Biology Practice Test 4

Biology Practice Test 4 is designed to help students strengthen their understanding of key biological concepts, theories, and processes for competitive entry tests like MDCAT, NUMS, AKU, UET, ECAT, NTS, as well as FSC Board Exams. This test covers topics from human anatomy, physiology, microbiology, and ecology, helping students improve accuracy and retention.

PLS Academy

Get Access to 20 thousands+ MCQs Including Topical MCQs, Practice Tests, Mock Tests, Solved Past Papers, Flashcards, Notes, FLPS, and Much More.

UNLOCK PREMIUM🔐

1244

Created by Ali Durrani

MDCAT Practice Tests

Biology Practice Test 4

This is the Free Access to Limited MCQs. Enroll to PLS Boost Premium Bundle to Get More MCQs HERE

1 / 100

Category: Biology

Q.32 Which one of the following is not a feature of the nervous system of Planaria?

A. Neurons are differentiated into sensory, motor and associative neurons.

B. Nerves are present.

C. No specialized sensory organs are present

D. All of the above.

2 / 100

Category: Biology

Q.24 Pepsinogen is produce by:

A. Mucous cells

B. Zymogen cells

C. Parietal cells

D. None of these

3 / 100

Category: Biology Ch 8 Class 11

An association between two organisms benefiting both is called

UHS 2010
Biology
Kingdom Fungi
Elimination Tool:

A) Commensalism

B) Parasitism

C) Predation

D) Symbiosis

4 / 100

Category: Biology Ch 13 Class 12

Process that supplies food to living things through decaying and decomposition is called

. Food cycle

Nutrient cycle

Dead-live cycle

None of these

5 / 100

Category: Biology Ch 2 Class 12

Joints found at the vertebrates are:

NTS 2014
Biology
Support and Movement
Elimination Tool:

A) gliding joints

C) partially moveable joints

B) sliding joints

D) fixed joints

6 / 100

Category: Biology Ch 2 Class 12

Myofibrils, within the muscle fibers, contain thick and thin filaments made up of _____ and ______ respectively:

NUMS 2020
Biology
Support and Movement
Elimination Tool:

A) Myosin and Actin

B) Globulin and Albumin

C) Troponin and Tropomyosin

D) Fibrin and Fibrinogen

7 / 100

Category: Biology Ch 12 Class 12

Which statement about hydrospheric ecosystem is incorrect?

Salt water ocean and sea are the largest ecosystems on earth

Salt water ecosystem covers about 75% earth surface

Fresh water ecosystem covers less than 1% of earth surface

It temperature is more moderate to support life

8 / 100

Category: Biology Ch 10 Class 12

The ultimate source of all changes is:

NUMS 2015
Biology
Evolution
Elimination Tool:

A) Mutation

B) Migration

C) Genetic drift

D) Change in allele frequency

9 / 100

Category: Biology

Carbon dioxide fixation can be enhanced by enhancing the efficiency of:

NUMS Mock 3
Biology
Bioenergetics

A) Auxins

B) Ribulose bisphosphate

C) Lactoferrin

D) Agrobacterium

10 / 100

Category: Biology Ch 2 Class 11

The property of water due to which it works as a temperature stabilizer and hence protect living organisms from sudden thermal changes is:

High specific heat of vaporization

High specific heat capacity

Its Dipole nature

Its liquid state

11 / 100

Category: Biology Ch 8 Class 11

Fungi whose growth is favored by fire is called:

NTS 2016 SMBBMC
Biology
Kingdom Fungi
Elimination Tool:

A) Pyrophilus

B) Prophilus

C) Philus

D) Prephylus

12 / 100

Category: Biology

Which of the following basic structural level of proteins is indicated by an association of two alpha and two beta chains in the haemoglobin molecule?

NUMS Mock 4
Biology
Biological Molecules

A) Primary structure

B) Secondary structure

C) Tertiary structure

D) Quatenary Structure

13 / 100

Category: Biology Ch 8 Class 12

If a heterozygous individual shows the complete effect of both alleles, the type of inheritance would be

Complete dominance

Non dominance

Incomplete dominance

Co-Dominance

14 / 100

Category: Biology Ch 3 Class 11

The substrate binds to specific region of enzyme called?

PMC Sample 1
Biology
Enzymes
Elimination Tool:

A) key

B) active site

C) hyperactive site

D) none of these

15 / 100

Category: Biology Ch 13 Class 11

During inspiration, the diaphragm:

PMC Practice 3
Biology
Gaseous Exchange
Elimination Tool:

A) Contracts

B) Relaxes

C) Contracts and relaxes

D) None of these options is correct

16 / 100

Category: Biology Ch 1 Class 12

The human body maintains all of its cells’ internal concentration _____ to internal body fluid.

NUMS 2019 Cancelled
Biology
Homeostasis
Elimination Tool:

A) Isotonic

B) Hypotonic

C) Hypertonic

D) Hyposmotic

17 / 100

Category: Biology Ch 6 Class 12

Transfer of genetic material from one cell to another that can alter the genetic makeup of recipient cell is called

Mutation

Transuction

Replication

Variation

18 / 100

Category: Biology Ch 9 Class 11

The botanical name of Imli is:

NTS 2012
Biology
Kingdom Plantae
Elimination Tool:

A) Cassia fistula

B) Mimosa pudica

C) Tamarindus indica

D) Datura alba

19 / 100

Category: Biology Ch 9 Class 12

Chemical nature of primers used in the PCR process is _______.

UHS 2018
Biology
Biotechnology
Elimination Tool:

A) RNA

B) Protein

C) Carbohydrate

D) DNA

20 / 100

Category: Biology Ch 12 Class 11

Of the following, which one has more variety of nutrition?

Animals

Bacteria

Plants

Fungi

21 / 100

Category: Biology Ch 9 Class 12

Which of the following is the manipulation of genetic material for practical purposes?

NTS 2018
Biology
Biotechnology
Elimination Tool:

A) Grafting

B) Tissue Culture

C) Genetic Engineering

D) Cell Culture

22 / 100

Category: Biology Ch 4 Class 11

DNA is found in which of the following structures?

NUMS 2016
Biology
Cell Structure and Function
Elimination Tool:

A) Golgi complex

B) Lysosomes

C) Mitochondria

D) Ribosomes

23 / 100

Category: Biology Ch 3 Class 11

An enzyme increases the speed of a reaction:

NTS 2012
Biology
Enzymes
Elimination Tool:

A) by adding activation energy requirements

B) by lowering the activation energy requirements

C) by decreasing the concentration of products

D) by increasing the concentration of products

24 / 100

Category: Biology Ch 5 Class 11

Viruses resemble living things because they:

NTS 2017
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Circulate

B) Move

C) Reproduce

D) Are crystalline

25 / 100

Category: Biology Ch 3 Class 11

If more substrate to already occurring enzymatic reaction is added and there is no effect on the rate of the reaction what is the form given to this situation:

Saturation

Denaturation

Composition

Inhibition

26 / 100

Category: Biology Ch 5 Class 11

HIV is also known as:

NUMS 2014
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) AIDS

B) HAV

D) HBV

C) HTLV

27 / 100

Category: Biology Ch 5 Class 11

A combination of alpha interferon and ribavirin is used for the treatment of hepatitis:

NUMS 2020
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) B

B) A

C) D

D) C

28 / 100

Category: Biology Ch 11 Class 11

NADH produces how many ATP?

NUMS 2016
Biology
Bioenergetics
Elimination Tool:

A) 2 ATP

B) 3 ATP

C) 4 ATP

D) 6 ATP

29 / 100

Category: Biology

The Latin words of the name given to a human being, Homo Sapiens, include the:

NUMS Mock 1
Biology
Bio-diversity | Variety of Life

B) Family and order

C) Order and class

D) Genus and class

E) Genus and species

30 / 100

Category: Biology Ch 3 Class 11

Most enzymes have an optimum temperature of around:

PMC 2020
Biology
Enzymes
Elimination Tool:

A) 30 C

B) 40 C

C) 50 C

D) 20 C

31 / 100

Category: Biology Ch 4 Class 11

Which one of the following organelles is required for aerobic respiration?

NTS 2018
Biology
Cell Structure and Function
Elimination Tool:

A) Nucleus

B) Mitochondrion

C) Endoplasmic reticulum

D) Plastids

32 / 100

Category: Biology Ch 11 Class 11

In paper chromatography xanthophyll will give ______ color:

NTS 2010
Biology
Bioenergetics
Elimination Tool:

A) Orange

B) Grey

C) Yellow

D) Blue-Green

33 / 100

Category: Biology Ch 6 Class 11

For respiratory metabolism, a bacterial cell membrane contains:

PMC Practice 4
Biology
Kingdom Prokaryote
Elimination Tool:

A) Proteins

B) Lipids

D) Chemicals

C) Enzymes

34 / 100

Category: Biology Ch 13 Class 11

Active site of Rubisco is evolved to bind

CO2

Both of these

H2O

35 / 100

Category: Biology

Which of the following occurs in the body in response to the secretion of Glucagon?

NUMS Mock 2
Biology
Homeostasis

A) Conversion of glucose to glycogen in liver cells

B) Decrease in blood glucose concentration

C) Increased uptake of glucose by muscle cells

D) Production of cyclic AMP in target cells

36 / 100

Category: Biology Ch 6 Class 12

Histones have abundance of amino acids

Valine and lysine

Arginine and lysine

Valine and arginine

Histidione and threonine

37 / 100

Category: Biology

Q.22 Pick the one which releases anticoagulant in human intestine to prevent clotting:

A. Ascaris lumbricoides

B. Ancylostoma duodenale

C. Enterobius vermicularis

D. Hirudo medicinalis

38 / 100

Category: Biology Ch 13 Class 11

Oxygen contents per liter of air is

10 ml

100 ml

200 ml

100ml

39 / 100

Category: Biology Ch 3 Class 11

Malonic acid is an example of:

Irreversible inhibitor

Reversible inhibitor

Competitive inhibitor

Non-competitive inhibitor

40 / 100

Category: Biology Ch 11 Class 12

Plants growing in xeric conditions are called

Spherophytes

Mesophytes

Xerophytes

Teridophytes

41 / 100

Category: Biology

The region where the impulse moves from one neuron to another is called ______.

NUMS Mock 4
Biology
Coordination and Control

A) Axon

B) Dendrites

C) Synapse

D) Thalamus

42 / 100

Category: Biology

Q43 Which cells produce oogonia in ovary?

A. Stromal cells

B. Epithelial cells

C. Germ cells

D. Theca cells

43 / 100

Category: Biology Ch 10 Class 11

Leptocardii is a group of:

NUMS 2015
Biology
Kingdom Animalia
Elimination Tool:

A) Urochordata

B) Cephalochordata

C) Vertebrata

D) Mollusca

44 / 100

Category: Biology

Q.65 How are flat worms not similar to round worms?

A. They are both acoelomates

B. They are both triploblastic.

C. They both show bilateral symmetry.

D. They are both worms.

45 / 100

Category: Biology Ch 12 Class 11

A psychological condition usually seen in girls and young women, with loss of appetite is:

NTS 2011
Biology
Nutrition
Elimination Tool:

A) Obesity

B) Malnutrition

C) Anorexia Nervosa

D) Dyspepsia

46 / 100

Category: Biology Ch 2 Class 11

5 different amino acids, numbered 1, 2, 3, 4, and 5, below from the following sequence in the path of a polypeptide chain:

1-2-3-4-2-5-3

Messenger RNA codon, which correspond to the amino acids, are:
amino acid 1 UGU

amino acid 2 GAU

amino acid 3 CAC

amino acid 4 UAG

amino acid 5 AAG

Which one of the following DNA bases sequences could provide the code for the given section of the polypeptide?

NTS 2015 DUHS and JSMU
Biology
Biological Molecules
Elimination Tool:

A) ACACTTGTGATGCTATTCGTG

B) ACACUAGUGAUGCUAUUCGUG

C) ACACTAGTGATGCTAAACGTG

D) ACACTAGTGATCCTATTCGTG

47 / 100

Category: Biology Ch 1 Class 12

Sphincter muscle in urinary system present near the junction of:

NUMS 2019 Reconduct
Biology
Homeostasis
Elimination Tool:

A) Pelvis and ureter

B) Ureter and urinary bladder

C) Urinary bladder and urethra

D) Urethra and bladder

48 / 100

Category: Biology Ch 7 Class 11

How are flat worms not similar to round worms?

PMC Practice 4
Biology
Kingdom Protista
Elimination Tool:

A) They are both acoelmates.

B) They are both triploblastic.

C) They both show bilateral symmetry.

D) They are both worms.

49 / 100

Category: Biology

Q.39 If a cross section of a sarcomere is seen, each myosin is surrounded by how many actin molecules?

A.5

B.6

C.7

D. 8

50 / 100

Category: Biology

Q.28 Flame cells in Planaria constitute the:

A. Digestive system

B. Reproductive system

C. Respiratory system

D. Excretory system

51 / 100

Category: Biology Ch 10 Class 12

Who developed a theory of natural selection essentially identical to Darwin’s

Hardy-Weinberg

Alfred Wallace

Malthus

Lyell

52 / 100

Category: Biology Ch 8 Class 11

Drug obtained from fungus used for lowing blood cholesterol is

UHS 2010
Biology
Kingdom Fungi
Elimination Tool:

A) Lovastatin

B) Cyclosporin

C) Ergotin

D) Griseofulvin

53 / 100

Category: Biology

Q31 What happens during muscle contraction to the length of each myosin and actin filament?

A. A band becomes short

B. I band elongates

C. There is no change in sarcomere

D. Z- lines get closer

54 / 100

Category: Biology

The type of gene interaction in which the effect caused by a gene at one locus interfere with the effect caused by another gene at another locus is known as:

NUMS Mock 1
Biology
Variation and Genetics

A) Pleiotropy

B) Epistasis

C) Polygenic inheritance

D) Gene linkage

55 / 100

Category: Biology Ch 2 Class 12

The number of muscles in a human body is about:

NTS 2012
Biology
Support and Movement
Elimination Tool:

A) 200

B) 300

C) 400

E) 600

56 / 100

Category: Biology Ch 11 Class 11

Van neil hypothesis about the production of oxygen during phosynthesis was based on the study and investigations on

Bacteria

Algae

Protenema

Cyanobacteria

57 / 100

Category: Biology Ch 7 Class 11

Which of the following statement about eiliates in incorrect?

Contain mainly unicellular organisms.

Their contractile vacoule is respobsible for water regulation.

They are even capable of sexual reproduction.

Diploid nucleus being smaller is responsible for cells metabolism and growth while polyploidy nucleus functions in sexual process.

58 / 100

Category: Biology Ch 11 Class 11

NAD is an example of ______:

NUMS 2020
Biology
Bioenergetics
Elimination Tool:

A) Mononucleotide

B) Dinucleotide

C) Tri nucleotide

D) Tetra nucleotide

59 / 100

Category: Biology Ch 6 Class 12

The length of okazaki fragments in eukayotes is

150–250 nucleotides long

200-300 nucleotides

1000-2000 nucleotde

100-200 nucleotides

60 / 100

Category: Biology Ch 7 Class 12

Microtubules are composed of

Action protein

Actin and myosin proteins

Sphingomyelin and tubulin

Tubulin protein and traces of RNA

61 / 100

Category: Biology Ch 6 Class 12

Haploid and monoploid numbers of chromosomes of hexaploid wheat are:

NTS 2014
Biology
Chromosomes and DNA
Elimination Tool:

A) 21 and 42

B) 7 and 21

C) 21 and 7

D) 42 and 21

62 / 100

Category: Biology Ch 9 Class 11

The gametophyte of Ulva is:

NUMS 2014
Biology
Kingdom Plantae
Elimination Tool:

A) Haploid

B) Diploid

C) Triploid

D) Polyploidy

63 / 100

Category: Biology

Icosahedral viruses have how many faces?

NUMS Mock 4
Biology
Variety of Life

A) 20

B) 30

C) 10

D) 40

64 / 100

Category: Biology Ch 8 Class 12

The trait “Kernel colour in corn” in controlled by how many pairs of genes

One pair

Two pairs

Three pairs

Many pairs

65 / 100

Category: Biology Ch 13 Class 11

The maximum amount of oxygen which normal human blood absorbs and carries at sea level is how many ml per 100 ml of blood?

PMC Sample 2
Biology
Gaseous Exchange
Elimination Tool:

A) 10

B) 20

C) 30

D) 40

66 / 100

Category: Biology

Which processes are essential in making nitrogen from dead plant material available to growing plants?

ammonification
deamination
nitrification
nitrogen fixation
NUMS Mock 2
Biology
Man and His Enviornment

A) I, II and III only

B) I, II and IV only

C) I, III and IV only

D) II, III and IV only

67 / 100

Category: Biology

Q.51 The heavy and light chains of an antibody molecule is held together by:

A. H-bonds

B. Disulphide bridges

C. Ionic interactions

D. Hydrophobic interactions

68 / 100

Category: Biology Ch 9 Class 12

Gel electrophoresis is a technique:

PMC 2020
Biology
Biotechnology
Elimination Tool:

A) Employed by forensic scientist to assist in the identification of the individuals by their respective type of DNA

B) Collect all the genes found in one complete set of chromosome

C) Is a technique to separate different sizeds fragment of charge bearing polymers (proteins, RNA or DNA)

D) Grows single cell or a group of cells in a glass ware on artificial medium under aseptic conditions

69 / 100

Category: Biology Ch 3 Class 11

Identify the wrong statements.

(a) The substrate binds to active site of enzyme and not fitting into active site

(b) The binding of substrate induces the enzyme to alter its shape

(d) The enzyme releases the products of the reaction and runs through catalytic cycle once again

NUMS 2019 Reconduct
Biology
Enzymes
Elimination Tool:

A) A, C

B) B, D

C) B, C

D) A, D

70 / 100

Category: Biology Ch 12 Class 12

Desert ecosystem of Mianwali is

Thar

Thal

Cholistan

None

71 / 100

Category: Biology Ch 10 Class 11

Archaeopteryx is a transitional stage between the members of which one of the following pairs?

NTS 2013
Biology
Kingdom Animalia
Elimination Tool:

A) Amphibian … bird

B) Fish … amphibian

C) Reptile … mammal

D) Reptile … bird

72 / 100

Category: Biology Ch 9 Class 12

Recombinant DNA contains DNA from

2 different sources

3 different sources

2 same sources

3 same sources

73 / 100

Category: Biology Ch 9 Class 11

The zygote formed in liverworts is

Unicellular

Mulicellular

Multinucleate

None of these

74 / 100

Category: Biology Ch 4 Class 11

Which among the following sentence is not correct about the organelles?

NUMS 2019 Reconduct
Biology
Cell Structure and Function
Elimination Tool:

A) They are found in all Eukaryotic cells.

B) They are only found in multicellular organisms.

C) They coordinate to produce the cell.

D) They are small sized and mostly internal.

75 / 100

Category: Biology Ch 9 Class 12

Transgenic plants are produced when foreign genes are introduced into

Mature plant embryo

Immature plant embryo

Roots

Leaves

76 / 100

Category: Biology Ch 13 Class 11

During breathing air from Pharynx enters to:

UHS 2018
Biology
Gaseous Exchange
Elimination Tool:

A) Trachea

B) Bronchioles

C) Alveoli

D) Bronchi

77 / 100

Category: Biology Ch 3 Class 12

Which body function is controlled through a positive feedback mechanism?

PMC 2020
Biology
Coordination and Control
Elimination Tool:

A) Labor contractions

B) Body temperature

C) Insulin production

D) Thyroxine release

78 / 100

Category: Biology Ch 4 Class 11

Autophagosomes are

Those lysosomes which eat parts of their own cells to generate energy.

Those lysosomes which eat old and worn out cellular organelles.

Lysosomes which help in extracellular digestion

Both a and b

79 / 100

Category: Biology Ch 3 Class 11

Biological molecules (proteins) which catalyze a biochemical reaction and remain unchanged after completion of reaction are called

Cofactor

Coenzymes

Activator

Enzymes

80 / 100

Category: Biology Ch 7 Class 11

Which of the following statements is correct?

NUMS 2017
Biology
Kingdom Protista
Elimination Tool:

A) Viruses have their own ribosomes for protein formation

B) New viral ribosomes are formed after viral DNA enters the cell

C) Viruses do not need ribosomes for protein formation

D) Viruses use the host ribosomes for their own requirements

81 / 100

Category: Biology Ch 14 Class 11

An example of passive acquired immunity is?

NTS 2015 DUHS and JSMU
Biology
Transport
Elimination Tool:

B) use of polio vaccine

C) passing of certain antibodies to the foetus by the pregnant women

D) inoculation of antitoxin in the case of puncture wound

E) both C and D

82 / 100

Category: Biology Ch 9 Class 11

Antheridia and archegonia are born on _____ in bryophytes

Sporophyte

Gametophyte

Both of these

None of these

83 / 100

Category: Biology Ch 10 Class 11

All of the following are coelomates except

Deuterosomes

Proterosomes

Hemichordates

Aschelminthes

84 / 100

Category: Biology

Q3 These animals show radial symmetry.

A. Chordates

B. Annelids

C. Cnidarian

D Round worms

85 / 100

Category: Biology Ch 5 Class 12

Fetus is human embryo from the beginning of which of the following?

PMC Sample 2
Biology
Growth and Development
Elimination Tool:

A) 2nd month

B) 3rd month

D) 5th month

C) 4th month

86 / 100

Category: Biology

Q47 The T-lymphocytes and B-lymphocytes are the major cells of the:

A. Thymus

B. Lymph nodes

C. Adrenal glands

D. Lymphatic vessels

87 / 100

Category: Biology Ch 2 Class 11

The cell wall of most of the bacteria have a unique macromolecule called_______.

NTS 2012
Biology
Biological Molecules
Elimination Tool:

A) Cellulose

B) Chitin

C) Fibres

E) Peptidoglycan

88 / 100

Category: Biology Ch 1 Class 12

Reabsorption of calcium is triggered by:

NUMS 2019 Reconduct
Biology
Homeostasis
Elimination Tool:

A) Aldosterone

B) Parathormone

C) Antidiuretic

D) Vasopressin

89 / 100

Category: Biology Ch 7 Class 12

In which stage of meiotic division centromere divides?

NUMS 2017
Biology
Cell Cycle
Elimination Tool:

A) Anaphase I

B) Anaphase II

C) Metaphase II

D) Both A and B

90 / 100

Category: Biology Ch 7 Class 11

The only group of algae having no flagellated motile cells at any stage is :

Chrysophyta

Phaeophyta

Pyrrophyta

Rhodophyta

91 / 100

Category: Biology Ch 9 Class 11

What is the strengthening material of the prokaryotic cell wall?

PMC Practice 7
Biology
Kingdom Plantae
Elimination Tool:

A) Cellulose

B) Chitin

C) Silica waxes and lignin

D) Peptidoglycan or murein

92 / 100

Category: Biology Ch 12 Class 11

Puccinia is a parasitic:

Plant

Fungus

Animal

Algae

93 / 100

Category: Biology Ch 3 Class 12

Neurons are cells adapted for the rapid transmission of electrical impulses. To do this, they have long thin processes called:

PMC 2020
Biology
Coordination and Control
Elimination Tool:

A) Axons

B) Dendrites

D) Schwann cell

C) Myelin sheath

94 / 100

Category: Biology

Q.32 Lymphocytes are found in:

A. Lymph capillary

B. Lymph vessel

C. Lymph trunk

D. lymph node

95 / 100

Category: Biology Ch 4 Class 12

Follicle – stimulating hormone, which is produced by the pituitary gland, stimulates the ovaries to produce:

NUMS 2019 Cancelled
Biology
Reproduction
Elimination Tool:

A) Estrogen

B) Estrogen and progesterone

C) Progesterone

D) Oxytocin

96 / 100

Category: Biology Ch 5 Class 12

Thymus is found in the human body in _____.

PMC Practice 2
Biology
Growth and Development
Elimination Tool:

A) The medulla oblongata

B) The mediastinum of the upper thorax

C) Both Options A and B are correct

D) None of these options is correct

97 / 100

Category: Biology Ch 6 Class 11

Which of the following is not a sterilization method for the control of bacteria?

PMC Practice 4
Biology
Kingdom Prokaryote
Elimination Tool:

A) Radiation

C) High temperature

B) Filtration

D) Antiseptic

98 / 100

Category: Biology Ch 9 Class 11

Below the point at which the cotyledons are attached, the embryo axis is called _______.

NTS 2016 SMBBMC
Biology
Kingdom Plantae
Elimination Tool:

A) Radicle

B) Epicotyl

C) Hypocotyl

D) Coleoptile

99 / 100

Category: Biology Ch 11 Class 11

Lactic Acid Fermentation is a type of anaerobic respiration that occurs in human muscle cells. It yields only ____ % of the energy present in a glucose molecule.

NUMS 2019 Reconduct
Biology
Bioenergetics
Elimination Tool:

A) 5

B) 7

C) 10

D) 20

100 / 100

Category: Biology Ch 5 Class 12

Which of the following is NOT a function of Abscisic acid?

PMC Sample 3
Biology
Growth and Development
Elimination Tool:

A) Inhibits stem and root growth during drought.

B) Closing of stomata during wilting.

C) Inhibits flowering in long-day plants

D) Promotes bud initiation during growth season.

Your score is

The average score is 61%

Structured Practice for Best Entry Test Preparation

This topic-wise and chapter-wise practice test allows students to focus on individual biology concepts, including diagrams, processes, and conceptual questions. Regular practice enhances understanding, sharpens problem-solving skills, and builds confidence to tackle both board and competitive exam questions efficiently.

Free Resources for Best Entry Test Preparation

Students can access free Biology Practice Test 4 to systematically improve knowledge, recall, and problem-solving abilities. This test is suitable for FSC Board Exams as well as major entry tests, helping students perform better in the biology section. PLS Academy provides these resources to support students in their preparation.

JazakAllah