Biology Practice Test 4

Biology Practice Test 4 is designed to help students strengthen their understanding of key biological concepts, theories, and processes for competitive entry tests like MDCAT, NUMS, AKU, UET, ECAT, NTS, as well as FSC Board Exams. This test covers topics from human anatomy, physiology, microbiology, and ecology, helping students improve accuracy and retention.

PLS Academy

Get Access to 20 thousands+ MCQs Including Topical MCQs, Practice Tests, Mock Tests, Solved Past Papers, Flashcards, Notes, FLPS, and Much More.

UNLOCK PREMIUM🔐

1244

Created by Ali Durrani

MDCAT Practice Tests

Biology Practice Test 4

This is the Free Access to Limited MCQs. Enroll to PLS Boost Premium Bundle to Get More MCQs HERE

1 / 100

Category: Biology Ch 10 Class 11

Which one of the following coelenterate is also called the Portuguese man of war?

NUMS 2014
Biology
Kingdom Animalia
Elimination Tool:

A) Hydra

B) Velella

C) Obelia

D) Physalis

2 / 100

Category: Biology

Q.27 During which of the following levels of biological organization can natural selection occur?

A. Gene

B. Individual

C. Group

D. All of these

3 / 100

Category: Biology Ch 2 Class 12

When the muscle is required to contract, calcium ion binds with ______ molecule and causes them to move slightly.

NUMS 2019 Cancelled
Biology
Support and Movement
Elimination Tool:

A) Actin

B) Myosin

C) Troponin

D) Tropomyosin

4 / 100

Category: Biology Ch 12 Class 11

Intrinsic factor is secreted by:

NUMS 2020
Biology
Nutrition
Elimination Tool:

A) Pancreas

B) Liver

C) Stomach

D) Duodenum

5 / 100

Category: Biology Ch 1 Class 11

The atoms of different elements combine with each other through ionic or covalent bonding to produce compounds this stable form is called:

An organ

Tissue

Both a and c

6 / 100

Category: Biology Ch 11 Class 11

Where do the light – dependent reactions of photosynthesis occur?

NTS 2016 SMBBMC
Biology
Bioenergetics
Elimination Tool:

A) In the guard cells of the stomata

B) Stroma of chloroplast

C) In the thylakoid membrane of chloroplast

D) Cytoplasm of leaf cell

7 / 100

Category: Biology

_______ is involved in lipid synthesis/metabolism.

NUMS Mock 4
Biology
Cell Structure and Function

A) Smooth endoplasmic reticulum

B) Rough endoplasmic reticulum

C) Mitochondria

D) Vacuoles

8 / 100

Category: Biology Ch 7 Class 12

Each kinetochore gets ________ fibers in mitosis

9 / 100

Category: Biology Ch 14 Class 11

Consider the following statements regarding blood pressure:

1. It is the pressure exerted by the blood on the walls of any vessel.

2. It decreases in the arteries as the distance from the heart increases.

3. It is lower in the capillaries than in the arteries.

4. It is usually lower in women than in men.

Choose the correct statements.

NTS 2015 DUHS and JSMU
Biology
Transport
Elimination Tool:

A) 1, 2 and 3 are correct.

B) 2, 3 and 4 are correct.

C) 1 and 4 are correct.

D) 1, 2, 3 and 4 are correct.

10 / 100

Category: Biology

Which of the following is not related to apoptosis?

NUMS Mock 1
Biology
Growth and Development

A) Loss of tail of developing humans embryos

B) Loss of tissues between developing digits

C) Controlling the number of neurons

D) None of the given options

11 / 100

Category: Biology

Q.28 The enzyme which plays important role in HIV pathogenesis

A. RNA polymerase I

B. DNA polymerase II

C. Reverse Transcriptase I

D. Reverse Transcriptase

12 / 100

Category: Biology Ch 13 Class 11

The air spaces may comprise upto ______ of total volume of leaf surface.

30%

20%

40%

50%

13 / 100

Category: Biology Ch 4 Class 12

Which one of the following represents the changes that occur in the ovary and the uterus approximately every 28 days involving ovulation with the breakdown and loss of the lining of the uterus?

PMC 2020
Biology
Reproduction
Elimination Tool:

A) Ovulation

B) Menstrual cycle

C) Uterine cycle

D) Embryo formation

14 / 100

Category: Biology

The excretion of hypertonic urine in humans is associated best with the:

NUMS Mock 1
Biology
Homeostasis

A) Glomerular capsule

B) Proximal convoluted tubule

C) Loop of Henle

D) Distal convoluted tubule

15 / 100

Category: Biology Ch 10 Class 11

Filter feeders extract food particles from:

NUMS 2014
Biology
Kingdom Animalia
Elimination Tool:

A) Water

B) Soil

C) Air

D) Blood

16 / 100

Category: Biology Ch 13 Class 11

Booklungs serve the function of respiration in:

NTS 2014
Biology
Gaseous Exchange
Elimination Tool:

A) Scorpion

B) Earthworm

C) Frog

D) Cockroaches

17 / 100

Category: Biology Ch 10 Class 11

Scales are present in:

NUMS 2015
Biology
Kingdom Animalia
Elimination Tool:

A) Fishes

B) Reptiles

C) Birds

E) A and B

18 / 100

Category: Biology

A/An ______ is an organism that makes ATP by aerobic respiration if oxygen is present, but is capable of switching to fermentation if oxygen is absent.

NUMS Mock 4
Biology
Nutrition

A) Cellular anaerobe

B) Respiratory anaerobe

C) Obligate anaerobe

D) Facultative anaerobe

19 / 100

Category: Biology Ch 2 Class 11

5 different amino acids, numbered 1, 2, 3, 4, and 5, below from the following sequence in the path of a polypeptide chain:

1-2-3-4-2-5-3

Messenger RNA codon, which correspond to the amino acids, are:
amino acid 1 UGU

amino acid 2 GAU

amino acid 3 CAC

amino acid 4 UAG

amino acid 5 AAG

Which one of the following DNA bases sequences could provide the code for the given section of the polypeptide?

NTS 2015 DUHS and JSMU
Biology
Biological Molecules
Elimination Tool:

A) ACACTTGTGATGCTATTCGTG

B) ACACUAGUGAUGCUAUUCGUG

C) ACACTAGTGATGCTAAACGTG

D) ACACTAGTGATCCTATTCGTG

20 / 100

Category: Biology Ch 10 Class 12

Who developed a theory of natural selection essentially identical to Darwin’s

Hardy-Weinberg

Alfred Wallace

Malthus

Lyell

21 / 100

Category: Biology Ch 13 Class 12

Total area of the world under cultivation is

11%

21%

31%

22 / 100

Category: Biology Ch 9 Class 11

Which of the following statement about plants is incorrect?

PMC Sample 2
Biology
Kingdom Plantae
Elimination Tool:

A) All are eukaryotes

B) They are multicellular

C) Non-motile organisms

D) Are heterotrophs

23 / 100

Category: Biology Ch 10 Class 11

The name animal is derived from the word.

Anima

Anemia

Aname

All of these

24 / 100

Category: Biology Ch 8 Class 12

In ‘Complete Dominance’:

PMC 2020
Biology
Variation and Genetics
Elimination Tool:

A) Different alleles of a gene are both expressed in heterozygous condition

B) One allele (R) is completely dominant over the other (r) and the presence of the recessive allele is functionally hidden, so the heterozygote (Rr) has the same round phenotype as (RR) homozygote.

C) The phenotype of the heterozygote is intermediate between phenotypes of the two homozygotes

D) Gene mutations may produce many different alleles of a gene

25 / 100

Category: Biology

Bones of the skull are joined by:

NUMS Mock 2
Biology
Support and Movement

A) Fixed joints

B) Sliding joints

C) Pivot joints

D) Hinge joints

26 / 100

Category: Biology Ch 1 Class 11

Oxygen accounts for ____ % of totals human body mass:

65%

18%

10%

27 / 100

Category: Biology

What is the effect of enzyme DNA ligase?

NUMS Mock 2
Biology
Chromosomes and DNA

A) DNA is broken up at specific sites

B) DNA fragments are joined together

C) DNA replication occurs

D) DNA transcription occurs

28 / 100

Category: Biology Ch 7 Class 11

How are flat worms not similar to round worms?

PMC Practice 4
Biology
Kingdom Protista
Elimination Tool:

A) They are both acoelmates.

B) They are both triploblastic.

C) They both show bilateral symmetry.

D) They are both worms.

29 / 100

Category: Biology Ch 5 Class 12

Tails can be regenerated in:

NUMS 2015
Biology
Growth and Development
Elimination Tool:

A) The larvae of amphibians

B) Lizards

C) Both lizards and the larvae of amphibians

D) None of the given options

30 / 100

Category: Biology Ch 6 Class 11

Cell wall is only absent in the following group of bacteria;

PMC Practice 6
Biology
Kingdom Prokaryote
Elimination Tool:

A) Staphylococci

B) Pseudomunas

C) Diplococcus pneumonia

D) Mycoplasmas

31 / 100

Category: Biology Ch 14 Class 11

About 55% of the volume of the human blood is?

NTS 2015 SMBBMC
Biology
Transport
Elimination Tool:

A) Plasma

B) Blood proteins

C) Blood cells

D) Both B and C

32 / 100

Category: Biology

Process ensuring the survival of species over long periods of time, even though individual members of the species die.

NUMS Mock 2
Biology
Man and His Environment

A) Reproduction

B) Adaptability

C) Mitosis

D) Respiration

33 / 100

Category: Biology Ch 3 Class 12

Which hormone is chemically a steroid?

NUMS 2020
Biology
Coordination and Control
Elimination Tool:

A) ADH

B) Thyroxin

C) Cortisone

D) Insulin

34 / 100

Category: Biology Ch 9 Class 12

Transgenic organisms:

PMC 2020
Biology
Biotechnology
Elimination Tool:

A) Have a foreign gene inserted into them

B) Have an important role in the large scale production of medicinal products

C) Are considered beneficial to humans

D) All of the above

35 / 100

Category: Biology Ch 4 Class 12

In the male reproductive tract, sperm cells follow a specific path. Which of the following do sperm cells enter after traveling through the epididymis?

PMC Sample 2
Biology
Reproduction
Elimination Tool:

A) Urethra

B) Seminiferous tubules

C) Ejaculatory duct

D) Vas deferens

36 / 100

Category: Biology Ch 2 Class 12

Which of the following statement is incorrect about Molluscans?

They are surrounded by single or double pieces of hard skeleton.

Their shell grows as the animal grows.

They have hydrostatic skeleton

They move by tube feet

37 / 100

Category: Biology

Phenylmethyl ketone can be converted into ethyl benzene in one step by using:

NUMS Mock 4
Chemistry
Aldehydes and Ketones

A) LiAlH4

B) Zn(Hg)-HCl

C) NaBH4

D) CH3Mgl

38 / 100

Category: Biology Ch 8 Class 12

Erythroblastosis foetalis occurs when:

NTS 2011
Biology
Variation and Genetics
Elimination Tool:

D) Both mother and baby are Rh-positive

A) Mother is Rh-positive and baby is Rh-negative

B) Mother is Rh-negative and the baby is Rh-positive

C) Both mother and baby are Rh-negative

D) Both mother and baby are Rh-positive

39 / 100

Category: Biology Ch 6 Class 11

A bacterium with tuft of flagella at both poles is called

Lophotrichus

Monotrichous

Peritrichous

Amphitrichous

40 / 100

Category: Biology Ch 7 Class 11

Chalk is gradually formed of dead

Actinopods

Foraminiferans

Apicomplexans

Radiolarians

41 / 100

Category: Biology

Q.43 Which of the following disappear during muscle contraction?

A. A-band

B. H-zone

C. I-band

D. M-line

42 / 100

Category: Biology Ch 9 Class 11

The flower of family gramineae process contain two scales below ovary which are called:

NUMS 2014
Biology
Kingdom Plantae
Elimination Tool:

A) Glumes

B) Lemma and palea

C) Lodicule

D) Rochella

43 / 100

Category: Biology Ch 8 Class 12

In birds the male is the homogametic sex. A male bird showing the recessive trait was mated with a female showing the dominant trait of a characteristic governed by a pair of alleles which are sex-linked. What is the probability that the male offspring will show the dominant trait?

NTS 2014
Biology
Variation and Genetics
Elimination Tool:

A) 0

B) 0.25

C) 0.50

E) 1.00

44 / 100

Category: Biology Ch 1 Class 12

Humans maintain their body temperature within a narrow limit due to their _____ characteristics.

NUMS 2019 Cancelled
Biology
Homeostasis
Elimination Tool:

A) Ectothermic

B) Endothermic

C) Heterothermic

D) Hypothermic

45 / 100

Category: Biology Ch 2 Class 12

Which of the following plays the major role in providing support to young herbaceous parts of the plant:

Living cells of epidermis with higher turgor pressure.

Living cells of cortex and pith with higher turgor pressure.

Collenchyma cells

All of these

46 / 100

Category: Biology Ch 4 Class 12

Which statement is incorrect?

In short day plants red light prevents flowering

Henbane is a short day plant

In long day plants for red light promotes flowering

Leaf unrolling occurs in grasses

47 / 100

Category: Biology

Q.39 The fertilization of ovum takes place at:

A. Distal part of the oviduct

B. Proximal part of the oviduct

C. Middle part of the oviduct

D. Anywhere in the oviduct

48 / 100

Category: Biology

Q.35 Ribose is a monosaccharide constituent of man

A. Enzymes

B. Coenzymes

C. Vitamin

D. Antibiotics

49 / 100

Category: Biology Ch 5 Class 12

A bean seed contains all of the following except:

NTS 2012
Biology
Growth and Development
Elimination Tool:

A) A seed coat

B) An epicotyl

C) A hypocoty

D) A hypha

50 / 100

Category: Biology

Q.44 When calcium gates of the smooth endoplasmic reticulum are open, then calcium is released into:

A. Cytosol

B. Organelle lumen

C. Nucleoplasm

D. Directly taken up by myofilament

51 / 100

Category: Biology Ch 12 Class 11

Secretion of pancreatic juice is stimulated by:

NUMS 2019 Cancelled
Biology
Nutrition
Elimination Tool:

A) Secretin

B) Gastrin

C) Pepsinogen

D) Both secretin and gastrin

52 / 100

Category: Biology

Lymph nodes are not present:

NUMS Mock 1
Biology
Coordination and Control

A) Neck region

B) Axilla

C) Groin

D) Spleen

53 / 100

Category: Biology Ch 10 Class 12

According to the Hardy-Weinberg theorem, what will be the frequency of heterozygote when ‘p’ is 0.2?

NUMS 2019 Reconduct
Biology
Evolution
Elimination Tool:

A) 0.32

B) 0.38

C) 0.42

D) 0.48

54 / 100

Category: Biology Ch 9 Class 12

Which one has antibiotic resistance gene for tetracycline and ampicillin?

pSC 101

pBR 322

pCR 322

None of these

55 / 100

Category: Biology Ch 3 Class 12

Normal action potential of a neuronal cell is :

plus 50 mv

plus 60 mv

plus 70 mv

plus 80 mv

56 / 100

Category: Biology Ch 3 Class 12

The spinal nerves are functionally:

NUMS 2016
Biology
Coordination and Control
Elimination Tool:

A) Sensory nerves

B) Motor nerves

C) Mixed nerves

D) Unknown

57 / 100

Category: Biology

Germ layers are formed in which stage of development?

NUMS Mock 2
Biology
Growth and Development

A) Morulation

B) Blastulation

C) Gastrulation

D) Organogenesis

58 / 100

Category: Biology Ch 13 Class 11

Parabronchi are open at ______ end/s

Single

Both

Do not have opening

None of these

59 / 100

Category: Biology Ch 7 Class 11

These protists are mostly unicellular (a few are colonial) organisms with spherical or elongated bodies with a single central nucleus. They possess from one to many long, whip-like flagella that enable them to move. Flagellates move rapidly, pulling themselves forward by lashing flexible flagella that are usually located at the anterior end. Examples include trypanosome, euglena, etc.

The above give lines indicate which of the following group of protozoa:

NUMS 2017
Biology
Kingdom Protista
Elimination Tool:

A) Amoeba

B) Arthropods

C) Foraminifera

D) Zooflagellates

60 / 100

Category: Biology Ch 8 Class 12

A monohybrid cross yielded 3:1 in F2. What could be mode of inheritance?

Segregation

Independent assortment

Both of these

None of these

61 / 100

Category: Biology

The position of an organism in a food chain of an ecosystem called:

NUMS Mock 2
Biology
Man and His Environment

A) Level of ecosystem

B) Food chain

C) Food web

D) Trophic level

62 / 100

Category: Biology Ch 12 Class 11

Which of the following have both internal and external digestion?

NUMS 2016
Biology
Nutrition
Elimination Tool:

A) Hydra

B) Jelly fish

C) Cockroach

D) All of these

63 / 100

Category: Biology Ch 12 Class 11

Carbohydrates, fats & proteins are essential for:

Metabolic processes of an organism

Providing energy

Formation of sturctures

All of these

64 / 100

Category: Biology Ch 5 Class 11

The viruses are:

NTS 2011
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Cellular

B) Prokaryotes

C) Non-cellular

D) Eukaryotes

65 / 100

Category: Biology Ch 6 Class 12

Locus is defined as:

NUMS 2019 Reconduct
Biology
Chromosomes and DNA
Elimination Tool:

A) Position of a gene on the chromosome

B) Appearance of a trait in an individual

C) Partner of a gene pair

D) Gene in an individual for a trait

66 / 100

Category: Biology Ch 1 Class 12

Negative feedback mechanism is the characteristic of which class?

NUMS 2020
Biology
Homeostasis
Elimination Tool:

A) Class Fish

B) Class Amphibia

C) Class Reptilia

D) Class Mammalia

67 / 100

Category: Biology

The autonomic nervous system controls all of the following activities except:

NUMS Mock 1
Biology
Coordination and Control

A) Digestion of food

B) Heart beat

C) Contraction of pupil of eye

D) Thought

68 / 100

Category: Biology Ch 7 Class 12

_______ is the most critical phase of mitosis.

NUMS 2015
Biology
Cell Cycle
Elimination Tool:

A) Prophase

B) Telophase

C) Anaphase

D) Metaphase

69 / 100

Category: Biology

Q.47 The chemical nature of oxytocin is:

A. Protein

B. Amino acid derivative

C. Polypeptide

D. Steroid Incorrect

70 / 100

Category: Biology Ch 3 Class 11

Most enzymes have an optimum temperature of around:

PMC 2020
Biology
Enzymes
Elimination Tool:

A) 30 C

B) 40 C

C) 50 C

D) 20 C

71 / 100

Category: Biology Ch 3 Class 11

The effect of competitive inhibitor on enzyme activity is such that it affects which of the following?

PMC Sample 2
Biology
Enzymes
Elimination Tool:

A) Increases enzyme activity

B) Doesn't change enzyme activity

C) Decreases enzyme activity

D) None of these options is correct

72 / 100

Category: Biology Ch 6 Class 11

In bacterial categories the bacteria smaller in number are

Gram-ive bacteria

Eubacteria

Ancient bacteria

Gram +ive bacteria

73 / 100

Category: Biology Ch 7 Class 12

Which of the following sub stages does not occur in prophase I?

NTS 2015 SMBBMC
Biology
Cell Cycle
Elimination Tool:

A) Leptotene

B) Zygotene

C) Synapsis

D) Diplotene

74 / 100

Category: Biology Ch 12 Class 11

Deficiency of K+ causes:

Stunted growth & strong chlorosis

No electron transport chains

Premature death of leaves.

Stunted growth of roots.

75 / 100

Category: Biology Ch 3 Class 12

Chemically auxins are

Indole propionic acid.

Indole carboxylic acid.

Indole acetaldehyde

Indole acetic acid

76 / 100

Category: Biology Ch 14 Class 11

The function of papillary muscles is to:

NUMS 2020
Biology
Transport
Elimination Tool:

A) Move blood from semilunar valve into pulmonary vein

B) Prevent the backward flow of blood from the ventricle

C) Push the blood from right atrium to left atrium

D) Push the blood from left atrium to aorta

77 / 100

Category: Biology

Q.30 This group of animals has three bones in the ear.

A. Reptiles

B. Mammals

C. Both reptiles and mammals

D. Birds and mammals

78 / 100

Category: Biology Ch 13 Class 11

The passageways of the respiratory system mucous secreting cells called:

NTS 2019
Biology
Gaseous Exchange
Elimination Tool:

A) Tracheal cells

B) Goblet cells

C) Surfactant cells

D) Pleural cells

79 / 100

Category: Biology Ch 9 Class 11

Horsetails are included in class

Sphenopeida

Lycopsida

Psilopsida

Pteropsida

80 / 100

Category: Biology Ch 14 Class 11

Anti-bodies are produced by:

NUMS 2014
Biology
Transport
Elimination Tool:

A) Red blood cells

B) Platelets

C) B-lymphocytes

D) Hormones

81 / 100

Category: Biology Ch 2 Class 12

Joints found at the vertebrates are:

NTS 2014
Biology
Support and Movement
Elimination Tool:

A) gliding joints

C) partially moveable joints

B) sliding joints

D) fixed joints

82 / 100

Category: Biology Ch 10 Class 12

Consider the following statements about biological communities.

I. Their members share a common gene pool

II. The community remains stable even though some physical aspect of the environment may undergo a change

III. It consists of all the populations living in a particular area.

IV. A community interacts with a non-living environment and both function together to form an ecosystem

Which two of the above statements are true?

NTS 2014
Biology
Evolution
Elimination Tool:

A) 1 and 2

B) 1 and 3

D) 2 and 3

E) 3 and 4

83 / 100

Category: Biology Ch 13 Class 12

Process that supplies food to living things through decaying and decomposition is called

. Food cycle

Nutrient cycle

Dead-live cycle

None of these

84 / 100

Category: Biology Ch 4 Class 12

The primary oocyte in mammals has which of the following structures around it:

NUMS 2014
Biology
Reproduction
Elimination Tool:

A) Zona Pellucida

B) Zona Vasculosa

C) Zona radiata

D) None of them

85 / 100

Category: Biology Ch 13 Class 11

In which of the following are book lungs found?

NUMS 2014
Biology
Gaseous Exchange
Elimination Tool:

A) Clam warm

B) Spider

C) Silverfish

D) Leech

86 / 100

Category: Biology Ch 11 Class 12

Hydrosere is

Secondary succession starting in a pond

. Primary succession starting in a pond

Primary succession starting on a dry soil

All of these

87 / 100

Category: Biology

Which one of the following muscles are considered as “Voluntary muscles”?

NUMS Mock 1
Biology
Support and Movement

A) Smooth muscles

B) Cardiac muscles

C) Skeletal muscles

D) Glandular muscles

88 / 100

Category: Biology

Q.26 Most carbon dioxide is transported in the form of:

A. Carboxyhemoglobin

B. Lipids

C. Bicarbonate ions

D. Chemicals

89 / 100

Category: Biology Ch 1 Class 11

The study of fossils is called:

Environmental Biology

Historical biology

Palaeontology

Social biology

90 / 100

Category: Biology Ch 5 Class 11

Which of the following is NOT TRUE about Human Immunodeficiency virus (HIV)?

PMC 2020
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) It is a retrovirus

B) It is surrounded by an envelope

C) It does not cause AIDS

D) It causes deficiency of the human immune system

91 / 100

Category: Biology Ch 2 Class 12

Gibberellins is an example of

Growth inhibitor

Growth stimulator

Growth hormone

None of these

92 / 100

Category: Biology Ch 9 Class 12

Which of the following diseases CANNOT be cured by gene therapy?

NUMS 2019 Reconduct
Biology
Biotechnology
Elimination Tool:

A) SCID

B) Tuberculosis

C) Cystic fibrosis

D) Cancer

93 / 100

Category: Biology Ch 7 Class 11

Based on molecular data euglenoids are thought to be closely related to

Dinoflagellates

Zooflagellates

Protozoans

Algae

94 / 100

Category: Biology

Which of the following single membranous organelle is absent in plant cells?

a. Vacuole

B. Golgi apparatus

C. Lysosomes

D. Endoplasmic reticulum

95 / 100

Category: Biology Ch 9 Class 11

What is the strengthening material of the prokaryotic cell wall?

PMC Practice 7
Biology
Kingdom Plantae
Elimination Tool:

A) Cellulose

B) Chitin

C) Silica waxes and lignin

D) Peptidoglycan or murein

96 / 100

Category: Biology Ch 8 Class 11

Fungi whose growth is favored by fire is called:

NTS 2016 SMBBMC
Biology
Kingdom Fungi
Elimination Tool:

A) Pyrophilus

B) Prophilus

C) Philus

D) Prephylus

97 / 100

Category: Biology Ch 4 Class 12

Which one is not a day neutral plant?

Cucumber

Maize

Cotton

Tobacco

98 / 100

Category: Biology Ch 10 Class 11

The adaptive feature(s) which help(s) the fish to live in water include(s):

NTS 2014
Biology
Kingdom Animalia
Elimination Tool:

A) A tail and an air bladder

B) Unpaired and paired fins

C) Streamlined body

E) All of these options

99 / 100

Category: Biology Ch 2 Class 12

In an annelids, the contraction of circular muscle results in:

Lengthening of the body.

Shortening of the body.

Widening of body

Thinning of body

100 / 100

Category: Biology

In semi-conservative replication, which of the following is true regarding the separation of two strands?

NUMS Mock 2
Biology
Chromosomes and DNA

A) Primary structure is conserved, and secondary structure is disturbed

B) Secondary structure is conserved, and the primary structure is disrupted

C) both the primary and secondary structures are conserved

D) Both the primary and secondary structures are disrupted

Your score is

The average score is 61%

Structured Practice for Best Entry Test Preparation

This topic-wise and chapter-wise practice test allows students to focus on individual biology concepts, including diagrams, processes, and conceptual questions. Regular practice enhances understanding, sharpens problem-solving skills, and builds confidence to tackle both board and competitive exam questions efficiently.

Free Resources for Best Entry Test Preparation

Students can access free Biology Practice Test 4 to systematically improve knowledge, recall, and problem-solving abilities. This test is suitable for FSC Board Exams as well as major entry tests, helping students perform better in the biology section. PLS Academy provides these resources to support students in their preparation.

JazakAllah