Biology Practice Test 4

Biology Practice Test 4 is designed to help students strengthen their understanding of key biological concepts, theories, and processes for competitive entry tests like MDCAT, NUMS, AKU, UET, ECAT, NTS, as well as FSC Board Exams. This test covers topics from human anatomy, physiology, microbiology, and ecology, helping students improve accuracy and retention.

PLS Academy

Get Access to 20 thousands+ MCQs Including Topical MCQs, Practice Tests, Mock Tests, Solved Past Papers, Flashcards, Notes, FLPS, and Much More.

UNLOCK PREMIUM🔐

1242

Created by Ali Durrani

MDCAT Practice Tests

Biology Practice Test 4

This is the Free Access to Limited MCQs. Enroll to PLS Boost Premium Bundle to Get More MCQs HERE

1 / 100

Category: Biology

Q.68 The spinal cord consist of which type of cell bodies?

A. Sensory neuron

B. motor neuron

C. connector neuron

D. all of these

2 / 100

Category: Biology Ch 6 Class 12

Haploid and monoploid numbers of chromosomes of hexaploid wheat are:

NTS 2014
Biology
Chromosomes and DNA
Elimination Tool:

A) 21 and 42

B) 7 and 21

C) 21 and 7

D) 42 and 21

3 / 100

Category: Biology

Q.26 The function/s of HCl during digestion is/are:

A. Adjust the pH

B. Softens the food

C. Activate pepsinogen to pepsin

D. All A, B, C

4 / 100

Category: Biology Ch 4 Class 12

In the male reproductive tract, sperm cells follow a specific path. Which of the following do sperm cells enter after traveling through the epididymis?

PMC Sample 2
Biology
Reproduction
Elimination Tool:

A) Urethra

B) Seminiferous tubules

C) Ejaculatory duct

D) Vas deferens

5 / 100

Category: Biology Ch 6 Class 11

In bacterial categories the bacteria smaller in number are

Gram-ive bacteria

Eubacteria

Ancient bacteria

Gram +ive bacteria

6 / 100

Category: Biology Ch 3 Class 11

Optimal temperature of enzymes present in human body is

27?C

37?C

47?C

30?C

7 / 100

Category: Biology Ch 11 Class 12

Secondary succession starts from A.

A bar rock sand

Clear glacial pool

From remains of previous ecosystem

Fire

8 / 100

Category: Biology

Q.43 Which of the following disappear during muscle contraction?

A. A-band

B. H-zone

C. I-band

D. M-line

9 / 100

Category: Biology

The structure of a fibrous protein comprises of polypeptide chains in the form of:

NUMS Mock 2
Biology
Biological Molecules

A) Cluster

B) Spherical or curried up ball

C) Long strands or fibrils

D) Flat uncoiled chains

10 / 100

Category: Biology Ch 4 Class 12

Development of an egg into zygote without fertilization is called

Parthenogenesis

Apomixes

Parthenocarpy

None of these

11 / 100

Category: Biology

Q.51 The heavy and light chains of an antibody molecule is held together by:

A. H-bonds

B. Disulphide bridges

C. Ionic interactions

D. Hydrophobic interactions

12 / 100

Category: Biology

Which of the following is not related to apoptosis?

NUMS Mock 1
Biology
Growth and Development

A) Loss of tail of developing humans embryos

B) Loss of tissues between developing digits

C) Controlling the number of neurons

D) None of the given options

13 / 100

Category: Biology Ch 1 Class 12

Among the followings which is the most longest supportive cell?

Tracheids

Sclereids

Trachea

Collenchyma cells

14 / 100

Category: Biology Ch 8 Class 11

Ecological role of fungi as decomposers is only paralleled by

Blue green algae

Cyanobacteria

Bacteria

Virus

15 / 100

Category: Biology

The diagram represents two liquids, separated by a membrane through which osmosis can occur.

What movement of molecules will occur?

NUMS Mock 3
Biology
Transport

A) Molecules of dissolved substance move from left to right.

B) Molecules of dissolved substance move from right to left.

C) Overall, water molecules move from left to right.

D) Overall, water molecules move from right to left.

16 / 100

Category: Biology Ch 6 Class 12

Which of the following can be blocked, if one wants to stop translation of mRNA?

NUMS 2019 Reconduct
Biology
Chromosomes and DNA
Elimination Tool:

A) RNA polymerase

B) Helicase

C) Elongation factor

D) Primase

17 / 100

Category: Biology Ch 1 Class 12

The disease in which patients passed urine that rapidly turned black on exposure to air is called:

NTS 2011
Biology
Homeostasis
Elimination Tool:

A) Phenylketonuria

B) Alkaptonuria

C) Sickle cell anemia

D) Hemophilia

18 / 100

Category: Biology Ch 3 Class 11

A substance which binds at the active site of the enzyme but does not result in the formation of the products is called:

Irreversible inhibitor

Reversible inhibitor

Competitive inhibitor

Non-competitive inhibitor

19 / 100

Category: Biology Ch 10 Class 11

Coelom is lined by

Parietal mesoderm

Visceral mesoderm

Mesoderm

Both A & B

20 / 100

Category: Biology Ch 5 Class 11

Other name for Kingdom monera is:

Protoctista

Prokaryotae

Archae

None of these

21 / 100

Category: Biology Ch 14 Class 11

Antibodies are manufactured in:

PMC 2020
Biology
Transport
Elimination Tool:

A) T Lymphocytes

B) Red Blood Cells

C) Platelets

D) B Lymphocytes

22 / 100

Category: Biology Ch 2 Class 12

The number of vertebrate in horse neck are:

NUMS 2014
Biology
Support and Movement
Elimination Tool:

A) 5

B) 6

C) 7

D) 10

23 / 100

Category: Biology Ch 4 Class 11

Chief material present in the cell wall of plants, fungal, and prokaryotic cells is:

NUMS 2020
Biology
Cell Structure and Function
Elimination Tool:

A) Proteins

B) Lipids

C) Polysaccharides

D) Phospholipids

24 / 100

Category: Biology

Why cannot viruses replicate on their own?

NUMS Mock 2
Biology
Variety of Life

A) They are too small.

B) They have no cell wall.

C) They lack metabolic machinery.

D) All of theoptions are correct.

25 / 100

Category: Biology Ch 10 Class 11

A characteristics features of Echinoderm is:

NTS 2011
Biology
Kingdom Animalia
Elimination Tool:

A) Canal system

B) Water vascular system

C) Tracheal system

D) Blood vascular system

26 / 100

Category: Biology

Lysosomes function in:

NUMS Mock 1
Biology
Cell Structure and Function

A) Protein synthesis

B) Processing

C) Intracellular digestion

D) Lipid synthesis

27 / 100

Category: Biology Ch 10 Class 12

The actual remains or traces of organisms that lived in ancident geological times

Vestigial remains

Fossils

Fuel

None of these

28 / 100

Category: Biology Ch 10 Class 11

In some cases the blastomere can produce complete embryo the cleavage will be

Spiral and determinate

Radial and indeterminate

Spiral and indeterminate

Radial and determinate

29 / 100

Category: Biology

Which of the following organelles are present in all the bacteria?

NUMS Mock 1
Biology
Kingdom Prokaryote

A) Mesosome

B) Golgi bodies

C) Mitochondria

D) Chloroplast

30 / 100

Category: Biology Ch 2 Class 12

The number of muscles in a human body is about:

NTS 2012
Biology
Support and Movement
Elimination Tool:

A) 200

B) 300

C) 400

E) 600

31 / 100

Category: Biology Ch 1 Class 12

Thick, waxy & leathery cuticle around leaves is present in

Hydrophytes

Mesophytes

Xerophytes

Halophytes

32 / 100

Category: Biology Ch 5 Class 11

The size of poxvirus is:

20 nm

200 nm

250 nm

300 nm

33 / 100

Category: Biology

The thick filaments, in a myofibril of muscles, are made of ________.

NUMS Mock 3
Biology
Support and Movement

A) Myoglobin

B) Myosin

C) Actin

D) Haemoglobin

34 / 100

Category: Biology

The system responsible for fighting the pathogens is:

NUMS Mock 4
Biology
Transport

A) Muscular System

B) Endocrine System

C) Nervous System

D) Immune System

35 / 100

Category: Biology Ch 1 Class 12

The human body maintains all of its cells’ internal concentration _____ to internal body fluid.

NUMS 2019 Cancelled
Biology
Homeostasis
Elimination Tool:

A) Isotonic

B) Hypotonic

C) Hypertonic

D) Hyposmotic

36 / 100

Category: Biology Ch 7 Class 12

Mitotic apparatus in animals is formed by

Aster and spindle

Polar and kinetochore microtubules

Spindle and RNA

Spindle only

37 / 100

Category: Biology Ch 9 Class 11

Which of the following is an ovoviviparous organism?

PMC Sample 3
Biology
Kingdom Plantae
Elimination Tool:

A) reptiles

B) mammals

C) frog

D) Duckbill platypus

38 / 100

Category: Biology Ch 5 Class 12

he only promoter of Leaf’s senescence in the following plant hormones is:

PMC Practice 9
Biology
Coordination and Control
Growth and Development
Elimination Tool:

A) Gibberellins

B) Cytokinins

C) Auxins

D) Abscisic acid

39 / 100

Category: Biology

What part of the brain integrates sensory information such as pain and temperature?

NUMS Mock 2
Biology
Coordination and Control

A) Forebrain

B) Midbrain

C) Hindbrain

D) Spinal cord

40 / 100

Category: Biology Ch 14 Class 11

The function of papillary muscles is to:

NUMS 2020
Biology
Transport
Elimination Tool:

A) Move blood from semilunar valve into pulmonary vein

B) Prevent the backward flow of blood from the ventricle

C) Push the blood from right atrium to left atrium

D) Push the blood from left atrium to aorta

41 / 100

Category: Biology Ch 10 Class 11

Species of phylum Platyhelminthes are:

NTS 2011
Biology
Kingdom Animalia
Elimination Tool:

A) Roundworms

B) Flat worms

C) Hook worms

D) Thread worms

42 / 100

Category: Biology Ch 8 Class 12

J. Seiler in 1914 discovered which type of sex determination in moths?

NUMS 2015
Biology
Variation and Genetics
Elimination Tool:

A) XO – XX

B) XY – XX

C) ZZ – ZW

D) None of the given options

43 / 100

Category: Biology

Q.10 Mating between relatives is called which of the following?

A. Ex breeding

B. Breeding

C. Inbreeding

D. Outbreeding

44 / 100

Category: Biology Ch 12 Class 12

Annual rainfall in grass land i

1500-2500 mm

750-1500 mm

250-750 mm

250-500 mm

45 / 100

Category: Biology

The end product of glycolysis in anaerobic respiration is:

NUMS Mock 4
Biology
Bioenergetics

A) Ethanol and Carbon dioxide

B) Lactate

C) Pyruvate

D) Both A and B

46 / 100

Category: Biology

5 different amino acids, numbered 1, 2, 3, 4, and 5, below from the following sequence in the path of a polypeptide chain:

1-2-3-4-2-5-3

Messenger RNA codon, which correspond to the amino acids, are:
amino acid 1 UGU

amino acid 2 GAU

amino acid 3 CAC

amino acid 4 UAG

amino acid 5 AAG

Which one of the following DNA bases sequences could provide the code for the given section of the polypeptide?

NUMS Mock 2
Biology
Biological Molecules

A) ACACTTGTGATGCTATTCGTG

B) ACACUAGUGAUGCUAUUCGUG

C) ACACTAGTGATGCTAAACGTG

D) ACACTAGTGATCCTATTCGTG

47 / 100

Category: Biology Ch 8 Class 12

How many pairs of homologous chromosomes are present in Pisum sativum

Five pairs

Six pairs

Seven pairs

Eight pairs

48 / 100

Category: Biology Ch 6 Class 12

Particular array of chromosomes that an individual processes is called its:

NUMS 2019 Reconduct
Biology
Chromosomes and DNA
Elimination Tool:

A) Nucleosome

B) Gene pool

C) Karyotype

D) Centromere

49 / 100

Category: Biology Ch 3 Class 11

Extreme change in pH results in:

Change in ionization of amino acids at the active site of the enzyme.

Change in the ionization of the substrate.

Denaturation of the enzyme

IncreaseIncrease in the reaction rate. in the reaction rate.

50 / 100

Category: Biology Ch 13 Class 12

Hydroelectricity is generated by using ______ of falling water.

Potential energy

Gravitational energy

Kinetic energy

. All of these

51 / 100

Category: Biology

Q.28 The vocal cords are stretched across:

A. Larynx

B. Glottis

C. Pharynx

D. Trachea

52 / 100

Category: Biology Ch 1 Class 12

Negative feedback mechanism is the characteristic of which class?

NUMS 2020
Biology
Homeostasis
Elimination Tool:

A) Class Fish

B) Class Amphibia

C) Class Reptilia

D) Class Mammalia

53 / 100

Category: Biology Ch 3 Class 12

Na+ -K+ ATPase pump is important for:

Maintenance of resting potential.

Massive out flux of K+ after depolarization.

Recovery of resting potential.

Conversion of resting potential into action potential.

54 / 100

Category: Biology Ch 7 Class 11

Sleeping sickness in humans is caused by:

UHS 2013
Biology
Kingdom Protista
Elimination Tool:

A) Trypanosoma

B) Plasmodium

C) Anopheles

D) Andes

55 / 100

Category: Biology Ch 7 Class 12

Gametes in animals are produced by:

PMC 2021 Tested
Biology
Cell Cycle
Elimination Tool:

A) Meiosis

B) Fission

C) Mitosis

D) All three

56 / 100

Category: Biology Ch 4 Class 11

Anthocyanins are various types of colorful pigments present in the:

NUMS 2014
Biology
Cell Structure and Function
Elimination Tool:

A) Chloroplasts

B) Chromoplasts

C) Leucoplasts

D) Vacuoles

57 / 100

Category: Biology Ch 1 Class 11

Different species of plants and animals living in the same habitat is called :

Population

Community

Biome

58 / 100

Category: Biology

Steroids consist of _____ 6 membered carbon rings and one 5 membered carbon ring.

NUMS Mock 4
Biology
Biological Molecules

A) Four

B) Three

C) Two

D) Five

59 / 100

Category: Biology Ch 5 Class 12

Typical symptoms like enlarged breasts and small testis in male are attributed to:

UHS 2015
Biology
Growth and Development
Elimination Tool:

A) Down’s Syndrome

B) Turner’s Syndrome

C) Klinefelter’s Syndrome

D) Phenylketonuria

60 / 100

Category: Biology Ch 5 Class 12

Meristems are of

. Two types

Three types

Four types

Five types

61 / 100

Category: Biology Ch 7 Class 11

Which of the following is the best desciption of bacteriophage?

PMC Practice 32
Biology
Kingdom Protista
Elimination Tool:

A) Fungus

B) Prokaryote

C) Living organism

D) Obligate intracellular parasite

62 / 100

Category: Biology Ch 14 Class 11

75% osmotic pressure of blood is maintained by:

NUMS 2015
Biology
Transport
Elimination Tool:

A) Globulin

C) Fibrinogen

B) Prothrombin

D) Albumin

63 / 100

Category: Biology Ch 1 Class 12

In a hot summer after noon, if your body’s Homeostatic machinery keep your internal temperature quite lower than that of external than this is an example of

Positive feed back

Negative feed back

. Feed back

Osmoregulation

64 / 100

Category: Biology Ch 8 Class 11

Those fungi which can grow only on their living host and cannot be grown on available defined growth culture medium e.g. various mildews and most rust species are called?

PMC Sample 2
Biology
Kingdom Fungi
Elimination Tool:

A) Parasitic fungi

B) Facultative parasitic fungi

C) Obligate parasitic fungi

D) all of these

65 / 100

Category: Biology Ch 10 Class 11

Opposable thumbs are characteristic features of

NUMS 2014
Biology
Kingdom Animalia
Elimination Tool:

A) Lagomorpha

B) Primates

C) Ederitate

D) None of these

66 / 100

Category: Biology

Which of the following RNA sequences would be transcribed from the DNA sequence ATGGCTAGGAC?

NUMS Mock 4
Biology
Chromosomes and DNA

A) TACGGATCCTG

B) UAGCGAUCCUG

C) AUGCCUAGGAC

D) UACCGAUCCUG

67 / 100

Category: Biology

Q.28 The enzyme which plays important role in HIV pathogenesis

A. RNA polymerase I

B. DNA polymerase II

C. Reverse Transcriptase I

D. Reverse Transcriptase

68 / 100

Category: Biology Ch 5 Class 12

The reason plants are considered totipotent is:

NUMS 2019 Cancelled
Biology
Growth and Development
Elimination Tool:

A) Each cell has full genetic potential of the organism

B) A single cell could become a complete plant

C) Because they have lesser potential for tissue culturing

D) Both each cell has full genetic potential of the organism and a single cell could become a complete plant

69 / 100

Category: Biology Ch 12 Class 11

In human gut, chylomicrons are formed by the combination of:

NUMS 2020
Biology
Nutrition
Elimination Tool:

A) Proteins and carbohydrates

B) Fats and proteins

C) Fats and carbohydrates

D) Vitamins and fats

70 / 100

Category: Biology Ch 5 Class 12

Turner’s syndrome is characterized by having:

UHS 2015
Biology
Growth and Development
Elimination Tool:

A) Trisomy 21

B) 44 + XXY

C) Trisomy

D) 44 + XO

71 / 100

Category: Biology Ch 7 Class 11

All of the following organisms belong to the kingdom protista EXCEPT:

NTS 2012
Biology
Kingdom Protista
Elimination Tool:

A) Ulva

B) Euglena

C) Slime Mold

D) Common Mold

72 / 100

Category: Biology Ch 7 Class 11

Identify the correctly matched pair relating to a term and its meaning/function/example:

NTS 2017
Biology
Kingdom Protista
Elimination Tool:

A) nitrogen cycle… Rhizopus

B) denitrifying bacteria..change protein to ammonia

C) biosphere.. where life exists

D) lithosphere…water,air and soil.on the surface of earth

73 / 100

Category: Biology Ch 9 Class 11

Antheridia and archegonia are born on _____ in bryophytes

Sporophyte

Gametophyte

Both of these

None of these

74 / 100

Category: Biology Ch 6 Class 12

What would be the number of nucleotides for a protein molecule of about 142 amino acids?

NUMS 2020
Biology
Chromosomes and DNA
Elimination Tool:

A) 430

B) 142

C) 426

D) 460

75 / 100

Category: Biology Ch 4 Class 11

In which model do proteins float in membrane-like iceberg in sea:

NTS 2010
Biology
Cell Structure and Function
Elimination Tool:

A) Lock and key model.

B) Induced fit model.

C) Fluid mosaic model.

D) Lotka volterra model.

76 / 100

Category: Biology Ch 11 Class 11

Net yield of H2O in Photosynthesis is

1 molecule

6 molecules

3 molecules

0 molecule

77 / 100

Category: Biology Ch 3 Class 11

An activated enzyme consisting of polypeptide chain and a cofactor is called:

Apoenzyme

Holoenzyme

Activated enzyme

Both b and c

78 / 100

Category: Biology Ch 11 Class 12

Wood forests form the

Pioneers community

Climax community

Top community

Transient community

79 / 100

Category: Biology Ch 13 Class 11

The passageways of the respiratory system mucous secreting cells called:

NTS 2019
Biology
Gaseous Exchange
Elimination Tool:

A) Tracheal cells

B) Goblet cells

C) Surfactant cells

D) Pleural cells

80 / 100

Category: Biology Ch 10 Class 12

Carolus Linnaeus was believer of which of the following?

PMC Sample 1
Biology
Evolution
Elimination Tool:

A) special creation

B) natural selection

C) catastrophism

D) Inheritance of acquired characters

81 / 100

Category: Biology Ch 2 Class 12

Vertebrae of the neck are called:

NUMS 2020
Biology
Support and Movement
Elimination Tool:

A) Coccygeal vertebrae

B) Cervical vertebrae

C) Sacral vertebrae

D) Lumbar vertebrae

82 / 100

Category: Biology Ch 3 Class 12

The sense organs of taste in tongue are known as:

NUMS 2014
Biology
Coordination and Control
Elimination Tool:

A) Olfactory receptors

B) Gustatory receptors

C) Cutaneous receptors

D) All of these

83 / 100

Category: Biology Ch 5 Class 12

The cells in our body are all genetically identical, apart from the:

PMC 2020
Biology
Growth and Development
Elimination Tool:

A) Somatic cells

B) Reproductive cells

D) White blood cells

C) Muscle fibers

84 / 100

Category: Biology Ch 12 Class 12

Development of bark in plants and skin in animals is a method for

Providing support

Protection from enemies

Reducing water loss

Helping in food production

85 / 100

Category: Biology Ch 14 Class 11

Which of the following has oxygenated blood?

NUMS 2014
Biology
Transport
Elimination Tool:

A) Renal veins

B) None

C) Pulmonary artery

D) Hepatic portal veins

86 / 100

Category: Biology Ch 5 Class 12

Growth process is

Irreversible

Reversible

Sometimes reversible sometimes irreversible

Temporary

87 / 100

Category: Biology Ch 8 Class 11

According to two kingdom classification fungi were placed in kingdom

Plantae

Animalia

Protista

Fungi

88 / 100

Category: Biology Ch 9 Class 11

Which of the following is included in Bryophytes?

NTS 2011
Biology
Kingdom Plantae
Elimination Tool:

A) Mosses

B) Club mosses

C) Ferns

D) Seed plants

89 / 100

Category: Biology Ch 6 Class 12

In a typical nucleotide, the nitrogenous base is attached to _______ carbon of pentose sugar.

NTS 2010
Biology
Chromosomes and DNA
Elimination Tool:

B) 5th

C) 4th

D) 3rd

E) 1st

90 / 100

Category: Biology

During cell division, the spindle fibres get attached to condensing chromosome at a highly differentiated region. This region is called as:

NUMS Mock 1
Biology
Cell Cycle

A) Chromosome

B) Chromocentre

C) Centriole

D) Kinetochore

91 / 100

Category: Biology Ch 9 Class 11

In Pakistan, the furniture wood is mainly obtained from the members of family:

UHS 2010
Biology
Kingdom Plantae
Elimination Tool:

A) Rosaceae

B) Solanaceae

C) Minosaceae

D) Fabaceae

92 / 100

Category: Biology Ch 6 Class 12

In Maxam – Gilbert method, DNA threads are:

NUMS 2015
Biology
Chromosomes and DNA
Elimination Tool:

A) Chemically synthesized

B) Synthesized from mRNA

C) Synthesized by using terminating nucleotides

D) Chemically cut into pieces

93 / 100

Category: Biology Ch 2 Class 11

Ribosomes are composed of almost an equal amount of:

NUMS 2018
Biology
Biological Molecules
Elimination Tool:

A) Protein & Lipid

B) Protein & RNA

C) RNA & Lipid

D) RNA & Carbohydrates

94 / 100

Category: Biology Ch 8 Class 11

Type of lichen which tightly attaches to rocks is

Parmelia

Fruticose

Foliose

Crustose

95 / 100

Category: Biology Ch 3 Class 12

Normal resting membrane potential of a neuron is

50 mv

60 mv

70 mv

80 mv

96 / 100

Category: Biology

Q.17 Final acceptor of electrons in respiratory chain is?

A. NADH

B. Cytochrome a3

C. Water

D. Oxygen

97 / 100

Category: Biology Ch 9 Class 12

Cystic fibrosis patients lack a gene that codes for a transmembrane carrier of:

NTS 2017
Biology
Biotechnology
Elimination Tool:

A) Na+ ions

B) K+ ions

C) CI- ions

D) Ca2+ ions

98 / 100

Category: Biology

DNA fingerprinting is basically done for:

NUMS Mock 1
Biology
Biotechnology

A) DNA cloning

B) DNA analysis

C) DNA sequencing

D) DNA splicing

99 / 100

Category: Biology

In the human cell, ______ is responsible for producing hydrogen peroxide.

NUMS Mock 2
Biology
Cell Structure and Function

A) Lysosomes

B) Mitochondria

C) Peroxisomes

D) Glyoxysomes

100 / 100

Category: Biology Ch 3 Class 12

Maintenance of normal resting potential via movement of K+ inside the cell and na+ out is a/an _______ process.

Active

Passive

Diffusional

None of these.

Your score is

The average score is 61%

Structured Practice for Best Entry Test Preparation

This topic-wise and chapter-wise practice test allows students to focus on individual biology concepts, including diagrams, processes, and conceptual questions. Regular practice enhances understanding, sharpens problem-solving skills, and builds confidence to tackle both board and competitive exam questions efficiently.

Free Resources for Best Entry Test Preparation

Students can access free Biology Practice Test 4 to systematically improve knowledge, recall, and problem-solving abilities. This test is suitable for FSC Board Exams as well as major entry tests, helping students perform better in the biology section. PLS Academy provides these resources to support students in their preparation.

JazakAllah