Biology Practice Test 2

Biology Practice Test 2 is designed to help students strengthen their understanding of key biological concepts, theories, and processes for competitive entry tests like MDCAT, NUMS, AKU, UET, ECAT, NTS, as well as FSC Board Exams. This test covers topics from molecular biology, cell division, human physiology, plant physiology, and more, helping students improve accuracy and retention.

PLS Academy

Get Access to 20 thousands+ MCQs Including Topical MCQs, Practice Tests, Mock Tests, Solved Past Papers, Flashcards, Notes, FLPS, and Much More.

UNLOCK PREMIUM🔐

2514

Created by Ali Durrani

MDCAT Practice Tests

Biology Practice Test 2

This is the Free Access to Limited MCQs. Enroll to PLS Boost Premium Bundle to Get More MCQs HERE

1 / 100

Category: Biology

Muscular tube that passes through pharynx and joins stomach is:

NUMS Mock 1
Biology
Nutrition

A) Trachea

B) NG tube

C) Nerve canal

D) Esophagus

2 / 100

Category: Biology Ch 6 Class 11

Which one of the following sets includes the bacterial diseases?

NUMS 2014
Biology
Kingdom Prokaryote
Elimination Tool:

A) Cholera, typhoid, mumps

B) Tetanus, tuberculosis, measles

C) Malaria, mumps, poliomyelitis

D) Diphtheria, leprosy, plague

3 / 100

Category: Biology

Which of these is not a reflex action?

NUMS Mock 3
Biology
Coordination and Control

A) Secretion of sweat.

B) Salivation.

C) Flexion due to needle prick.

D) Blinking of eyes due to strong light.

4 / 100

Category: Biology Ch 9 Class 11

Which of the following features differentiate angiosperms from gymnosperms?

UHS 2010
Biology
Kingdom Plantae
Elimination Tool:

A) Pollens disperse by air

B) Haploid microspores

C) Ovaries

D) Pollen tubes

5 / 100

Category: Biology Ch 3 Class 11

The Induced fit model was introduced by Koshland in which of the following year?

PMC Sample 1
Biology
Enzymes
Elimination Tool:

A) 1960

B) 1961

C) 1959

D) 1966

6 / 100

Category: Biology Ch 8 Class 11

An association in which fungal hyphae penetrate the outer cells of the plant root forming coils swellings and minute branches and also extend out into surrounding soil is called:

Mycorrizael association

Endomycorrhizae

Ectomycorrhizae

Lichen

7 / 100

Category: Biology Ch 8 Class 12

In cats, the genes controlling coat-color are co-dominant (incompletely dominant) and are carried on the X chromosomes. When a black female was mated with a ginger male the resulting litter consisted of black male and tortoise-shell female kittens. What phenotypic ratio would be expected in the F2 generation?

NTS 2012
Biology
Variation and Genetics
Elimination Tool:

A) 1 black male : 1 ginger male : 2 tortoise – shell females

B) 1 black male : 1 ginger male : 1 tortoise – shell female : 1 black female

C) 2 black males : 1 tortoise – shell female : 1 ginger female

D) 1 black male : 1 tortoise – shell female : 1 ginger female : 1 black female

8 / 100

Category: Biology Ch 2 Class 12

Molluscs have an exoskeleton made up of:

NTS 2016 DUHS & JSMU
Biology
Support and Movement
Elimination Tool:

A) Protein

B) Silica

D) Cuticles

C) CaCO3

9 / 100

Category: Biology

The causes of Cyanosis include:

NUMS Mock 2
Biology
Transport

A) Deficiency of vitamin C

B) Varicella-zoster virus

C) Degeneration of the cartilage of joints

D) Ventricular septum defect

10 / 100

Category: Biology

Q.56 During cyclic photophosphorylation, electrons are diverted back to:

A. Plastoquinone

B. Cytochrome complex

C. Plastocyanin

D. Ferredoxin

11 / 100

Category: Biology Ch 4 Class 12

Gametes in animals are produced by

Mitosis

RedMeiosis

BlueFission

Apomixis

12 / 100

Category: Biology Ch 11 Class 11

C6H12O6 + 6O2 ? 6CO2 + 6H20 + ENERGY represents:

Photosynthesis

Aerobic respiration

Anaerobic respiration

Respiration

13 / 100

Category: Biology Ch 11 Class 12

Disease in living organisms caused by parasites is called

Parasitism

Infestation

Predation

Infection

14 / 100

Category: Biology Ch 7 Class 11

Which of the following is TRUE about Amoebae?

PMC 2020
Biology
Kingdom Protista
Elimination Tool:

A) They have flagella

B) They are multicellular

C) They do not cause any disease in humans

D) They move by forming specialized cytoplasmic projections called pseudopodia

15 / 100

Category: Biology Ch 10 Class 12

Carolus Linnaeus was believer of

Special creation

Natural selection

Catastrophism

. Inheritance of acquired characters

16 / 100

Category: Biology Ch 1 Class 12

Sperms of liverworts, mosses, ferns move towards archegonia, in response to uncleic acid released by the ovum. This is an example of:

Chemotropic movement

Chemotactic movement.

Chemosastic movement

. Haptonastic movement.

17 / 100

Category: Biology Ch 2 Class 12

Roots of a plant show

Positive phototropism and negative geotropism.

Negative phototropism and positive geotropism.

Negative tactic movement and positive tropic movement.

Positive geotropism of stem and roots

18 / 100

Category: Biology Ch 5 Class 11

Which of the following organisms have Chitin as a major structural component of their cell wall:

Prokaryotae

Protoctista

Plantae

Fungi

19 / 100

Category: Biology Ch 11 Class 12

The role a species plays in a community including behavior and influence is

Nichon

Niche

Autecology

Profession

20 / 100

Category: Biology Ch 2 Class 11

5 different amino acids, numbered 1, 2, 3, 4, and 5, below from the following sequence in the path of a polypeptide chain:

1-2-3-4-2-5-3

Messenger RNA codon, which correspond to the amino acids, are:
amino acid 1 UGU

amino acid 2 GAU

amino acid 3 CAC

amino acid 4 UAG

amino acid 5 AAG

Which one of the following DNA bases sequences could provide the code for the given section of the polypeptide?

NTS 2015 DUHS and JSMU
Biology
Biological Molecules
Elimination Tool:

A) ACACTTGTGATGCTATTCGTG

B) ACACUAGUGAUGCUAUUCGUG

C) ACACTAGTGATGCTAAACGTG

D) ACACTAGTGATCCTATTCGTG

21 / 100

Category: Biology

Q.39 If a cross section of a sarcomere is seen, each myosin is surrounded by how many actin molecules?

A.5

B.6

C.7

D. 8

22 / 100

Category: Biology Ch 11 Class 11

The inner membrane of mitochondrion has many infoldings into the inner chamber, these folding are called as:

NUMS 2019 Reconduct
Biology
Bioenergetics
Elimination Tool:

A) Cristae

B) Cisternae

C) Matrix

D) F1 particles

23 / 100

Category: Biology Ch 10 Class 12

Consider the following statements about biological communities.

I. Their members share a common gene pool

II. The community remains stable even though some physical aspect of the environment may undergo a change

III. It consists of all the populations living in a particular area.

IV. A community interacts with a non-living environment and both function together to form an ecosystem

Which two of the above statements are true?

NTS 2014
Biology
Evolution
Elimination Tool:

A) 1 and 2

B) 1 and 3

D) 2 and 3

E) 3 and 4

24 / 100

Category: Biology

Gel electrophoresis is a technique:

NUMS Mock 1
Biology
Biotechnology

A) Employed by forensic scientist to assist in the identification of the individuals by their respective type of DNA

B) Collect all the genes found in one complete set of chromosome

C) Is a technique to separate different sizeds fragment of charge bearing polymers (proteins, RNA or DNA)

D) Grows single cell or a group of cells in a glass ware on artificial medium under aseptic conditions

25 / 100

Category: Biology Ch 8 Class 11

Tetracycline and penicillins are:

NUMS 2018
Biology
Kingdom Fungi
Elimination Tool:

A) Disinfectants

B) Antibiotics

C) Antiseptics

D) Antigens

26 / 100

Category: Biology Ch 13 Class 11

The respiratory pigment, which has much higher affinity to combine with oxygen is:

NUMS 2016
Biology
Gaseous Exchange
Elimination Tool:

A) Myoglobin

B) Globin

C) Haemoglobin

D) Hemocyanin

27 / 100

Category: Biology Ch 10 Class 12

Which one of the following pairs represents an analogous feature?

NUMS 2018
Biology
Evolution
Elimination Tool:

A) Elephant tusks and human incisors

B) Teleost erythrocyte and mammalian erythrocyte

C) Insect wing and bat wing

D) Mole forelimb and bird wing

28 / 100

Category: Biology

Q37 The muscle contraction depends on:

A. Nerve impulse

B. Energy

C. Calcium

D. All of these

29 / 100

Category: Biology Ch 3 Class 11

Identify the wrong statements.

(a) The substrate binds to active site of enzyme and not fitting into active site

(b) The binding of substrate induces the enzyme to alter its shape

(d) The enzyme releases the products of the reaction and runs through catalytic cycle once again

NUMS 2019 Reconduct
Biology
Enzymes
Elimination Tool:

A) A, C

B) B, D

C) B, C

D) A, D

30 / 100

Category: Biology Ch 7 Class 12

During meiosis, the homologous chromosomes come together and form pairs, this process is called:

PMC 2020
Biology
Cell Cycle
Elimination Tool:

A) Linkage

B) Synapsis

C) Pairing

D) Crossing over

31 / 100

Category: Biology Ch 1 Class 12

Most of the marine invertebrates are

Osmoconformers

Osmoregulators

Both depend upon the concentration of sea water

None of these

32 / 100

Category: Biology

Q.36 The ETC in plants consists of an electron carrier called?

A. Pq

B. Pc

C. Pt

D.Po

33 / 100

Category: Biology Ch 1 Class 12

Which organ is called the body thermostat?

NUMS 2020
Biology
Homeostasis
Elimination Tool:

A) Pituitary gland

B) Kidneys

C) Hypothalamus

D) Adrenal gland

34 / 100

Category: Biology Ch 3 Class 12

Which brain portion is responsible for controlling body coordination?

NUMS 2020
Biology
Coordination and Control
Elimination Tool:

A) Medulla

B) Amygdala

C) Cerebellum

D) Pons

35 / 100

Category: Biology Ch 8 Class 12

Linked genes with closer loci ______ Mendel’s law of independent assortment as they _____ assort independently.

NUMS 2019 Reconduct
Biology
Variation and Genetics
Elimination Tool:

A) Don’t obey: cannot

B) Don’t obey: can

C) obey : cannot

D) obey : can

36 / 100

Category: Biology Ch 11 Class 11

How does chemosynthesis differ from photosynthesis?

NUMS 2020
Biology
Bioenergetics
Elimination Tool:

A) Source of energy to carry out the reaction

B) Production of organic compounds

C) Reduction of CO2

D) Carried out by bacteria

37 / 100

Category: Biology Ch 5 Class 12

Fetus is human embryo from the beginning of which of the following?

PMC Sample 2
Biology
Growth and Development
Elimination Tool:

A) 2nd month

B) 3rd month

D) 5th month

C) 4th month

38 / 100

Category: Biology Ch 6 Class 11

If lipopolysaccharides did not appear in the wall of bacteria on staining then it will be known as ________.

UHS 2018
Biology
Kingdom Prokaryote
Elimination Tool:

A) Gram negative

B) Gram positive

C) Capsule

D) Both Gram positive & negative

39 / 100

Category: Biology Ch 14 Class 11

In the human body, blood circulating from the gut to the heart passes through the:

NTS 2013
Biology
Transport
Elimination Tool:

A) aorta

B) kidneys

D) lungs

C) llver

40 / 100

Category: Biology Ch 6 Class 12

DNA has a helical shape with the diameter of

3 nm

4 nm

2 nm

5 nm

41 / 100

Category: Biology Ch 2 Class 12

Exoskeleton of a marine snail is composed of

CaPO4

CaCO3

CaSO4

SiO2

42 / 100

Category: Biology Ch 1 Class 12

Right kidney is slightly lower than left kidney due to:

NUMS 2018
Biology
Homeostasis
Elimination Tool:

A) Heart

B) Liver

D) Lungs

C) Pancreas

43 / 100

Category: Biology

Which of the following is correct in case of active membrane potential?

NUMS Mock 2
Biology

A) Extra cellular sodium is high

B) Extra cellular potassium is high

C) Intracellular sodium is high

D) Intracellular potassium is less

44 / 100

Category: Biology Ch 9 Class 12

Which one of the following is made up of radioactively labelled nucleotides?

UHS 2015
Biology
Biotechnology
Elimination Tool:

A) Phage DNA

B) Genomic Library

C) Recombinant DNA

D) Gene Probe

45 / 100

Category: Biology

Q.63 Ozone depletion is commonly caused by:

A. CFC’s

B. Industrial smoke

C. Nitrogen gases

D. Green house gases

46 / 100

Category: Biology Ch 2 Class 12

When a physician elicits the knee-jerk reflex by tapping deep tendons in the knee, the normal response is for the lower leg to swing forward. When this happens:

NTS 2013
Biology
Support and Movement
Elimination Tool:

A) Muscles in the front of the thigh are contracting and muscles in the back of the thigh are relaxing

B) Muscles in the front of the lower leg are contracting and muscles in the back of the lower leg are relaxing

C) Muscles in the back of the thigh are contracting and muscles in the front of the thigh are relaxing

D) Muscles in the back of the lower leg are contracting and muscles in the front of the lower leg are relaxing

47 / 100

Category: Biology Ch 10 Class 12

Who developed a theory of natural selection essentially identical to Darwin’s?

PMC Sample 2
Biology
Evolution
Elimination Tool:

A) Hardy-Weinberg

B) Malthus

C) Lamark

D) Alfred Wallace

48 / 100

Category: Biology

The rate of photosynthesis and respiration may equal one another at what time?

NUMS Mock 4
Biology
Bioenergetics

A) Dawn

B) Noon

C) Dusk

D) Dawn and dusk

49 / 100

Category: Biology

Q.18 The internal buds are known as which of the following?

A. Spicules

B. Choanocytes

C. Gemmules

D. Both A and B

50 / 100

Category: Biology Ch 2 Class 12

Number of bones in the skull:

NUMS 2016
Biology
Support and Movement
Elimination Tool:

A) 22

B) 26

C) 24

D) 28

51 / 100

Category: Biology Ch 7 Class 12

In gametogenesis, which resultant product is non-functional?

NTS 2019
Biology
Cell Cycle
Elimination Tool:

A) Spermatogonia

B) Oogonia

C) Polar body

D) Ovum

52 / 100

Category: Biology Ch 3 Class 12

Type of neurons found exclusively in CNS are:

Sensory neurons

Motor neurons

Associative neurons

None of these

53 / 100

Category: Biology Ch 1 Class 12

Higher turgor pressure in a plant cell is maintained by:

Large number of vacoules in a plant cell.

Higher ionic concentration inside vacuoles resulting from active pumping of ions at their tonoplastic membrane

Higher osmotic pressure of the cell vacuole

both b and c

54 / 100

Category: Biology Ch 2 Class 11

A complex substance which on hydrolysis yields polyhydroxy aldehyde or ketone subunits is called:

Lipid

Carbohydrate

Protein

Carotein

55 / 100

Category: Biology Ch 9 Class 12

Some transgenic bacteria produce a dipeptide sweetener called

Ultrasweet

Disweet

Monosweet

Neutrasweet

56 / 100

Category: Biology Ch 7 Class 12

A special area of centromere with specific base arrangement and specific proteins where spindle fibers are attached is called

Chromatin

Aster

Kinetochore

Primary constriction

57 / 100

Category: Biology Ch 11 Class 11

Dark reaction of photosynthesis takes place in _______ of chloroplast.

NUMS 2020
Biology
Bioenergetics
Elimination Tool:

A) Thylakoids

B) Grana

C) Intergrana

D) Stroma

58 / 100

Category: Biology Ch 6 Class 11

Who discovered the bacteria causing tuberculosis and also developed various techniques of media preparation and maintenance of pure culture?

Robert Koch

Louis Pasteur

Alexander Fleming

Leeuwenhoek

59 / 100

Category: Biology Ch 11 Class 11

During the first three steps of glycolysis, glucose is converted to Fructose 1, 6-diphosphate by the rearrangement of the molecule and addition of two phosphate groups. The phosphate comes from?

NTS 2015 SMBBMC
Biology
Bioenergetics
Elimination Tool:

A) Phospholipids of the membrane

B) ADP

C) inorganic phosphates

D) ATP

60 / 100

Category: Biology

The autonomic nervous system controls all of the following activities except:

NUMS Mock 1
Biology
Coordination and Control

A) Digestion of food

B) Heart beat

C) Contraction of pupil of eye

D) Thought

61 / 100

Category: Biology Ch 12 Class 11

Certain types of whales are also ______ feeder.

Fluid

Macrophagous

Filter

None of these

62 / 100

Category: Biology Ch 10 Class 12

The ultimate source of all changes is:

NUMS 2015
Biology
Evolution
Elimination Tool:

A) Mutation

B) Migration

C) Genetic drift

D) Change in allele frequency

63 / 100

Category: Biology Ch 10 Class 12

Homology means

PMC Sample 3
Biology
Evolution
Elimination Tool:

A) similiarity in characteristics resulting from common ancestors

B) similarity in function from acquired characterists

C) study of different ograns but with similar functions

D) study of similar ograns but with different functions

64 / 100

Category: Biology Ch 5 Class 12

Thyroxine deficiency in adults’ results in a condition called:

UHS 2015
Biology
Growth and Development
Elimination Tool:

A) Cretinism

B) Hypothyroidism

C) Thyrotoximia

D) Myxoedema

65 / 100

Category: Biology

Q.27 In the process of esterification OH is derived from?

A. Ether

B. Alcohol

C. Water

D. Both A and B

66 / 100

Category: Biology Ch 9 Class 12

Gel electrophoresis is a technique:

PMC 2020
Biology
Biotechnology
Elimination Tool:

A) Employed by forensic scientist to assist in the identification of the individuals by their respective type of DNA

B) Collect all the genes found in one complete set of chromosome

C) Is a technique to separate different sizeds fragment of charge bearing polymers (proteins, RNA or DNA)

D) Grows single cell or a group of cells in a glass ware on artificial medium under aseptic conditions

67 / 100

Category: Biology Ch 9 Class 11

The term which is not related to the process of evolution of leaf is:

NUMS 2020
Biology
Kingdom Plantae
Elimination Tool:

A) Overtopping

B) Planation

C) Heterospory

D) Fusion / webbing

68 / 100

Category: Biology Ch 10 Class 11

Archaeopteryx is a transitional stage between the members of which one of the following pairs?

NTS 2013
Biology
Kingdom Animalia
Elimination Tool:

A) Amphibian … bird

B) Fish … amphibian

C) Reptile … mammal

D) Reptile … bird

69 / 100

Category: Biology Ch 3 Class 11

The type of energy, reduced by the enzymes, for biological reactions to occur is called the:

UHS 2019
Biology
Enzymes
Elimination Tool:

A) Light Energy

B) Heat energy

C) Active energy

D) Activation energy

70 / 100

Category: Biology Ch 7 Class 11

Which of the following bacteria are able to release oxygen into the environment?

NTS 2018
Biology
Kingdom Protista
Elimination Tool:

A) Saprotrophic bacteria

B) Parasitic bacteria

C) Cyanobacteria

D) Pathogenic bacteria

71 / 100

Category: Biology Ch 6 Class 12

Haploid and monoploid numbers of chromosomes of hexaploid wheat are:

NTS 2014
Biology
Chromosomes and DNA
Elimination Tool:

A) 21 and 42

B) 7 and 21

C) 21 and 7

D) 42 and 21

72 / 100

Category: Biology Ch 4 Class 12

Egg-laying mammals are called:

NUMS 2016
Biology
Reproduction
Elimination Tool:

A) Prototheria

B) Protozoa

C) Chordata

D) Monotremes

E) Both A and D

73 / 100

Category: Biology Ch 8 Class 12

Which of the following is monohybrid cross

TT x tt

TTYy x Ttyy

Both of these

None of these

74 / 100

Category: Biology Ch 8 Class 11

In rhizopus, zygote forms temporary, dormant, thick-walled resistant structure called:

UHS 2015
Biology
Kingdom Fungi
Elimination Tool:

A) Zygospore

B) Spore

D) Hydra

C) Sporangia

75 / 100

Category: Biology Ch 7 Class 12

How does the second meiotic division differ from mitosis? In the second meiotic division:

NTS 2015 SMBBMC
Biology
Cell Cycle
Elimination Tool:

A) Chiasmata Formed between the chromatids of a bivalent

B) Each chromosome replicates to form two chromatids during metaphase

C) The separating chromatids of a pair differ genetically

D) None of the above

76 / 100

Category: Biology Ch 2 Class 11

Water acts as a universal solvent because of:

PMC 2020
Biology
Biological Molecules
Elimination Tool:

A) Heat of vaporization

B) Hydrogen bonding

C) High polarity

D) Cohesion and adhesion

77 / 100

Category: Biology

Q.34 What molecule would you not expect to find in a refrovirus

A. Adenine

B. Thymine

C. Uracil

D Guanine

78 / 100

Category: Biology Ch 14 Class 11

The lymph vessels empty in:

NUMS 2015
Biology
Transport
Elimination Tool:

A) Arteries

B) Veins

C) Capillaries

D) None of the given options

79 / 100

Category: Biology Ch 5 Class 11

Chicken pox is caused by:

NTS 2011
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Hepatitis A virus

B) Varicella zoster virus

C) Influenza virus

D) Human immunodeficiency virus

80 / 100

Category: Biology Ch 9 Class 12

Which of the following is the manipulation of genetic material for practical purposes?

NTS 2018
Biology
Biotechnology
Elimination Tool:

A) Grafting

B) Tissue Culture

C) Genetic Engineering

D) Cell Culture

81 / 100

Category: Biology Ch 14 Class 11

The massive accumulation of blood with is a tissue is called as:

NTS 2011
Biology
Transport
Elimination Tool:

A) Haemorrhage

C) Hepatoma

B) Haematoma

D) Haemocoel

82 / 100

Category: Biology

Q45 Which was the first virus to be successfully crystalized?

A. TMV

B. Smallpox

C. Poliovirus

D. Adenovirus

83 / 100

Category: Biology Ch 6 Class 11

A type of bacterial cell that is completely surrounded by flagella is called:

PMC Practice 5
Biology
Kingdom Prokaryote
Elimination Tool:

A) Diplococcus

B) Tetrad

C) Peritrichous

D) Munotrichous

84 / 100

Category: Biology

In cross-section each Centriole consist of nine (each in triplets) of:

NUMS Mock 2
Biology
Cell Structure and Function

A) Microfilaments

B) Microvilli

C) Microtubules

D) Intermediate filaments

85 / 100

Category: Biology Ch 6 Class 12

Phenotype is:

PMC 2020
Biology
Chromosomes and DNA
Elimination Tool:

A) The genetic component i.e. the genes in an individual for a particular trait

B) Partner of gene pair

C) The form of appearance of a trait

D) The position of a gene on the chromosome

86 / 100

Category: Biology

Q.25 For respiratory metabolism, bacterial cell membrane contains

A. Proteins

B. Lipids

C.Enzymes

D. Chemicals

87 / 100

Category: Biology Ch 14 Class 11

The cells which play a very important role in developing immunity are:

PMC 2020
Biology
Transport
Elimination Tool:

A) Monocytes

B) Neutrophils

C) Lymphocytes

D) Thrombocytes

88 / 100

Category: Biology Ch 7 Class 12

Which statement is incorrect?

In human, cell cycle is about 24 hrs

Mitosis takes 30 min

G2 5.5 hrs

Yeast cell only 90 min

89 / 100

Category: Biology Ch 4 Class 12

Which statement is incorrect?

In short day plants red light prevents flowering

Henbane is a short day plant

In long day plants for red light promotes flowering

Leaf unrolling occurs in grasses

90 / 100

Category: Biology

Q.32 In the ascent of sap, water moves up in:

A. Xylem

B. Cambium

C. Phloem

D. Endodermis

91 / 100

Category: Biology Ch 2 Class 11

Which of the following has the ability to develop ester linkage with OH group of Pentose sugar?

NUMS 2019 Reconduct
Biology
Biological Molecules
Elimination Tool:

A) Purine

B) Pyrimidine

C) H3PO4

D) HNO3

92 / 100

Category: Biology

Q.9 This is a reduced compound

A. CO2

B. O2

C. NADH

D. NAD

93 / 100

Category: Biology Ch 10 Class 11

Class Elasmobranchi have an outer covering of?

NTS 2015 DUHS and JSMU
Biology
Kingdom Animalia
Elimination Tool:

A) Placoid scale

B) Cycloid

C) Ctenoid scales

D) Epidermal scales

94 / 100

Category: Biology Ch 10 Class 12

A group of interbreeding individuals belonging to a particular species and sharing a common geopraphic area is called?

PMC Sample 1
Biology
Evolution
Elimination Tool:

A) community

B) family

C) race

D) population

95 / 100

Category: Biology Ch 3 Class 11

If another molecule, having a shape very similar to the enzymes substrate, binds to its active site, it would then ____ the enzyme’s function:

NUMS 2020
Biology
Enzymes
Elimination Tool:

A) Fasten

B) Inhibit

C) Reverse

D) Decrease

96 / 100

Category: Biology Ch 4 Class 12

Only one ovary is functional at a time in:

NUMS 2015
Biology
Reproduction
Elimination Tool:

A) Human

B) Eagle

C) Chicken

D) Pigeon and human

97 / 100

Category: Biology Ch 2 Class 12

Skeleton of arms and legs is:

NUMS 2018
Biology
Support and Movement
Elimination Tool:

A) Exoskeleton

B) Endoskeleton

C) Axial skeleton

D) Appendicular skeleton

98 / 100

Category: Biology Ch 7 Class 11

Which part of bacteria is most delicate and damage to it can kill the bacteria?

PMC 2021 Tested
Biology
Kingdom Protista
Elimination Tool:

A) Cell wall

B) Slime

C) Capsule

D) Cell membrane

99 / 100

Category: Biology Ch 8 Class 11

Oyster mushroom is an example of predator fungi which attack on

Pin warms

Tape worms

Round worms

Platehelminthes

100 / 100

Category: Biology Ch 6 Class 12

Bacteria were grown in a medium containing heavy isotope of nitrogen (N15) for many generations and all their DNA contained many heavy nitrogen only. A bacterium of this type was transferred to normal medium and allowed to duplicate. After two divisions of heavy DNA is likely to be that:

NTS 2012
Biology
Chromosomes and DNA
Elimination Tool:

A) Only one daughter cell will have heavy DNA

B) Two daughter cells have normal DNA and other two have heavy DNA

C) All daughter cells have heavy DNA

D) Half daughter cells have heavy DNA and other half have normal DNA

Your score is

The average score is 57%

Structured Practice for Best Entry Test Preparation

This topic-wise and chapter-wise practice test allows students to focus on individual biology concepts, including diagrams, processes, and conceptual questions. Regular practice enhances understanding, sharpens problem-solving skills, and builds confidence to tackle both board and competitive exam questions efficiently.

Free Resources for Best Entry Test Preparation

Students can access free Biology Practice Test 2 to systematically improve knowledge, recall, and problem-solving abilities. This test is suitable for FSC Board Exams as well as major entry tests, helping students perform better in the biology section. PLS Academy provides these resources to support students in their preparation.

JazakAllah