9 Class 11

Why do Bryophytes and ferns both require water for fertilization?

NUMS 2015
Biology
Kingdom Plantae
Elimination Tool:

A) Ciliated spermatozoa instead of flagellated spermatozoa

B) Sporophyte as the main generation instead of the gametophyte generation

D) Non-motile eggs

C) Flagellated spermatozoa can travel

100 / 100

Category: Biology Ch 12 Class 11

The propulsive movement of the gastrointestinal tract (GI tract) is:

NTS 2010
Biology
Nutrition
Elimination Tool:

A) Peristalsis

B) Epiglottis

C) Antiperistalsis

D) Anus

Your score is

The average score is 61%

Structured Practice for Best Entry Test Preparation

This topic-wise and chapter-wise practice test allows students to focus on individual biology concepts, including diagrams, processes, and conceptual questions. Regular practice enhances understanding, sharpens problem-solving skills, and builds confidence to tackle both board and competitive exam questions efficiently.

Free Resources for Best Entry Test Preparation

Students can access free Biology Practice Test 4 to systematically improve knowledge, recall, and problem-solving abilities. This test is suitable for FSC Board Exams as well as major entry tests, helping students perform better in the biology section. PLS Academy provides these resources to support students in their preparation.

JazakAllah