Biology Practice Test 2

Biology Practice Test 2 is designed to help students strengthen their understanding of key biological concepts, theories, and processes for competitive entry tests like MDCAT, NUMS, AKU, UET, ECAT, NTS, as well as FSC Board Exams. This test covers topics from molecular biology, cell division, human physiology, plant physiology, and more, helping students improve accuracy and retention.

PLS Academy

Get Access to 20 thousands+ MCQs Including Topical MCQs, Practice Tests, Mock Tests, Solved Past Papers, Flashcards, Notes, FLPS, and Much More.

UNLOCK PREMIUM🔐

2519

Created by Ali Durrani

MDCAT Practice Tests

Biology Practice Test 2

This is the Free Access to Limited MCQs. Enroll to PLS Boost Premium Bundle to Get More MCQs HERE

1 / 100

Category: Biology Ch 3 Class 11

The effect of competitive inhibitor on enzyme activity is such that it affects which of the following?

PMC Sample 2
Biology
Enzymes
Elimination Tool:

A) Increases enzyme activity

B) Doesn't change enzyme activity

C) Decreases enzyme activity

D) None of these options is correct

2 / 100

Category: Biology Ch 5 Class 11

Which of the following is NOT TRUE about Human Immunodeficiency virus (HIV)?

PMC 2020
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) It is a retrovirus

B) It is surrounded by an envelope

C) It does not cause AIDS

D) It causes deficiency of the human immune system

3 / 100

Category: Biology Ch 2 Class 12

Tendon is made up of:

NUMS 2014
Biology
Support and Movement
Elimination Tool:

A) Yellow fibrous connective tissue

B) Modified white fibrous tissue

C) Areolar tissue

D) Adipose tissue

4 / 100

Category: Biology Ch 7 Class 12

Gametes in animals are produced by which of the following?

PMC Practice 2
Biology
Cell Cycle
Elimination Tool:

A) Mitosis

B) Meiosis

C) Fission

D) All of these options are correct

5 / 100

Category: Biology Ch 11 Class 11

Immediate source of energy for cellular respiration is:

NUMS 2016
Biology
Bioenergetics
Elimination Tool:

A) Lipids

B) ATP

C) Proteins

D) Carbohydrates

6 / 100

Category: Biology

Q.60 The part of spinal cord where interneurons present is called:

A. White matter

B. Gray mater

C. lumbar enlargement

D. cervical enlargement

7 / 100

Category: Biology Ch 3 Class 12

Chlorosis, i.e., yellowish hue on the leaves results from

Accumulation of toxic waste products in leaves.

Deficiency of chlorophyll.

Short supplies of mineral nutrients in the soil

All of these

8 / 100

Category: Biology Ch 10 Class 11

Which group of organisms has the following features?

I. three pairs of jointed legs

II. three-part segmented body

III. one pair of antennae

NTS 2017
Biology
Kingdom Animalia
Elimination Tool:

A) arachnids

B) crustaceans

C) Insects

D) myriapods

9 / 100

Category: Biology Ch 5 Class 11

Virus is a _____ entity among living and non-living.

PMC Sample 2
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Balanced

B) Transitional

C) Threshold

D) None of these options is correct

10 / 100

Category: Biology Ch 3 Class 11

Which one forms the raw material for coenzymes?

Vitamins

Carbohydrates

Proteins

Metals

11 / 100

Category: Biology Ch 6 Class 11

The DNA of the bacterium is present in a distinct region called:

NUMS 2017
Biology
Kingdom Prokaryote
Elimination Tool:

A) Nucleolus

B) Centrosome

C) Nucleoid

D) Nucleus

12 / 100

Category: Biology Ch 6 Class 11

Tuberculosis is caused by?

NTS 2015 SMBBMC
Biology
Kingdom Prokaryote
Elimination Tool:

A) Bacterium

B) Allergy

C) Nicotine

D) Virus

13 / 100

Category: Biology Ch 12 Class 11

Which type of mucosa cells secrete pepsinogen?

NUMS 2014
Biology
Nutrition
Elimination Tool:

A) Zymogen

B) Oxyntic

C) Mucous

D) Gastric

14 / 100

Category: Biology Ch 9 Class 12

Cystic fibrosis patients lack a gene that codes for a transmembrane carrier of:

NTS 2017
Biology
Biotechnology
Elimination Tool:

A) Na+ ions

B) K+ ions

C) CI- ions

D) Ca2+ ions

15 / 100

Category: Biology Ch 12 Class 11

Midgut in cockroach is a short narrow tube called

Hepatic caeca

Gizzard

Stomach

Rectum

16 / 100

Category: Biology Ch 1 Class 12

Which of the following structure in plant’s body is called excretophores?

Stem

Leaves

Flowers

Roots

17 / 100

Category: Biology Ch 4 Class 11

_______ organelles are involved in the synthesis of the plant cell wall.

NUMS 2020
Biology
Cell Structure and Function
Elimination Tool:

A) Endoplasmic reticulum

B) Golgi complex

C) Lysosomes

D) Peroxisomes

18 / 100

Category: Biology

Q.66 Which one of the following is a non-protein group covalently bonded to a few respiratory enzymes among others?

A. Nicotine adenine dinucleotide

B. Flavin adenine dinucleotide

C. Nicotinamide adenine dinucleotide phosphate

D. All of the above

19 / 100

Category: Biology Ch 6 Class 11

The size of Spirochete is

0.1 -600 um

100-200 nm

500 um

0.75-1.25 um

20 / 100

Category: Biology Ch 7 Class 12

In gametogenesis, which resultant product is non-functional?

NTS 2019
Biology
Cell Cycle
Elimination Tool:

A) Spermatogonia

B) Oogonia

C) Polar body

D) Ovum

21 / 100

Category: Biology

Q.30 Arterial blood contains ___________of CO2/100 ml of blood:

22 / 100

Category: Biology Ch 9 Class 11

Which type of leucoplasts store lipids?

NUMS 2020
Biology
Kingdom Plantae
Elimination Tool:

A) Amyloplast

B) Elaioplast

C) Proteinoplast

D) Etioplast

23 / 100

Category: Biology Ch 8 Class 11

Those fungi which can grow only on their living host and cannot be grown on available defined growth culture medium e.g. various mildews and most rust species are called?

PMC Sample 2
Biology
Kingdom Fungi
Elimination Tool:

A) Parasitic fungi

B) Facultative parasitic fungi

C) Obligate parasitic fungi

D) all of these

24 / 100

Category: Biology Ch 10 Class 12

On Galapagos island, among the birds, ____ caught much attention of Darwin in formulating his work, related to adaptations.

NUMS 2019 Reconduct
Biology
Evolution
Elimination Tool:

A) Pigeons

B) Ravens

C) Finches

D) Parrots

25 / 100

Category: Biology Ch 8 Class 12

If a heterozygous individual shows the complete effect of both alleles, the type of inheritance would be

Complete dominance

Non dominance

Incomplete dominance

Co-Dominance

26 / 100

Category: Biology

Q.65 How are flat worms not similar to round worms?

A. They are both acoelomates

B. They are both triploblastic.

C. They both show bilateral symmetry.

D. They are both worms.

27 / 100

Category: Biology Ch 8 Class 12

Mendel concluded that each organism has two hereditary factors for each trait, now called:

NTS 2015 SMBBMC
Biology
Variation and Genetics
Elimination Tool:

A) Chromatids

B) Alleles

C) Chromosomes

D) None of the above

28 / 100

Category: Biology Ch 3 Class 11

Enzymes work by which of the following?

PMC Practice 1
Biology
Enzymes
Elimination Tool:

A) Increasing the activation energy

B) Reducing the activation energy

C) Making exergonic reactions endergonic

D) Making endergonic reactions exergonic

29 / 100

Category: Biology Ch 5 Class 12

The only promoter of leaf senescence in the following plant hormones is?

PMC Sample 3
Biology
Growth and Development
Elimination Tool:

A) gibberellins

B) cytokinins

C) auxins

D) abscisic acid

30 / 100

Category: Biology Ch 7 Class 11

Of the following which one has glassy shells?

Radiolarians

Forams

Both of these

None of these

31 / 100

Category: Biology

What type of virus is the smallpox virus?

NUMS Mock 1
Biology
Bio-diversity | Variety of Life

A) DNA enveloped virus

B) RNA enveloped virus

C) DNA virus

D) RNA naked virus

32 / 100

Category: Biology Ch 10 Class 12

Modification in the organization of the basic pentadactyl limb structure found in vertebrates provides good evidence for the principle of:

NUMS 2020
Biology
Evolution
Elimination Tool:

A) Adaptive radiation

B) Convergent evolution

C) Genetic drift

D) Inheritance of acquired characters

33 / 100

Category: Biology Ch 11 Class 11

Exposure to ______ light is effective in photosynthesis as it enables guard cells to take up K+ and opening of stomata.

NUMS 2019 Reconduct
Biology
Bioenergetics
Elimination Tool:

A) Red

B) Blue

C) Green

D) Orange

34 / 100

Category: Biology Ch 8 Class 12

Haemophilia occurs because of:

PMC 2020
Biology
Variation and Genetics
Elimination Tool:

A) Mutation in an autosome

B) Mutation of Y-chromosome

C) Mutation of X-chromosome

D) Deficiency of iron

35 / 100

Category: Biology

The rate of photosynthesis and respiration may equal one another at what time?

NUMS Mock 4
Biology
Bioenergetics

A) Dawn

B) Noon

C) Dusk

D) Dawn and dusk

36 / 100

Category: Biology Ch 3 Class 11

The structure of an enzyme is altered by:

Irreversible inhibitor

Reversible inhibitor

Competitive inhibitor

Non-competitive inhibitor

37 / 100

Category: Biology

The system responsible for fighting the pathogens is:

NUMS Mock 4
Biology
Transport

A) Muscular System

B) Endocrine System

C) Nervous System

D) Immune System

38 / 100

Category: Biology

Optimum pH for action of pepsin and salivary amylase is

NUMS Mock 2
Biology
Nutrition

A) 3.5 and 7.7 respectively

B) 1.8 and 6.8 respectively

C) 6.8 and 7.4 respectively

D) 1.8 and 7.4 respectively

39 / 100

Category: Biology Ch 4 Class 12

Example of ovoviviparous

Reptiles

Mammal s

Duckbill platypus

Frog

40 / 100

Category: Biology Ch 10 Class 12

Mating with non-relatives is known as?

PMC Sample 2
Biology
Evolution
Elimination Tool:

A) Inbreeding

B) Outbreeding

C) Breeding

D) None of these options is correct

41 / 100

Category: Biology Ch 4 Class 12

In biennials and perennials, low temperature stimulus is not received by

Shoot apex of mature stem

Embryo of the seed

Leaves of the plants

None of the above

42 / 100

Category: Biology Ch 8 Class 12

A monohybrid cross yielded 3:1 in F2. What could be mode of inheritance?

Segregation

Independent assortment

Both of these

None of these

43 / 100

Category: Biology Ch 9 Class 12

In the commercial manufacture of insulin, a human gene is inserted into which one of the following?

NTS 2013
Biology
Biotechnology
Elimination Tool:

A) A chromosome of a human cell

B) A protein molecule in a yeast cell

C) The DNA of a bacterium

D) The nucleic acid in a virus

44 / 100

Category: Biology

Among the following, which cellular organelle contains circular DNA, similar to those found in bacteria?

NUMS Mock 1
Biology
Cell Structure and Function

A) Lysosome

B) Nucleus

C) Nucleosome

D) Mitochondria

45 / 100

Category: Biology Ch 7 Class 12

Chance of a cross over between two loci is directly proportional to their

UHS 2018
Biology
Cell Cycle
Elimination Tool:

A) Thickens

B) Width

C) Length

D) Distance

46 / 100

Category: Biology Ch 11 Class 11

FADH2 is produced during which step of Krebs cycle?

NUMS 2015
Biology
Bioenergetics
Elimination Tool:

A) When Isocitrate is converted into alpha – ketoglutarate

B) When alpha – Ketogluterate is converted into Succinate

C) When Succinate is converted into Fumarate

D) When Fumarate is converted into Maltose

47 / 100

Category: Biology Ch 6 Class 11

Some bacteria ranging occasionally a size of 500 ?m in length are

Escherichia coli

Spirochetes

Mycoplasma

Epulopiscuim

48 / 100

Category: Biology Ch 8 Class 12

The trait “Kernel colour in corn” in controlled by how many pairs of genes

One pair

Two pairs

Three pairs

Many pairs

49 / 100

Category: Biology Ch 4 Class 12

Referring to sexual reproduction, humans are:

NTS 2018
Biology
Reproduction
Elimination Tool:

A) Hermaphrodites

B) Vivaparous

C) Oviparous

D) Self-fertilized

50 / 100

Category: Biology Ch 7 Class 12

Which statement is incorrect?

In human, cell cycle is about 24 hrs

Mitosis takes 30 min

G2 5.5 hrs

Yeast cell only 90 min

51 / 100

Category: Biology

Most enzymes have an optimum temperature of around:

NUMS Mock 4
Biology
Enzymes

A) 30 C

B) 40 C

C) 50 C

D) 20 C

52 / 100

Category: Biology Ch 3 Class 12

All of the following hormones are secreted from anterior lobe of pituitary gland BUT:

NUMS 2019 Reconduct
Biology
Coordination and Control
Elimination Tool:

A) Somatotropin hormone

B) Thyroid stimulating hormone

C) Antidiuretic hormone

D) Gonadotrophic hormone

53 / 100

Category: Biology Ch 5 Class 11

The shape of the tobacco mosaic virus is:

NUMS 2016
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Spring shape

B) Rod shape

C) Comma shape

D) Spherical shape

54 / 100

Category: Biology Ch 3 Class 12

Hepatic and Pancreatic secretions are also stimulated by a hormone called:

NUMS 2016
Biology
Coordination and Control
Elimination Tool:

A) Gastrin

B) Secretin

C) Insulin

D) Glucagon

55 / 100

Category: Biology Ch 9 Class 11

Which one of the following is not in the group of Gymnosperm?

NTS 2012
Biology
Kingdom Plantae
Elimination Tool:

A) Cycads

B) Gingko

C) Gnetae

E) Musci

56 / 100

Category: Biology Ch 8 Class 12

The law of dominance is illustrated in the garden pea by:

NTS 2010
Biology
Variation and Genetics
Elimination Tool:

B) Heterozygous tall x heterozygous tall

C) Homozygous tall x homozygous tall

D) Pure short x pure short

E) Homozygous tall x pure short

57 / 100

Category: Biology

Q.27 During which of the following levels of biological organization can natural selection occur?

A. Gene

B. Individual

C. Group

D. All of these

58 / 100

Category: Biology

Pick the correct option about Drosophila.

NUMS Mock 3
Biology
Variation and Genetics

A) The Male is larger with a pointed abdomen

B) The female has sex combs on its front legs

C) It has a generation time of just eight weeks

D) Salivary gland cells have giant chromosomes in their nuclei

59 / 100

Category: Biology

Q.32 Lymphocytes are found in:

A. Lymph capillary

B. Lymph vessel

C. Lymph trunk

D. lymph node

60 / 100

Category: Biology

The autonomic nervous system controls all of the following activities except:

NUMS Mock 1
Biology
Coordination and Control

A) Digestion of food

B) Heart beat

C) Contraction of pupil of eye

D) Thought

61 / 100

Category: Biology

Q.59 NADH produced during glycolysis and Krebs cycle will oxidized by:

A. Coenzyme ‘Q’

B. Cytochrome ‘c’

C. Cytochrome ‘b’

D. Cytochrome ‘a’

62 / 100

Category: Biology Ch 8 Class 12

The position of a gene on chromosome is called

Habitat

Position

Locus

Location

63 / 100

Category: Biology Ch 4 Class 11

Which of the following is NOT the function of cell membranes?

NTS 2018
Biology
Cell Structure and Function
Elimination Tool:

A) Protection of cytoplasm

B) Regulating the passage of different molecules

C) Protein synthesis

D) Cellular communication

64 / 100

Category: Biology Ch 4 Class 11

Autophagosomes are

Those lysosomes which eat parts of their own cells to generate energy.

Those lysosomes which eat old and worn out cellular organelles.

Lysosomes which help in extracellular digestion

Both a and b

65 / 100

Category: Biology Ch 10 Class 11

The function of coelom is

To increase the size of the animals

To help in the functioning of reproductive system

To provide space for the development of organs and systems

None of these

66 / 100

Category: Biology Ch 14 Class 11

Choose the correct pathway for the flow of blood:

NUMS 2020
Biology
Transport
Elimination Tool:

A) Arterioles → metarterioles → capillaries → thoroughfare channels

B) Arterioles → thoroughfare channel → metarterioles → capillaries

C) Thoroughfare channel → arterioles → capillaries → metarterioles

D) Metarterioles → arterioles → thoroughfare channels → capillaries

67 / 100

Category: Biology Ch 11 Class 11

Carbon dioxide joins the photosynthetic pathway at:

NTS 2018
Biology
Bioenergetics
Elimination Tool:

A) PSI

B) PSII

C) Light reaction

D) Dark reaction

68 / 100

Category: Biology

Which of the following basic structural level of proteins is indicated by an association of two alpha and two beta chains in the haemoglobin molecule?

NUMS Mock 2
Biology
Biological Molecules

A) Primary structure

B) Secondary structure

C) Tertiary structure

D) Quatenary Structure

69 / 100

Category: Biology Ch 2 Class 12

The number of muscles in a human body is about:

NTS 2012
Biology
Support and Movement
Elimination Tool:

A) 200

B) 300

C) 400

E) 600

70 / 100

Category: Biology Ch 8 Class 12

Baldness is most frequent in

Men

Women

Children

Girls

71 / 100

Category: Biology Ch 10 Class 11

Coelom that develops from the archenteron as outpouching is

Pseudocoelom

Enterocoelom

Schizocoelom

None of these

72 / 100

Category: Biology

Q.23 During inspiration, the diaphragm:

A. Contracts

B. Relaxes

C. Contracts and relaxes

D. None of these

73 / 100

Category: Biology Ch 4 Class 11

Which property of water helps to maintain the integrity of lipid-containing membranes?

PMC 2020
Biology
Cell Structure and Function
Elimination Tool:

A) Specific Heat Capacity

B) Hydrogen Bonding

C) Cohesion and Adhesion

D) Hydrophobic exclusion

74 / 100

Category: Biology Ch 4 Class 12

Only one ovary is functional at a time in:

NUMS 2015
Biology
Reproduction
Elimination Tool:

A) Human

B) Eagle

C) Chicken

D) Pigeon and human

75 / 100

Category: Biology Ch 4 Class 11

Magnifying power of electron microscope as compared to eye is

500 X

250000X

500000X

250X

76 / 100

Category: Biology Ch 11 Class 11

Photosynthesis is process in which ________ compounds of carbon (CO2) and hydrogen (H2O) are reduced to carbohydrate like (glucose) using light energy.

Organic

Energy rich

Energy poor

Reduced

77 / 100

Category: Biology

5 different amino acids, numbered 1, 2, 3, 4, and 5, below from the following sequence in the path of a polypeptide chain:

1-2-3-4-2-5-3

Messenger RNA codon, which correspond to the amino acids, are:
amino acid 1 UGU

amino acid 2 GAU

amino acid 3 CAC

amino acid 4 UAG

amino acid 5 AAG

Which one of the following DNA bases sequences could provide the code for the given section of the polypeptide?

NUMS Mock 2
Biology
Biological Molecules

A) ACACTTGTGATGCTATTCGTG

B) ACACUAGUGAUGCUAUUCGUG

C) ACACTAGTGATGCTAAACGTG

D) ACACTAGTGATCCTATTCGTG

78 / 100

Category: Biology

Erythroblastosis foetalis occurs when:

NUMS Mock 2
Biology
Variation and Genetics

A) Mother is Rh-positive and baby is Rh-negative

B) Mother is Rh-negative and the baby is Rh-positive

C) Both mother and baby are Rh-negative

D) Both mother and baby are Rh-positive

79 / 100

Category: Biology Ch 6 Class 11

When was the bacteriophage phenomena rediscovered by D’Herelle?

PMC Practice 4
Biology
Kingdom Prokaryote
Elimination Tool:

B) 1917

A) 1918

C) 1920

D) 1990

80 / 100

Category: Biology Ch 13 Class 11

Breathing is considered as a:

PMC Practice 1
Biology
Gaseous Exchange
Elimination Tool:

A) Chemical process

B) Biochemical process

C) Mechanical process

D) Both A and B

81 / 100

Category: Biology Ch 5 Class 12

Germ layers are formed in which stage of development?

NUMS 2020
Biology
Growth and Development
Elimination Tool:

A) Morulation

B) Blastulation

C) Gastrulation

D) Organogenesis

82 / 100

Category: Biology Ch 3 Class 11

A chemical substance which can react (in place of substrate) with the enzyme but is not transformed into product/s and thus blocks the active site temporarily or permanently is called

Co-enzyme

Blocker

Inhibitor

Cofactor

83 / 100

Category: Biology Ch 2 Class 11

Cell wall is made up of:

NUMS 2016
Biology
Biological Molecules
Elimination Tool:

A) Cellulose

B) Cell

C) Ribosomes

D) Penicillin binding protein

84 / 100

Category: Biology Ch 6 Class 12

Central dogma is

Transfer of information from DNA to mRNA

Basic mechanism of reading and expressing genes

Transfer of information from RNA to proteins

Synthesis of all three types of RNA

85 / 100

Category: Biology Ch 3 Class 12

Which of the following is not the function of the cerebrum?

NUMS 2016
Biology
Coordination and Control
Elimination Tool:

A) Voluntary digestion

B) Thinking

C) Intelligence

D) Skeletal muscles

86 / 100

Category: Biology Ch 14 Class 11

Which of the following is NOT a part of the immune system?

NTS 2018
Biology
Transport
Elimination Tool:

A) Phagocytes

B) Complement Proteins

C) Cytokines

D) Atherosclerosis

87 / 100

Category: Biology Ch 4 Class 11

Which of the following cells does not have nucleus?

NUMS 2020
Biology
Cell Structure and Function
Elimination Tool:

A) Muscle cell

B) Nerve cell

C) White Blood cell

D) Red Blood cell

88 / 100

Category: Biology Ch 4 Class 11

What is the role of cholesterol in the cell membrane?

NUMS 2020
Biology
Cell Structure and Function
Elimination Tool:

A) it functions in joining adjacent cells together.

B) It functions in recognizing foreign cells.

C) It increases the rate of transport of ions across the membrane.

D) It stabilizes the cell membrane.

89 / 100

Category: Biology Ch 4 Class 11

Strengthening material of prokaryotic cell wall is

Cellulose

Chitin

Inorganic salts silica waxes and ligin

Peptidoglycan or Murein.

90 / 100

Category: Biology

Q.52 The plasma pool of antibodies is synthesized from:

A. T- lymphocytes

B. Plasma cells

C. B- lymphocytes

D. Fibroblasts

91 / 100

Category: Biology Ch 5 Class 11

Viral disease that is widely spread and caused by enveloped RNA virus is:

NUMS 2015
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) AIDS

B) Hepatitis

C) Measles

D) Influenza

92 / 100

Category: Biology Ch 12 Class 12

End of earth’ is related to

Tropical rain forest

Temperate deciduous forest

Savanna

Tundra

93 / 100

Category: Biology

Hemoglobin carries more oxygen than plasma by:

NUMS Mock 1
Biology
Gaseous Exchange

A) 50 times

B) 20 times

C) 70 times

D) 100 times

94 / 100

Category: Biology Ch 5 Class 11

Five steps of the lytic cycle of a T4 stage are given below:

The T4 phage uses its tails to stick to specific receptor
The cell’s metabolic machinery, directed by phage DNA, produces phage proteins and nucleotides from the cells degraded DNA are used to make copies of the phage genome.
The phage then directs production of an enzyme that digests the cell.
The empty capsid of the phage is left as a ghost outside the cell
The sheath of the tail contracts, thrusting a hollow core through the wall and membrane of the cell.
Which of the following is the correct sequence of the cycle?

NTS 2015 SMBBMC
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) 3-5-4-2-1

B) 2-4-5-1-3

C) 5-1-4-2-3

D) 1-5-4-2-3

95 / 100

Category: Biology Ch 5 Class 11

The size of poxvirus is:

20 nm

200 nm

250 nm

300 nm

96 / 100

Category: Biology

The hormone which controls the uptake of Sodium ions in kidney and its maintenance in blood plasma is:

NUMS Mock 2
Biology
Coordination and Control

A) Somatotrophic Hormone

B) Aldosterone Hormone

C) Gonadotrophic Hormone

D) Thyroxine Hormone

97 / 100

Category: Biology

The smaller (40S) of ribosome combines with larger subunit (60S) in the presence of Mg2+ ion to form _____ particle.

NUMS Mock 3
Biology
Cell Structure and Function

A) 100 S

B) 90 S

C) 80 S

D) 70 S

98 / 100

Category: Biology

Which vertebrae together are called pelvic vertebrae?

NUMS Mock 2
Biology
Support and Movement

A) Coccygeal and lumbar

B) Sacral and lumbar

C) Sacral and coccygeal

D) Sacral and thoracic

99 / 100

Category: Biology Ch 6 Class 12

A fern has _____ pairs of chromosomes.

NTS 2012
Biology
Chromosomes and DNA
Elimination Tool:

A) 23

B) 40

C) 500

D) 13

100 / 100

Category: Biology Ch 13 Class 12

Endangered species are

Dangerous for the life of humans

Reduced in number

Already extinct

All of these

Your score is

The average score is 57%

Structured Practice for Best Entry Test Preparation

This topic-wise and chapter-wise practice test allows students to focus on individual biology concepts, including diagrams, processes, and conceptual questions. Regular practice enhances understanding, sharpens problem-solving skills, and builds confidence to tackle both board and competitive exam questions efficiently.

Free Resources for Best Entry Test Preparation

Students can access free Biology Practice Test 2 to systematically improve knowledge, recall, and problem-solving abilities. This test is suitable for FSC Board Exams as well as major entry tests, helping students perform better in the biology section. PLS Academy provides these resources to support students in their preparation.

JazakAllah