Biology Practice Test 2

Biology Practice Test 2 is designed to help students strengthen their understanding of key biological concepts, theories, and processes for competitive entry tests like MDCAT, NUMS, AKU, UET, ECAT, NTS, as well as FSC Board Exams. This test covers topics from molecular biology, cell division, human physiology, plant physiology, and more, helping students improve accuracy and retention.

PLS Academy

Get Access to 20 thousands+ MCQs Including Topical MCQs, Practice Tests, Mock Tests, Solved Past Papers, Flashcards, Notes, FLPS, and Much More.

UNLOCK PREMIUM🔐

2514

Created by Ali Durrani

MDCAT Practice Tests

Biology Practice Test 2

This is the Free Access to Limited MCQs. Enroll to PLS Boost Premium Bundle to Get More MCQs HERE

1 / 100

Category: Biology Ch 9 Class 12

In prokaryotes only one type of RNA polymerase is present, while ______ types of RNA polymerase are present in eukaryotes.

NUMS 2019 Reconduct
Biology
Biotechnology
Elimination Tool:

A) Two

B) Three

C) Four

D) Five

2 / 100

Category: Biology Ch 9 Class 12

Organisms that have had a foreign gene inserted into them are

Transformed organisms

Transgenic organisms

Transfigured organisms

Recombinant organisms

3 / 100

Category: Biology Ch 3 Class 11

If more substrate to already occurring enzymatic reaction is added more enzyme activity is seen because:

There is probably more substrate present than there is enzyme.

There is probably more enzayme available than there is substrate.

There is probably more product present than there is either substrate or enzyme.

The enzyme substrate complex is probably failing to form during the reaction.

4 / 100

Category: Biology Ch 9 Class 12

The DNA that has been altered and which now contains length of nucleotides from two different organisms is called a:

PMC 2020
Biology
Biotechnology
Elimination Tool:

A) Plasmid

B) Combined DNA

C) Vector

D) Recombinant DNA

5 / 100

Category: Biology

Which of the following is correct in humans?

NUMS Mock 1
Biology
Reproduction

A) Both sperm and egg contain yolk

B) All genetic information comes from sperm

C) Sperm contains little cytoplasm

D) Fertilization commonly occurs in the uterus

6 / 100

Category: Biology Ch 14 Class 11

The valve between right atrium and right ventricle is called:

NUMS 2014
Biology
Transport
Elimination Tool:

A) Bicuspid valve

B) Tricuspid valve

C) Pulmonary valve

D) Semi lunar valve

7 / 100

Category: Biology

Two species can avoid competition and better use the environment’s resources by occupying different ____.

NUMS Mock 4
Biology
Evolution

A) Adaptations

B) Polymorphism

C) Niches

D) Specialization

8 / 100

Category: Biology Ch 13 Class 11

Oxygen is transported by combining with ……….. in Hb.

NUMS 2015
Biology
Gaseous Exchange
Elimination Tool:

A) Nitrogen

B) Iron

D) Hydrogen

C) Carbon

9 / 100

Category: Biology Ch 3 Class 12

Which of the following is antagonist to Auxin in terms of promotion of stem growth?

Gibberellins

Cytokinins

Abscisic Acid

none of these.

10 / 100

Category: Biology Ch 2 Class 12

Myofibrils, within the muscle fibers, contain thick and thin filaments made up of _____ and ______ respectively:

NUMS 2020
Biology
Support and Movement
Elimination Tool:

A) Myosin and Actin

B) Globulin and Albumin

C) Troponin and Tropomyosin

D) Fibrin and Fibrinogen

11 / 100

Category: Biology

Q.64 All of the following are the attributes of evolution except:

A. O3 began to filter UV radiations

B. Some organisms began to utilized O2 in the start of evolution

C. Nutrient supply is abundant

D. The reducing atmosphere slowly become oxidizing atmosphere

12 / 100

Category: Biology Ch 13 Class 11

The number of stomata present per cm2 of leaf is:

PMC Sample 2
Biology
Gaseous Exchange
Elimination Tool:

A) Less than 100

B) 1,000 to 60,000

C) One million

D) None of the above

13 / 100

Category: Biology Ch 1 Class 12

Terrestrial animals like kangaroo rat survive even without drinking water since

They don't require water for their metabolic process

They can retain excessive water in their body during raining season.

They feed on carbohydrate rich seeds which can provide them with metabolic water

They are anhydrobiotic organisms

14 / 100

Category: Biology Ch 6 Class 12

Which of the following can be blocked, if one wants to stop translation of mRNA?

NUMS 2019 Reconduct
Biology
Chromosomes and DNA
Elimination Tool:

A) RNA polymerase

B) Helicase

C) Elongation factor

D) Primase

15 / 100

Category: Biology Ch 9 Class 12

Protoplasts are plant cells from which

. Cell walls are removed

Nucleus is removed

New organelles are added

Vacuoles are taken out

16 / 100

Category: Biology Ch 10 Class 11

Which one of the following does not have intermediate host?

NUMS 2016
Biology
Kingdom Animalia
Elimination Tool:

A) Tapeworm

C) Liver fluke

B) Ascaris

D) Plasmodium

17 / 100

Category: Biology Ch 3 Class 11

An activated enzyme consisting of polypeptide chain and a cofactor is called:

Apoenzyme

Holoenzyme

Activated enzyme

Both b and c

18 / 100

Category: Biology

Q.44 To produce ATP (adenosine triphosphate) in muscles, creatine phosphate (CP) transfers__________________ to adenosine diphosphate (ADP).

A. Oxygen

B. Adenosine

C. Cytosine

D. Phosphate

19 / 100

Category: Biology

Q.23 During inspiration, the diaphragm:

A. Contracts

B. Relaxes

C. Contracts and relaxes

D. None of these

20 / 100

Category: Biology Ch 10 Class 12

Which scientist does not match his achievements

Lamarck published his theory of evolution

Lyell published principles of geology

Malthus published essay on principle of population

Cuvier published papers on inheritance

21 / 100

Category: Biology Ch 7 Class 11

The disease caused by Protozoal infection is:

NTS 2018
Biology
Kingdom Protista
Elimination Tool:

A) Rickets

B) Goiter

C) Malaria

D) Beri-beri

22 / 100

Category: Biology Ch 7 Class 11

It is the smallest eukaryote:

NUMS 2017
Biology
Kingdom Protista
Elimination Tool:

A) Virus

B) Bacteria

C) Plasmodium

D) Sponge

23 / 100

Category: Biology Ch 7 Class 11

Which part of bacteria is most delicate and damage to it can kill the bacteria?

PMC 2021 Tested
Biology
Kingdom Protista
Elimination Tool:

A) Cell wall

B) Slime

C) Capsule

D) Cell membrane

24 / 100

Category: Biology Ch 9 Class 11

Plants of this group are called ferns:

NUMS 2017
Biology
Kingdom Plantae
Elimination Tool:

A) Filicinae

B) Angiospermae

C) Gymnospermae

D) All of them

25 / 100

Category: Biology Ch 13 Class 11

Oxygen, released into the atmosphere, comes from:

NUMS 2020
Biology
Gaseous Exchange
Elimination Tool:

A) CO2

B) H2O

C) C6H12O6

D) CO2 and H2O

26 / 100

Category: Biology Ch 6 Class 11

Which one of the following sets includes the bacterial diseases?

NUMS 2014
Biology
Kingdom Prokaryote
Elimination Tool:

A) Cholera, typhoid, mumps

B) Tetanus, tuberculosis, measles

C) Malaria, mumps, poliomyelitis

D) Diphtheria, leprosy, plague

27 / 100

Category: Biology Ch 10 Class 11

Flame cells are commonly found in:

NUMS 2014
Biology
Kingdom Animalia
Elimination Tool:

A) Platyhelminthes

B) Annelida

C) Coelenterate

D) All of above

28 / 100

Category: Biology Ch 12 Class 12

End of earth’ is related to

Tropical rain forest

Temperate deciduous forest

Savanna

Tundra

29 / 100

Category: Biology Ch 2 Class 12

Roots of a plant show

Positive phototropism and negative geotropism.

Negative phototropism and positive geotropism.

Negative tactic movement and positive tropic movement.

Positive geotropism of stem and roots

30 / 100

Category: Biology Ch 11 Class 11

Pyruvic acid is the end product of:

NTS 2017
Biology
Bioenergetics
Elimination Tool:

A) Glycolysis

B) Krebs cycle

C) Oxidation

D) Electron transport system

31 / 100

Category: Biology Ch 14 Class 11

In the human body, blood circulating from the gut to the heart passes through the:

NTS 2013
Biology
Transport
Elimination Tool:

A) aorta

B) kidneys

D) lungs

C) llver

32 / 100

Category: Biology

Which type of protein structure contains the three dimensional structure?

NUMS Mock 3
Biology
Biological Molecules

A) Primary

B) Secondary

C) Tertiary

D) Quaternary

33 / 100

Category: Biology Ch 7 Class 11

In which of the following growth phases, the number of bacteria increases the most rapidly?

NTS 2018
Biology
Kingdom Protista
Elimination Tool:

A) Lag phase

B) Log phase

C) Stationary phase

D) Death / Decline phase

34 / 100

Category: Biology

Q.55 The type of bronchitis that causes no permanent damage to the lungs and lasts for two weeks is known as

A. Acute bronchitis

B. Chronic bronchitis

C. Coastal bronchitis

D. Intercostal bronchitis

35 / 100

Category: Biology Ch 9 Class 12

Chemical nature of primers used in the PCR process is _______.

UHS 2018
Biology
Biotechnology
Elimination Tool:

A) RNA

B) Protein

C) Carbohydrate

D) DNA

36 / 100

Category: Biology Ch 13 Class 11

Chest cavity is bounded by ribs and muscles on the sides, while the floor of chest cavity is called:

NUMS 2019 Reconduct
Biology
Gaseous Exchange
Elimination Tool:

A) Pleura

B) Alveoli

C) Chest cage

D) Diaphragm

37 / 100

Category: Biology Ch 2 Class 12

Pivot joint exists between

NUMS 2014
Biology
Support and Movement
Elimination Tool:

A) Tibia and fibula

C) Humerus and scapula

B) Humerus and ulna

D) Ulna and radius

38 / 100

Category: Biology Ch 4 Class 12

Which of the following is an ovoviviparous animal?

PMC Sample 1
Biology
Reproduction
Elimination Tool:

A) basking shark

B) humans

C) blue shark

D) all of these

39 / 100

Category: Biology Ch 3 Class 11

The substrate binds to specific region of enzyme called?

PMC Sample 1
Biology
Enzymes
Elimination Tool:

A) key

B) active site

C) hyperactive site

D) none of these

40 / 100

Category: Biology

What is the effect of enzyme DNA ligase?

NUMS Mock 2
Biology
Chromosomes and DNA

A) DNA is broken up at specific sites

B) DNA fragments are joined together

C) DNA replication occurs

D) DNA transcription occurs

41 / 100

Category: Biology Ch 11 Class 12

Plants growing in xeric conditions are called

Spherophytes

Mesophytes

Xerophytes

Teridophytes

42 / 100

Category: Biology Ch 6 Class 11

The word Archaeobacteria (a division of bacteria) derived from Greek means

True bacteria

False bacteria

Recent bacteria

Ancient bacteria

43 / 100

Category: Biology Ch 2 Class 11

Proteoglycan in cartilages (which consists of polysaccharides) are also attached to:

NUMS 2014
Biology
Biological Molecules
Elimination Tool:

A) Chondroitin

B) Ossein

C) Casein

D) Cartilagin

44 / 100

Category: Biology Ch 8 Class 12

The type of gene interaction in which the effect caused by a gene at one locus interfere with the effect caused by another gene at another locus is known as:

NUMS 2018
Biology
Variation and Genetics
Elimination Tool:

A) Pleiotropy

B) Epistasis

C) Polygenic inheritance

D) Gene linkage

45 / 100

Category: Biology Ch 2 Class 11

The disease caused by nutritional deficiency is:

NTS 2018
Biology
Biological Molecules
Elimination Tool:

A) Hepatitis

B) Cholera

C) Malaria

D) Beriberi

46 / 100

Category: Biology Ch 12 Class 11

A part of the digestive system that is not in contact with food is the:

NTS 2017
Biology
Nutrition
Elimination Tool:

A) Small intestine

C) Liver

B) Stomach

D) Large intestine

47 / 100

Category: Biology

In semi-conservative replication, which of the following is true regarding the separation of two strands?

NUMS Mock 2
Biology
Chromosomes and DNA

A) Primary structure is conserved, and secondary structure is disturbed

B) Secondary structure is conserved, and the primary structure is disrupted

C) both the primary and secondary structures are conserved

D) Both the primary and secondary structures are disrupted

48 / 100

Category: Biology Ch 7 Class 11

The only group of algae having no flagellated motile cells at any stage is :

Chrysophyta

Phaeophyta

Pyrrophyta

Rhodophyta

49 / 100

Category: Biology Ch 5 Class 11

Which of the following is derived from Latin word VENUME which means poisonous?

NUMS 2018
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Bacteria

B) Fungi

C) Virus

D) Malaria

50 / 100

Category: Biology Ch 12 Class 11

Which process takes place during the movement of glucose from the body fluid to the blood?

NUMS 2016
Biology
Nutrition
Elimination Tool:

A) Endosmosis

B) Osmosis

C) Active transport

D) Facilitated diffusion

51 / 100

Category: Biology Ch 6 Class 11

In many bacteria, the cell wall is enclosed within a slime capsule made up of:

NUMS 2017
Biology
Kingdom Prokaryote
Elimination Tool:

A) Polysaccharides

B) Cellulose

C) Amino acids

D) Proteins

52 / 100

Category: Biology

Hepatic and Pancreatic secretions are also stimulated by a hormone called:

NUMS Mock 4
Biology
Coordination and Control

A) Gastrin

B) Secretin

C) Glucagon

D) Insulin

53 / 100

Category: Biology Ch 2 Class 12

The significant flight muscle in birds is the:

NUMS 2014
Biology
Support and Movement
Elimination Tool:

A) Pectoral

B) Tensor

C) Appendicular

D) All of these

54 / 100

Category: Biology Ch 8 Class 11

Which of the following group represent pathological fungi?

Mushrooms morels and truffles

Rusts smuts and molds

Penicillium

All of these

55 / 100

Category: Biology Ch 5 Class 12

he only promoter of Leaf’s senescence in the following plant hormones is:

PMC Practice 9
Biology
Coordination and Control
Growth and Development
Elimination Tool:

A) Gibberellins

B) Cytokinins

C) Auxins

D) Abscisic acid

56 / 100

Category: Biology Ch 8 Class 11

The most common example of members of the kingdom fungi is/are:

NUMS 2019 Reconduct
Biology
Kingdom Fungi
Elimination Tool:

A) Star fish

B) Mushrooms

C) Algae

D) Human

57 / 100

Category: Biology

Q.29 A monohybrid cross yielded 3:1 in F2. What could be mode of inheritance?

A. segregation

B. independent assortment

C. Both A and B

D. none of these

58 / 100

Category: Biology

The only possible treatment in end stage renal failure is:

NUMS Mock 3
Biology

A) Hemodialysis

B) Peritoneal dialysis

C) Lithotripsy

D) Kidney transplantation

59 / 100

Category: Biology Ch 8 Class 12

In cats, the genes controlling coat-color are co-dominant (incompletely dominant) and are carried on the X chromosomes. When a black female was mated with a ginger male the resulting litter consisted of black male and tortoise-shell female kittens. What phenotypic ratio would be expected in the F2 generation?

NTS 2012
Biology
Variation and Genetics
Elimination Tool:

A) 1 black male : 1 ginger male : 2 tortoise – shell females

B) 1 black male : 1 ginger male : 1 tortoise – shell female : 1 black female

C) 2 black males : 1 tortoise – shell female : 1 ginger female

D) 1 black male : 1 tortoise – shell female : 1 ginger female : 1 black female

60 / 100

Category: Biology Ch 10 Class 11

Despite the structural diversities, ____ are characterized by having a soft body protected by a calcareous shell developing from the mantle layer.

NUMS 2014
Biology
Kingdom Animalia
Elimination Tool:

A) Corals

B) Foraminiferos

C) Molluscs

D) None of these

61 / 100

Category: Biology Ch 5 Class 12

Lateral meristems are present in

All plants

Gymnosperms and dicots

Monocots

In aquatic plants

62 / 100

Category: Biology Ch 11 Class 12

Disease in living organisms caused by parasites is called

Parasitism

Infestation

Predation

Infection

63 / 100

Category: Biology Ch 12 Class 11

Nitrogen-fixing bacteria in root nodules fix nitrogen in soil air into:

NUMS 2015
Biology
Nutrition
Elimination Tool:

A) Ammonia

B) Nitrite

C) Nitrate

D) Amino acid

64 / 100

Category: Biology Ch 10 Class 12

Which one of the following pairs represents an analogous feature?

NUMS 2018
Biology
Evolution
Elimination Tool:

A) Elephant tusks and human incisors

B) Teleost erythrocyte and mammalian erythrocyte

C) Insect wing and bat wing

D) Mole forelimb and bird wing

65 / 100

Category: Biology Ch 7 Class 12

Spread of tumor cells and establishment of secondary areas of growth is

Benign tumors

Cancer

Metastasis

Epistasis

66 / 100

Category: Biology Ch 10 Class 12

Most fossils are found in the

Metamorphic rocks

Soil

Sedimentary rocks

Volcanic mountains

67 / 100

Category: Biology Ch 1 Class 12

Sperms of liverworts, mosses, ferns move towards archegonia, in response to uncleic acid released by the ovum. This is an example of:

Chemotropic movement

Chemotactic movement.

Chemosastic movement

. Haptonastic movement.

68 / 100

Category: Biology Ch 2 Class 12

Molluscs have an exoskeleton made up of:

NTS 2016 DUHS & JSMU
Biology
Support and Movement
Elimination Tool:

A) Protein

B) Silica

D) Cuticles

C) CaCO3

69 / 100

Category: Biology Ch 6 Class 11

Spirochaete bacterium Treponema Pallidum causes ______.

NTS 2016 SMBBMC
Biology
Kingdom Prokaryote
Elimination Tool:

A) Gonorrhea

B) Syphilis

C) Genital herpes

D) AIDS

70 / 100

Category: Biology Ch 9 Class 11

Leaves of ……….. are used to cure cough and cold in horses.

NUMS 2015
Biology
Kingdom Plantae
Elimination Tool:

A) Glycyrrhiza glabra

B) Cassia alata

C) Bamboo

D) Both bamboo and Glycyrrhiza glabra

71 / 100

Category: Biology Ch 10 Class 12

Analogous organs show

Convergent evolution

Divergent evolution

Straight evolution

Zig-zag evolution

72 / 100

Category: Biology Ch 2 Class 11

The helical structure of a protein is kept by the formation of hydrogen bond between amino acid molecules which are:

NUMS 2015
Biology
Biological Molecules
Elimination Tool:

A) Adjacent to each other

B) In successive spiral turns

C) Between two different polypeptide chains

D) None of the given options

73 / 100

Category: Biology

The smaller (40S) of ribosome combines with larger subunit (60S) in the presence of Mg2+ ion to form _____ particle.

NUMS Mock 3
Biology
Cell Structure and Function

A) 100 S

B) 90 S

C) 80 S

D) 70 S

74 / 100

Category: Biology

Q.11 Which of the following statement regarding lecithin is correct?

A. Contain only one fatty acid

B. Choline attached with phosphatidic acid at carbon 3

C. Phosphate group is positively charged

D. Have five carbon glycerol molecules

75 / 100

Category: Biology Ch 2 Class 11

5 different amino acids, numbered 1, 2, 3, 4, and 5, below from the following sequence in the path of a polypeptide chain:

1-2-3-4-2-5-3

Messenger RNA codon, which correspond to the amino acids, are:
amino acid 1 UGU

amino acid 2 GAU

amino acid 3 CAC

amino acid 4 UAG

amino acid 5 AAG

Which one of the following DNA bases sequences could provide the code for the given section of the polypeptide?

NTS 2015 DUHS and JSMU
Biology
Biological Molecules
Elimination Tool:

A) ACACTTGTGATGCTATTCGTG

B) ACACUAGUGAUGCUAUUCGUG

C) ACACTAGTGATGCTAAACGTG

D) ACACTAGTGATCCTATTCGTG

76 / 100

Category: Biology Ch 14 Class 11

Anti-bodies are produced by:

NUMS 2014
Biology
Transport
Elimination Tool:

A) Red blood cells

B) Platelets

C) B-lymphocytes

D) Hormones

77 / 100

Category: Biology

Lecithin is formed by combining phosphatidic acid with ______:

NUMS Mock 1
Biology
Biological Molecules

A) Serine

B) Choline

C) Inositol

D) Ethanolamine

78 / 100

Category: Biology Ch 7 Class 11

Radiolarians belong to which of the following protozoal group?

Zooflagellates

Actinopods

Foraminifera

Apicomplexans

79 / 100

Category: Biology Ch 11 Class 11

The main process that occurs in the dark reaction in photosynthesis is:

NTS 2010
Biology
Bioenergetics
Elimination Tool:

A) That water is split.

B) Light energy is converted into chemical energy.

C) That glucose is oxidized.

D) That carbon-dioxide is fixed.

80 / 100

Category: Biology Ch 3 Class 12

Diameter of an artery can be changed by:

NUMS 2015
Biology
Coordination and Control
Elimination Tool:

A) Nervous stimulation

B) Chemical stimulation

C) Both chemical and nervous stimulation

D) None of the given options

81 / 100

Category: Biology Ch 2 Class 11

Each β – chain of hemoglobin molecules contains ____ amino acids.

NUMS 2019 Reconduct
Biology
Biological Molecules
Elimination Tool:

A) 136

B) 146

D) 288

C) 235

82 / 100

Category: Biology Ch 9 Class 12

A weed engineered to produce a biodegradable plastic in cell granules is

. Mouse-cat cress

Mouse weed

Mouse-eared cress

None of these

83 / 100

Category: Biology

The spectrum of He is expected to be similar to that of:

NUMS Mock 4
Chemistry
Atomic Structure

A) Hydrogen

B) Sodium

C) Oxygen

D) Li+

84 / 100

Category: Biology Ch 13 Class 11

Haemoglobin carries more oxygen than plasma by:

NTS 2011
Biology
Gaseous Exchange
Elimination Tool:

A) 50 times

B) 20 times

C) 70 times

D) 100 times

85 / 100

Category: Biology Ch 6 Class 11

Gram negative bacteria are stained pink by the use of:

NUMS 2016
Biology
Kingdom Prokaryote
Elimination Tool:

A) Crystal violet

B) Gram’s iodine

C) Feulgen stain

D) Safranin

86 / 100

Category: Biology Ch 5 Class 12

Fetus is human embryo from the beginning of which of the following?

PMC Sample 2
Biology
Growth and Development
Elimination Tool:

A) 2nd month

B) 3rd month

D) 5th month

C) 4th month

87 / 100

Category: Biology

Q.42 All of the following are paired facial bones except:

A. Maxilla

B. Lacrimal

C. Zygomatic

D. Mandible

88 / 100

Category: Biology Ch 4 Class 11

In a typical compound microscope the resolution is 2 μm. Which is about _____ that of naked eye.

NUMS 2019 Reconduct
Biology
Cell Structure and Function
Elimination Tool:

A) 100 x

B) 300 x

C) 400 x

D) 500 x

89 / 100

Category: Biology Ch 7 Class 12

_______ is the stage of mitosis characterized by the physical separation of ________ chromatids.

NTS 2019
Biology
Cell Cycle
Elimination Tool:

A) Interphase. Offspring

B) Telophase, F1 chromatids

C) Metaphase, Homologous

D) Anaphase. Sister

90 / 100

Category: Biology Ch 9 Class 11

Which of the following statements is a correct distinction between autotrophs and heterotrophs?

PMC Practice 7
Biology
Kingdom Plantae
Elimination Tool:

A) Only heterotrophs require chemical compunds from the environment

B) Cellular respiration is unique to heterotrophs

C) Autotrophs, but not heterotrophs can nourish themselves beginning with nutrients that are entirely inorganic.

D) Only heterotrophs have mitochondria

91 / 100

Category: Biology

Consider the following statements about biological communities.

I. Their members share a common gene pool

II. The community remains stable even though some physical aspect of the environment may undergo a change

III. It consists of all the populations living in a particular area.

IV. A community interacts with a non-living environment and both function together to form an ecosystem

Which two of the above statements are true?

NUMS Mock 4
Biology
Evolution

A) 1 and 2

B) 1 and 3

C) 2 and 4

D) 3 and 4

92 / 100

Category: Biology Ch 10 Class 12

Which condition can be explained by Lamarckism?

PMC Sample 1
Biology
Evolution
Elimination Tool:

A) How giraffes got their long neck

B) How humans lost their tail

C) How humans became bipedal

D) all of these

93 / 100

Category: Biology Ch 8 Class 12

What CANNOT be true for a man having B+ve blood group?

NUMS 2019 Reconduct
Biology
Variation and Genetics
Elimination Tool:

A) His mother’s blood group is BB

B) His mother’s blood group is BO

C) His father’s blood group is AO

D) His father’s blood group is AA

94 / 100

Category: Biology Ch 7 Class 11

Brown algae are also known as

Phaeophyta

Rhodophyta

Pyrrophyta

Chrysophyta

95 / 100

Category: Biology

Q48 Which statement is incorrect about Lock and Key Model?

A. Specific enzyme can transform only a specific substrate

B. Active site of an enzyme is a non-flexible structure

C. Active site does not change before during or even after the reaction

D. It explains the mechanism of every chemical reaction

96 / 100

Category: Biology

In which of the following phases of bacterial growth, is the death rate more rapid than the multiplication rate?

NUMS Mock 2
Biology
Kingdom Prokaryote

A) Stationary phase

B) LAG phase

C) Decline phase

D) LOG phase

97 / 100

Category: Biology Ch 5 Class 12

Thymus is found in the human body in _____.

PMC Practice 2
Biology
Growth and Development
Elimination Tool:

A) The medulla oblongata

B) The mediastinum of the upper thorax

C) Both Options A and B are correct

D) None of these options is correct

98 / 100

Category: Biology Ch 9 Class 11

Antheridiophore and archegoniophore are found in

Marchantia

Funaria

Both of these

None of these

99 / 100

Category: Biology Ch 10 Class 11

Which of the following is a freshwater sponge?

NUMS 2016
Biology
Kingdom Animalia
Elimination Tool:

A) Sycon

B) Leucosolenia

C) Euplectella

D) Spongilla

100 / 100

Category: Biology Ch 9 Class 12

Transgenic plants are produced when foreign genes are introduced into

Mature plant embryo

Immature plant embryo

Roots

Leaves

Your score is

The average score is 57%

Structured Practice for Best Entry Test Preparation

This topic-wise and chapter-wise practice test allows students to focus on individual biology concepts, including diagrams, processes, and conceptual questions. Regular practice enhances understanding, sharpens problem-solving skills, and builds confidence to tackle both board and competitive exam questions efficiently.

Free Resources for Best Entry Test Preparation

Students can access free Biology Practice Test 2 to systematically improve knowledge, recall, and problem-solving abilities. This test is suitable for FSC Board Exams as well as major entry tests, helping students perform better in the biology section. PLS Academy provides these resources to support students in their preparation.

JazakAllah