FSC Biology Full Book MCQs Test 5

MDCAT Practice Tests

Biology Practice Test 5

1 / 100

Category: Biology Ch 2 Class 12

Number of bones in the skull:

NUMS 2016
Biology
Support and Movement
Elimination Tool:

A) 22

B) 26

C) 24

D) 28

2 / 100

Category: Biology

Erythroblastosis foetalis occurs when:

NUMS Mock 2
Biology
Variation and Genetics

A) Mother is Rh-positive and baby is Rh-negative

B) Mother is Rh-negative and the baby is Rh-positive

C) Both mother and baby are Rh-negative

D) Both mother and baby are Rh-positive

3 / 100

Category: Biology Ch 13 Class 11

Guard cells function as:

NUMS 2019 Cancelled
Biology
Gaseous Exchange
Elimination Tool:

A) The defense system

B) Multisensory hydraulic valve

C) Hydrostatic pressure

D) All of these

4 / 100

Category: Biology Ch 4 Class 11

Who first observed and thus hypothesized that new cells are formed from previously existing living cell?

Theodor Schwann and Schleiden

Rudolph Virchows

Louis Pasteur

Both b and c

5 / 100

Category: Biology Ch 3 Class 11

Which statement about enzyme is incorrect:

Some of them consist solely of protein with no non protein part.

They catalyze a chemical reaction without being utilized.

All enzymes are fibrous Proteins.

They without their cofactor are called apoenzyme.

6 / 100

Category: Biology Ch 2 Class 11

Ribose sugar that is the main part of RNA is a type of _____ sugar.

NUMS 2019 Reconduct
Biology
Biological Molecules
Elimination Tool:

A) Triose

B) Tetrose

C) Pentose

D) Hexose

7 / 100

Category: Biology Ch 7 Class 12

Which statement is incorrect?

In human, cell cycle is about 24 hrs

Mitosis takes 30 min

G2 5.5 hrs

Yeast cell only 90 min

8 / 100

Category: Biology

Q.67 What is the property of the part of a cell membrane which is in contact with external and internal environment?

A. hydrophobic

B. hydrophilic

C. neutral

D. Both A and B

9 / 100

Category: Biology

Q.12 The least stable RNA present in the cell is:

tRNA

mRNA

rRNA

Micro RNA

10 / 100

Category: Biology

Q.38 Which of the following best describes a coenzyme?

A. Covalently bonded non-protein part of an enzyme

B. Cofactor consists of metal ions

C. Loosely bonded non-protein part of an enzyme

D. Both A and B

11 / 100

Category: Biology Ch 10 Class 11

Which organism has wings with claws?

NUMS 2015
Biology
Kingdom Animalia
Elimination Tool:

A) Eagle

B) Kestrel

C) Archaeopteryx

D) Mallard

12 / 100

Category: Biology Ch 6 Class 11

Which of the following organelles are present in all the bacteria?

NTS 2014
Biology
Kingdom Prokaryote
Elimination Tool:

A) Mesosome

B) Golgi bodies

C) Mitochondria

D) Chloroplast

13 / 100

Category: Biology Ch 1 Class 12

Which of the following structure in plant’s body is called excretophores?

Stem

Leaves

Flowers

Roots

14 / 100

Category: Biology Ch 13 Class 11

A disease caused by gradual breakdown of the thin walls of alveoli is;

UHS 2019
Biology
Gaseous Exchange
Elimination Tool:

A) Tuberculosis

B) Asthma

C) Emphysema

D) Bronchitis

15 / 100

Category: Biology Ch 6 Class 11

Which of the following structures provides greater pathogenicity to the bacteria?

PMC Practice 3
Biology
Kingdom Prokaryote
Elimination Tool:

A) Slime

B) Cell wall

C) Cell membrane

D) Capsule

16 / 100

Category: Biology Ch 9 Class 11

In Pakistan, the furniture wood is mainly obtained from the members of family:

UHS 2010
Biology
Kingdom Plantae
Elimination Tool:

A) Rosaceae

B) Solanaceae

C) Minosaceae

D) Fabaceae

17 / 100

Category: Biology

Tails can be regenerated in:

NUMS Mock 3
Biology
Growth and Development

A) The larvae of amphibians

B) Lizards

C) Both lizards and the larvae of amphibians

D) None of the given options

18 / 100

Category: Biology Ch 3 Class 12

The phytohormones controlling the plant movements are?

NTS 2015 SMBBMC
Biology
Coordination and Control
Elimination Tool:

A) Auxins

B) Gibberellins

C) Abscisic acid

D) Cytokinins

E) All of the above

19 / 100

Category: Biology

_______ is the storage form of carbohydrate in animals and humans which is equivalent to the _____ in plants.

NUMS Mock 3
Biology
Biological Molecules

A) Glycogen, cellulose

B) Starch. cellulose.

C) Glycogen, starch

D) Starch, glycogen

20 / 100

Category: Biology

Q.12 In enzymatic mechanism, the substrate bind to enzyme active site to produce?

A. Reactants

B. Enzyme

C. Products

D. all of these

21 / 100

Category: Biology

Q.52 A chromosome in which a centromere stays at one end is called?

A. Metacentric

Telocentric

C. Acrocentric

D. All of these

22 / 100

Category: Biology Ch 13 Class 11

Hemoglobin can absorb maximum oxygen at sea level, which is _____ ml/100 ml of blood.

NUMS 2019 Cancelled
Biology
Gaseous Exchange
Elimination Tool:

A) 15

B) 19

C) 19.6

D) 20

23 / 100

Category: Biology Ch 8 Class 12

______ alleles both have an effect on the phenotype of a heterozygous organism:

PMC 2020
Biology
Variation and Genetics
Elimination Tool:

A) Dominant

B) Recessive

C) Co-dominant

D) Multiple

24 / 100

Category: Biology Ch 4 Class 11

60S and 40S subunit combine to form ______ particle

100 S

90 S

80 S

70 S

25 / 100

Category: Biology Ch 9 Class 12

A single stranded nucleotide sequence that will hybridize into a certain piece of DNA is

Primer

Probe

Genome

Both a & b

26 / 100

Category: Biology

Booklungs serve the function of respiration in:

NUMS Mock 3
Biology
Gaseous Exchange

A) Scorpion

B) Earthworm

C) Frog

D) Cockroaches

27 / 100

Category: Biology Ch 5 Class 11

Closely related species are grouped together into ______ .

NTS 2012
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) families

B) orders

C) phyla

E) genus

28 / 100

Category: Biology Ch 7 Class 11

Which of the following statements is correct?

NUMS 2017
Biology
Kingdom Protista
Elimination Tool:

A) Viruses have their own ribosomes for protein formation

B) New viral ribosomes are formed after viral DNA enters the cell

C) Viruses do not need ribosomes for protein formation

D) Viruses use the host ribosomes for their own requirements

29 / 100

Category: Biology

Q.59 NADH produced during glycolysis and Krebs cycle will oxidized by:

A. Coenzyme ‘Q’

B. Cytochrome ‘c’

C. Cytochrome ‘b’

D. Cytochrome ‘a’

30 / 100

Category: Biology Ch 2 Class 12

The multinucleated mass of the bone-breaking cells is called:

NUMS 2020
Biology
Support and Movement
Elimination Tool:

A) Osteoclasts

B) Osteoblasts

C) Osteogenesis

D) Osteocytes

31 / 100

Category: Biology Ch 4 Class 12

In sexual reproduction, plants have diplohaplontic life cycle with alternating

Diploid sporophyte and haploid gametophyte generations

Haploid sporophyte and diploid gametophyte generations

Diploid sporophyte and diploid gametophyte generations

Haploid sporophyte and haploid gametophyte generations

32 / 100

Category: Biology Ch 7 Class 11

The drfinite shape to ciliates is given by

Pellicle

Penicle

Calcium

Cell wall

33 / 100

Category: Biology Ch 10 Class 12

According to the theory of natural selection, organisms produce:

UHS 2019
Biology
Evolution
Elimination Tool:

A) Offspring according to the resources available

B) Offspring to create resources

C) To create resources

D) More offspring than supported

34 / 100

Category: Biology Ch 3 Class 11

An activated enzyme made of polypeptide chain and a cofactor is?

PMC Practice 2
Biology
Enzymes
Elimination Tool:

A) Substrate

B) Coenzyme

C) Apoenzyme

D) Holoenzyme

35 / 100

Category: Biology Ch 11 Class 11

How does chemosynthesis differ from photosynthesis?

NUMS 2020
Biology
Bioenergetics
Elimination Tool:

A) Source of energy to carry out the reaction

B) Production of organic compounds

C) Reduction of CO2

D) Carried out by bacteria

36 / 100

Category: Biology Ch 10 Class 11

Which vertebrate groups have scaly skin?

NTS 2013
Biology
Kingdom Animalia
Elimination Tool:

A) amphibians and fish

B) amphibians and mammals

C) fish and mammals

D) fish and reptiles

37 / 100

Category: Biology Ch 3 Class 12

The only promoter of leaf senescence in the following plant hormones is:

Gibberellins

Cytokinins

Auxins

Abscisic Acid

38 / 100

Category: Biology Ch 8 Class 12

Pick the correct option about Drosophila.

NUMS 2015
Biology
Variation and Genetics
Elimination Tool:

A) The Male is larger with a pointed abdomen

B) The female has sex combs on its front legs

C) It has a generation time of just eight weeks

D) Salivary gland cells have giant chromosomes in their nuclei

39 / 100

Category: Biology Ch 12 Class 11

A part of the digestive system that is not in contact with food is the:

NTS 2017
Biology
Nutrition
Elimination Tool:

A) Small intestine

C) Liver

B) Stomach

D) Large intestine

40 / 100

Category: Biology Ch 10 Class 11

Bipinnaria is the larval form of:

NUMS 2014
Biology
Kingdom Animalia
Elimination Tool:

A) Coelenterate

B) Potychaeta

C) Echinodermata

D) Cestoda

41 / 100

Category: Biology Ch 9 Class 12

Treatment of hereditary disorders by gene manipulations is called:

NUMS 2016
Biology
Biotechnology
Elimination Tool:

A) Biotechnology

B) Genetic engineering

C) Gene therapy

D) None of these

42 / 100

Category: Biology

Q.9 This is a reduced compound

A. CO2

B. O2

C. NADH

D. NAD

43 / 100

Category: Biology Ch 14 Class 11

Autoimmune diseases act at the principle of:

NUMS 2020
Biology
Transport
Elimination Tool:

A) Self against antigens

B) Antigen against self

C) Self against self

D) Antigen destroyed

44 / 100

Category: Biology

Q.44 To produce ATP (adenosine triphosphate) in muscles, creatine phosphate (CP) transfers__________________ to adenosine diphosphate (ADP).

A. Oxygen

B. Adenosine

C. Cytosine

D. Phosphate

45 / 100

Category: Biology Ch 4 Class 11

Lysosomes function in:

NTS 2011
Biology
Cell Structure and Function
Elimination Tool:

A) Protein synthesis

B) Processing

C) Intracellular digestion

D) Lipid synthesis

46 / 100

Category: Biology Ch 3 Class 11

The Induced fit model was introduced by Koshland in which of the following year?

PMC Sample 1
Biology
Enzymes
Elimination Tool:

A) 1960

B) 1961

C) 1959

D) 1966

47 / 100

Category: Biology Ch 12 Class 12

Which statement about profundal zone is correct?

Plants are unable to anchor but enough light penetrates to support photosynthesis

Phytoplanktons in this region are cyanobacteria

Decomposers and detritus feeders inhabit it

Water lilies are abundant

48 / 100

Category: Biology

The structure of an enzyme is altered by which of the following inhibitors?

NUMS Mock 3
Biology
Enzymes

A) Reversible inhibitor.

B) Competitive inhibitor.

C) Non-competitive inhibitor.

D) Irreversible inhibitor.

49 / 100

Category: Biology Ch 4 Class 11

What is the role of cholesterol in the cell membrane?

NUMS 2020
Biology
Cell Structure and Function
Elimination Tool:

A) it functions in joining adjacent cells together.

B) It functions in recognizing foreign cells.

C) It increases the rate of transport of ions across the membrane.

D) It stabilizes the cell membrane.

50 / 100

Category: Biology Ch 8 Class 12

Which of the following is monohybrid cross

TT x tt

TTYy x Ttyy

Both of these

None of these

51 / 100

Category: Biology Ch 10 Class 12

Choose the correct combination:

NUMS 2019 Cancelled
Biology
Evolution
Elimination Tool:

A) Darwin – survival of the fittest

B) Darwin – no extinction

C) Lamarck – acquired transmission

D) Both Darwin – survival of the fittest and Lamark – acquired transmission

52 / 100

Category: Biology Ch 8 Class 11

Which of the following component is found in the cell wall of fungi?

UHS 2012
Biology
Kingdom Fungi
Elimination Tool:

A) Cellulose

B) Chitin

C) Proteins

D) Glycerol

53 / 100

Category: Biology

Two species can avoid competition and better use the environment’s resources by occupying different ____.

NUMS Mock 4
Biology
Evolution

A) Adaptations

B) Polymorphism

C) Niches

D) Specialization

54 / 100

Category: Biology Ch 6 Class 11

Which of the following is true of both bacterial conjugation and meiosis?

PMC Practice 3
Biology
Kingdom Prokaryote
Elimination Tool:

A) Both processes produce four haploid cells

B) Both processes are a form of asexual reproduction

C) Both processes involve genetic recombination

D) None of these options is correct

55 / 100

Category: Biology Ch 1 Class 12

Marine fish can keep their internal environment hypertonic with respect to the surrounding salty water by retaining.

Excessive urea which will increase their internal solute concentration and prevent body shrinkage in hypertonic environment

Trimethyl alanine

Ammonia

Trimethylamine oxide

56 / 100

Category: Biology Ch 8 Class 11

Coenocytic hyphae are also known as

Septate

. Perforated hyphae

Aseptate

Uninucleate hyphae

57 / 100

Category: Biology Ch 6 Class 11

A group of 8 cocci is called

Diplococci

Octococci

Tetrad

Sarcina

58 / 100

Category: Biology Ch 5 Class 11

Syphilis is caused by:

NUMS 2018
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Coccus

B) Bacillus

C) Spirillum

D) Spirochete

59 / 100

Category: Biology Ch 9 Class 12

Choose the term from the following which is NOT a part of gene therapy?

NTS 2019
Biology
Biotechnology
Elimination Tool:

A) Bone marrow transplant

B) Retrovirus

C) DNA Fingerprinting

D) Somatic cells

60 / 100

Category: Biology

The sympathetic nervous system causes which of the following?

NUMS Mock 2
Biology
Coordination and Control

A) Constriction of the pupil

B) Decreased heart rate

C) Increased gastric section

E) Increased respiration

61 / 100

Category: Biology Ch 9 Class 11

Of the following which one is most advanced ?

Anthoceropsida

Bryopsida

Hepaticopsida

None of these

62 / 100

Category: Biology Ch 7 Class 12

Which statement is not true about phragmoplast?

Formed from vesicle originating from Golgi apparatus

Present in plants only

Formed at the end of anaphase

Centre of dividing cell

63 / 100

Category: Biology

Q.13 Without enzymes, the biological reaction would proceed at:

A. Same speed

B. Constant speed

C. Very slow speed

D. Variable speed

64 / 100

Category: Biology Ch 2 Class 11

Which of the statement is not true for compounds like glycoprotein and glycolipids?

They are conjugated molecules of carbohydrates

Both have role in the extra cellular matrix of animals and bacterial cell wall

They are components of biological membranes.

Both are produced and secreted by endoplasmic reticulum

65 / 100

Category: Biology Ch 11 Class 11

Of the following which one is not an energy releasing process?

Glycolysis

Respiration

Photosynthesis

Kreb's cycle

66 / 100

Category: Biology

Red-green color-blindness is an X-linked recessive disorder. Jacob’s paternal grandfather and father are both color-blind, but his mother has two normal alleles. What is the probability that Jacob is red-green color-blind?

NUMS Mock 2
Biology
Variation and Genetics

A) 0%

B) 25%

C) 50%

D) 75%

67 / 100

Category: Biology Ch 8 Class 11

Which of the following endoparasites of humans does show viviparity?

NTS 2018
Biology
Kingdom Fungi
Elimination Tool:

A) Trichinella spiralis

B) Ascaris lumbricoides

C) Ancylostoma duodenale

D) Enterobius vermicularis

68 / 100

Category: Biology Ch 13 Class 12

Hydroelectricity is generated by using ______ of falling water.

Potential energy

Gravitational energy

Kinetic energy

. All of these

69 / 100

Category: Biology Ch 7 Class 11

Sleeping sickness in humans is caused by:

UHS 2013
Biology
Kingdom Protista
Elimination Tool:

A) Trypanosoma

B) Plasmodium

C) Anopheles

D) Andes

70 / 100

Category: Biology Ch 2 Class 12

Endoskeleton is secreted by:

Ectoderm

Endoderm

Mesoderm

All of these

71 / 100

Category: Biology Ch 4 Class 12

Which of these cycles operate in human females?

PMC Sample 2
Biology
Reproduction
Elimination Tool:

A) Oestrous cycle

B) Menstrual cycle

C) Both Options A and B are correct

D) None of these options is correct

72 / 100

Category: Biology Ch 5 Class 11

Amoeba belongs to which kingdom:

Prokaryotae

Plantae

Monera

Protista

73 / 100

Category: Biology

Q.55 Immunogen is a foreign substance and stimulates the formation of:

A. Antitoxins

B. Antiserum

C. Antibodies

D. Lymph

74 / 100

Category: Biology Ch 13 Class 12

A lullaby is a song. No song is prose. Some proses are epics.

Conclusions:

I. Some proses are songs.

II. Some epics are lullabies.

III. Some songs are lullabies.

Which of the following is most appropriate in the above case?

a) Only II

b) Only III

c) I, II, and III are inappropriate

a

b

c

none

75 / 100

Category: Biology Ch 3 Class 12

The nerve center for sight is located in the

NUMS 2014
Biology
Coordination and Control
Elimination Tool:

A) Thalamus

B) Myopic

C) Both a and b

D) None of these

76 / 100

Category: Biology Ch 4 Class 11

Which among the following sentence is not correct about the organelles?

NUMS 2019 Reconduct
Biology
Cell Structure and Function
Elimination Tool:

A) They are found in all Eukaryotic cells.

B) They are only found in multicellular organisms.

C) They coordinate to produce the cell.

D) They are small sized and mostly internal.

77 / 100

Category: Biology Ch 4 Class 11

Which of the following statement(s) is/are correct regarding a nucleus?

I.Stores wastes and other Substances

II.Contains genetic material

III.Helps in cellular transport system

IV.Control centre of the cell

NTS 2017
Biology
Cell Structure and Function
Elimination Tool:

A) I only

B) I&II

C) II & III

D) II & IV

78 / 100

Category: Biology

Q42 The process that secretes insulin from the cell is called?

A. Endocytosis

B. Pinocytosis

C. Phagocytosis

D. Exocytosis

79 / 100

Category: Biology

Q.21 All of the following are true for platyhelminthes except:

A. Flatworms

B. Triploblastic

C. Coelomates

D. Bilateral symmetry

80 / 100

Category: Biology Ch 5 Class 12

Human embryo remains enclosed in:

PMC Practice 1
Biology
Growth and Development
Elimination Tool:

A) Amniotic sac

B) Placenta

C) Chorion

D) Allantois

81 / 100

Category: Biology Ch 13 Class 11

Lungs are separated from abdominal cavity by a muscular sheath called:

NUMS 2018
Biology
Gaseous Exchange
Elimination Tool:

A) Pleura

B) Rib cage

C) Pericardium

D) Diaphragm

82 / 100

Category: Biology Ch 9 Class 12

A method of DNA sequencing in which DNA threads are chemically cut into pieces of different sizes is

Sanger's method

Maxam-Gilbert method

Hamilton's method

Vortex method A

83 / 100

Category: Biology Ch 6 Class 12

The particular array of chromosomes that an individual possesses is called its:

PMC 2020
Biology
Chromosomes and DNA
Elimination Tool:

A) Genotype

B) Phenotype

C) Karyotype

D) Allele

84 / 100

Category: Biology Ch 10 Class 11

Species of phylum Platyhelminthes are:

NTS 2011
Biology
Kingdom Animalia
Elimination Tool:

A) Roundworms

B) Flat worms

C) Hook worms

D) Thread worms

85 / 100

Category: Biology Ch 5 Class 11

Which of the following is not true for retroviruses?

NUMS 2014
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) They are cuboidal in shape

B) They are enveloped by host plasma membrane

C) They have enzyme reverse transcriptase

D) All of them are not specific

86 / 100

Category: Biology Ch 8 Class 11

Fungi do not contain:

NTS 2010
Biology
Kingdom Fungi
Elimination Tool:

A) Cell wall

C) Chlorophyll

B) Hyphae

D) Mycelium

87 / 100

Category: Biology Ch 7 Class 12

The term bivalent means:

NUMS 2014
Biology
Cell Cycle
Elimination Tool:

A) Two chromatids

B) Two chromosomes

C) Four chromatids

D) Four chromosomes

88 / 100

Category: Biology Ch 4 Class 12

Which statement is incorrect?

Climacteric is burst of respiratory activity in fruit ripening

It is associated with ethane production C

It helps in fruit set

It helps in fruit ripening

89 / 100

Category: Biology Ch 3 Class 11

When inhibitor binds to enzyme other than active site and alters its structure, then it is called:

NUMS 2020
Biology
Enzymes
Elimination Tool:

A) Competitive inhibitor

B) Non-competitive inhibitor

C) Reversible inhibitor

D) Irreversible inhibitor

90 / 100

Category: Biology Ch 7 Class 12

During which stage of meiosis do centromeres divide?

NTS 2016 DUHS & JSMU
Biology
Cell Cycle
Elimination Tool:

A) Prophase I

B) Metaphase I

C) Prophase II

D) Metaphase II

91 / 100

Category: Biology Ch 7 Class 11

Photosynthesis is absent in which of the following:

PMC 2021 Tested
Biology
Kingdom Protista
Elimination Tool:

A) Bacteria

B) None of these

C) Seaweeds

D) Mushrooms

92 / 100

Category: Biology Ch 2 Class 11

The melting point of unsaturated fatty acids:

NUMS 2019 Reconduct
Biology
Biological Molecules
Elimination Tool:

A) Increases with increase in double bonds

B) Decreases with increase in double bonds

C) Rises in some and falls in others

D) There is no relationship between unsaturation and melting point

93 / 100

Category: Biology Ch 13 Class 11

_________ respiration is directly involved in the production of energy, necessary for all living activities.

Organismic

Cellular

Both of these

None of thes

94 / 100

Category: Biology Ch 4 Class 12

Amniocentesis is performed between the:

NTS 2011
Biology
Reproduction
Elimination Tool:

A) 16th and 18th week of gestation

B) 1st and 2nd week of gestation

C) 30th and 32nd week of gestation

D) 37th and 38th week of gestation

95 / 100

Category: Biology Ch 5 Class 12

he only promoter of Leaf’s senescence in the following plant hormones is:

PMC Practice 9
Biology
Coordination and Control
Growth and Development
Elimination Tool:

A) Gibberellins

B) Cytokinins

C) Auxins

D) Abscisic acid

96 / 100

Category: Biology Ch 5 Class 11

Bacteriophages, or phages are also known as:

PMC Sample 2
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Bacteria facilitator

B) Bacteria eater

C) Animal viruses

D) Plant viruse

97 / 100

Category: Biology Ch 8 Class 12

How many genes control Rh blood group system?

One

Two

Three

Four

98 / 100

Category: Biology

5 different amino acids, numbered 1, 2, 3, 4, and 5, below from the following sequence in the path of a polypeptide chain:

1-2-3-4-2-5-3

Messenger RNA codon, which correspond to the amino acids, are:
amino acid 1 UGU

amino acid 2 GAU

amino acid 3 CAC

amino acid 4 UAG

amino acid 5 AAG

Which one of the following DNA bases sequences could provide the code for the given section of the polypeptide?

NUMS Mock 2
Biology
Biological Molecules

A) ACACTTGTGATGCTATTCGTG

B) ACACUAGUGAUGCUAUUCGUG

C) ACACTAGTGATGCTAAACGTG

D) ACACTAGTGATCCTATTCGTG

99 / 100

Category: Biology Ch 11 Class 11

Which of the following is a copper containing protein in electron transport chain?

PMC 2020
Biology
Bioenergetics
Elimination Tool:

A) Plastoquinone

B) Cytochrome – C

C) Plastocyanin

D) Ferredoxin

100 / 100

Category: Biology

Which one of the following is most likely to occur in a boy during puberty?

NUMS Mock 4
Biology
Reproduction

A) He produces eggs

B) His shoulders broaden

C) The colour of his eyes change

D) None of these options is correct

Your score is

The average score is 60%

0%

Learn Anytime Anywhere

PakLearningSpot