Biology Practice Test 2

Biology Practice Test 2 is designed to help students strengthen their understanding of key biological concepts, theories, and processes for competitive entry tests like MDCAT, NUMS, AKU, UET, ECAT, NTS, as well as FSC Board Exams. This test covers topics from molecular biology, cell division, human physiology, plant physiology, and more, helping students improve accuracy and retention.

PLS Academy

Get Access to 20 thousands+ MCQs Including Topical MCQs, Practice Tests, Mock Tests, Solved Past Papers, Flashcards, Notes, FLPS, and Much More.

UNLOCK PREMIUM🔐

2514

Created by Ali Durrani

MDCAT Practice Tests

Biology Practice Test 2

This is the Free Access to Limited MCQs. Enroll to PLS Boost Premium Bundle to Get More MCQs HERE

1 / 100

Category: Biology Ch 5 Class 12

Nutrition to egg in ovary is provided by which of the following?

PMC Practice 1
Biology
Growth and Development
Elimination Tool:

A) Germ cells

B) Milk cells

D) All of these

C) Follicle cells

2 / 100

Category: Biology

Q.51 The water splitting step of photosynthesis is called?

A Hydrolysis

B. Chemiosmosis

C. Photolysis

D. Photosynthesis

3 / 100

Category: Biology

_____ are more common in human males and females.

NUMS Mock 3
Biology
Variation and Genetics

A) X-linked dominant traits

B) X-linked recessive traits

C) Y-linked dominant traits

D) Autosomal linked recessive traits

4 / 100

Category: Biology Ch 3 Class 11

What is not true about the induced fit model:

NUMS 2018
Biology
Enzymes
Elimination Tool:

A) Explains mechanism of enzyme action

B) Enzyme is specific in nature

C) Enzyme is a flexible structure

D) Enzyme doesn’t show change during reaction

5 / 100

Category: Biology

Q.27 During which of the following levels of biological organization can natural selection occur?

A. Gene

B. Individual

C. Group

D. All of these

6 / 100

Category: Biology

Phenylmethyl ketone can be converted into ethyl benzene in one step by using:

NUMS Mock 4
Chemistry
Aldehydes and Ketones

A) LiAlH4

B) Zn(Hg)-HCl

C) NaBH4

D) CH3Mgl

7 / 100

Category: Biology

What is the effect of enzyme DNA ligase?

NUMS Mock 2
Biology
Chromosomes and DNA

A) DNA is broken up at specific sites

B) DNA fragments are joined together

C) DNA replication occurs

D) DNA transcription occurs

8 / 100

Category: Biology Ch 5 Class 12

Lateral meristems are present in

All plants

Gymnosperms and dicots

Monocots

In aquatic plants

9 / 100

Category: Biology Ch 6 Class 12

The number of base pairs in a complete helical turn is/are:

NUMS 2020
Biology
Chromosomes and DNA
Elimination Tool:

A) 1

B) 5

C) 10

D) 15

10 / 100

Category: Biology Ch 12 Class 12

Which statement about profundal zone is correct?

Plants are unable to anchor but enough light penetrates to support photosynthesis

Phytoplanktons in this region are cyanobacteria

Decomposers and detritus feeders inhabit it

Water lilies are abundant

11 / 100

Category: Biology

Q31 What happens during muscle contraction to the length of each myosin and actin filament?

A. A band becomes short

B. I band elongates

C. There is no change in sarcomere

D. Z- lines get closer

12 / 100

Category: Biology Ch 2 Class 12

Myofibrils, within the muscle fibers, contain thick and thin filaments made up of _____ and ______ respectively:

NUMS 2020
Biology
Support and Movement
Elimination Tool:

A) Myosin and Actin

B) Globulin and Albumin

C) Troponin and Tropomyosin

D) Fibrin and Fibrinogen

13 / 100

Category: Biology Ch 10 Class 12

A group of interbreeding individuals belonging to a particular species and sharing a common geopraphic area is called?

PMC Sample 1
Biology
Evolution
Elimination Tool:

A) community

B) family

C) race

D) population

14 / 100

Category: Biology Ch 10 Class 12

Consider the following statements about biological communities.

I. Their members share a common gene pool

II. The community remains stable even though some physical aspect of the environment may undergo a change

III. It consists of all the populations living in a particular area.

IV. A community interacts with a non-living environment and both function together to form an ecosystem

Which two of the above statements are true?

NTS 2014
Biology
Evolution
Elimination Tool:

A) 1 and 2

B) 1 and 3

D) 2 and 3

E) 3 and 4

15 / 100

Category: Biology Ch 13 Class 11

The most important cause of many of the respiratory disorders is:

NUMS 2019 Cancelled
Biology
Gaseous Exchange
Elimination Tool:

A) Bacterial infection

B) Pollution

C) Smoking

D) Drinking

16 / 100

Category: Biology Ch 11 Class 11

The light dependent reaction of photosynthesis occurs in:

NTS 2011
Biology
Bioenergetics
Elimination Tool:

A) Stroma of chloroplast

B) Guard cells of stomata

C) Thylakoid membrane of chloroplast

D) Cytoplasm of leaf cell

17 / 100

Category: Biology Ch 9 Class 11

Which of the following is included in Bryophytes?

NTS 2011
Biology
Kingdom Plantae
Elimination Tool:

A) Mosses

B) Club mosses

C) Ferns

D) Seed plants

18 / 100

Category: Biology Ch 10 Class 11

Which one of the following coelenterate is also called the Portuguese man of war?

NUMS 2014
Biology
Kingdom Animalia
Elimination Tool:

A) Hydra

B) Velella

C) Obelia

D) Physalis

19 / 100

Category: Biology Ch 13 Class 12

Which of the following statements is true about Savannah?

NTS 2015 DUHS and JSMU
Biology
Man and His Environment
Elimination Tool:

A) Dry season is very long and the temperature ranges more than 18 C throughout the year

B) Its plants do not shed off their leaves

C) The subsoil is permanently frozen

D) Rainfall is up to 200 cm per year

20 / 100

Category: Biology

The thickest chamber of the human heart is:

NUMS Mock 4
Biology
Transport

A) Left atrium

B) Right atrium

C) Right ventricle

D) Left ventricle

21 / 100

Category: Biology Ch 13 Class 11

Diaphragm is a sheet of:

NUMS 2019 Cancelled
Biology
Gaseous Exchange
Elimination Tool:

A) Smooth muscles

B) Cardiac muscles

C) Skeletal muscles

D) All of these

22 / 100

Category: Biology Ch 9 Class 11

“Vascular System absent; gametophyte dominant, sporophyte attached to gametophyte; homosporous” are distinguishing characters of

UHS 2010
Biology
Kingdom Plantae
Elimination Tool:

A) Psilopsida

B) Pteropsida

C) Angiosperms

D) Bryophyta

23 / 100

Category: Biology Ch 6 Class 11

Apparently which bacteria is more resistant to antibiotics?

NUMS 2017
Biology
Kingdom Prokaryote
Elimination Tool:

A) Gram-positive bacteria

B) Gram-negative bacteria

C) Both Gram-negative and positive bacteria

D) None of these options are correct

24 / 100

Category: Biology Ch 9 Class 12

Passive immunity is used against:

UHS 2015
Biology
Biotechnology
Elimination Tool:

A) Malaria

B) Typhoid

C) Dengue

D) Tetanus

25 / 100

Category: Biology Ch 8 Class 12

In question number 2 what will be frequency of dwarf plant in F2

0.25

0.5

0.75

26 / 100

Category: Biology Ch 2 Class 12

The muscles attached to the bones are:

NTS 2010
Biology
Support and Movement
Elimination Tool:

A) Voluntary and smooth

B) Involuntary and smooth

D) Involuntary and striated

C) Voluntary and striated

27 / 100

Category: Biology Ch 14 Class 11

Arteriosclerosis is:

NUMS 2016
Biology
Transport
Elimination Tool:

A) A metabolic disorder

B) A degenerative disorder

C) An infectious disorder

D) A nutritional deficiency disorder

28 / 100

Category: Biology

Arrange the following according to the level of protein structures:

a) lysozyme, b) haemoglobin, c) insulin, d) hairs.

NUMS Mock 4
Biology
Biological Molecules

A) c, d, a, b

B) a, b, c, d

C) d, c, b, a

D) a, d, c, b

29 / 100

Category: Biology

Q.12 An enzyme without its cofactor is called.

A. Coenzyme

B. Apoenzyme

C. Holoenzyme

D. Proenzyme

30 / 100

Category: Biology Ch 3 Class 12

Which body function is controlled through a positive feedback mechanism?

PMC 2020
Biology
Coordination and Control
Elimination Tool:

A) Labor contractions

B) Body temperature

C) Insulin production

D) Thyroxine release

31 / 100

Category: Biology Ch 14 Class 11

All of the following protect the body against the entrance of germs except:

NTS 2017
Biology
Transport
Elimination Tool:

A) Tears

B) Mucous membranes

C) Ciliated cells

E) Red blood cells,

32 / 100

Category: Biology Ch 4 Class 11

In a typical compound microscope the resolution is 2 μm. Which is about _____ that of naked eye.

NUMS 2019 Reconduct
Biology
Cell Structure and Function
Elimination Tool:

A) 100 x

B) 300 x

C) 400 x

D) 500 x

33 / 100

Category: Biology

The Porifera are pore – bearing animals, commonly called:

NUMS Mock 3
Biology
Kingdom Animalia

A) Corals

B) Sponges

C) Hydras

D) Anemones

34 / 100

Category: Biology Ch 11 Class 12

Diverse and stable community at the end of succession is

Diverse Climax communityand stable community at the end of succession is A. Climax community B. Pioneers community C. Top community D. Stable community Answer & Explanation Answer: Option A

Pioneers community

Top community

Stable community A

35 / 100

Category: Biology Ch 5 Class 11

Bacteriophages, or phages are also known as:

PMC Sample 2
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Bacteria facilitator

B) Bacteria eater

C) Animal viruses

D) Plant viruse

36 / 100

Category: Biology Ch 13 Class 12

Geothermal energy is

. Energy obtained from nuclear fuel

Energy obtained from burning natural fuels

Heat energy trapped underground

Energy obtained from blowing hot winds

37 / 100

Category: Biology Ch 3 Class 12

Type of neurons found exclusively in CNS are:

Sensory neurons

Motor neurons

Associative neurons

None of these

38 / 100

Category: Biology

5 different amino acids, numbered 1, 2, 3, 4, and 5, below from the following sequence in the path of a polypeptide chain:

1-2-3-4-2-5-3

Messenger RNA codon, which correspond to the amino acids, are:
amino acid 1 UGU

amino acid 2 GAU

amino acid 3 CAC

amino acid 4 UAG

amino acid 5 AAG

Which one of the following DNA bases sequences could provide the code for the given section of the polypeptide?

NUMS Mock 2
Biology
Biological Molecules

A) ACACTTGTGATGCTATTCGTG

B) ACACUAGUGAUGCUAUUCGUG

C) ACACTAGTGATGCTAAACGTG

D) ACACTAGTGATCCTATTCGTG

39 / 100

Category: Biology Ch 13 Class 11

The oxygen-binding protein present in skeletal muscles is:

NUMS 2017
Biology
Gaseous Exchange
Elimination Tool:

A) Globin

B) Glycogen

C) Myo Glycogen

D) Myoglobin

40 / 100

Category: Biology Ch 9 Class 12

DNA analysis is done to

Diagnose viral infections

Identify criminals

Determine evolution

All of these

41 / 100

Category: Biology

Q.46 Identify the property which is not related to cardiac muscle:

A. Irregular strips

B. Spontaneous contraction

C. Branched

D. Slow speed of contraction

42 / 100

Category: Biology Ch 6 Class 11

Which of the following statement is incorrect regarding germ theory of diseases postulated by Robert Koch?

A specific organism can always be found in association with a given disease

The organism can be isolated and grown in pure culture in the laboratories

The pure culture cannot produce the disease when inoculated into susceptible animal however the causative organism isolated from pure culture can do so.

It is possible to recover the organism in pure culture from the experimentally infected animals.

43 / 100

Category: Biology Ch 3 Class 11

A reaction will proceed faster if the activation energy is?

PMC Sample 1
Biology
Enzymes
Elimination Tool:

A) High

B) Low

C) Remains the same

D) None of these options is correct

44 / 100

Category: Biology Ch 10 Class 12

Which condition can be explained by Lamarckism?

PMC Sample 1
Biology
Evolution
Elimination Tool:

A) How giraffes got their long neck

B) How humans lost their tail

C) How humans became bipedal

D) all of these

45 / 100

Category: Biology

Q.17 Final acceptor of electrons in respiratory chain is?

A. NADH

B. Cytochrome a3

C. Water

D. Oxygen

46 / 100

Category: Biology Ch 11 Class 11

FADH2 is produced during which step of Krebs cycle?

NUMS 2015
Biology
Bioenergetics
Elimination Tool:

A) When Isocitrate is converted into alpha – ketoglutarate

B) When alpha – Ketogluterate is converted into Succinate

C) When Succinate is converted into Fumarate

D) When Fumarate is converted into Maltose

47 / 100

Category: Biology Ch 3 Class 12

Normal action potential of a neuronal cell is :

plus 50 mv

plus 60 mv

plus 70 mv

plus 80 mv

48 / 100

Category: Biology

The type of plastids found in roots of plants are _____.

NUMS Mock 4
Biology
Cell Structure and Function

A) Chloroplasts

B) Chromoplasts

C) Leucoplasts

D) All of these options are correct

49 / 100

Category: Biology Ch 1 Class 12

Most of the marine invertebrates are

Osmoconformers

Osmoregulators

Both depend upon the concentration of sea water

None of these

50 / 100

Category: Biology Ch 4 Class 11

Which of the following is NOT the function of cell membranes?

NTS 2018
Biology
Cell Structure and Function
Elimination Tool:

A) Protection of cytoplasm

B) Regulating the passage of different molecules

C) Protein synthesis

D) Cellular communication

51 / 100

Category: Biology Ch 1 Class 12

Marine fish can keep their internal environment hypertonic with respect to the surrounding salty water by retaining.

Excessive urea which will increase their internal solute concentration and prevent body shrinkage in hypertonic environment

Trimethyl alanine

Ammonia

Trimethylamine oxide

52 / 100

Category: Biology Ch 10 Class 12

Theory of Lamarck was based on:

NTS 2011
Biology
Evolution
Elimination Tool:

A) Adaptive modifications

B) Adaptive radiations

C) Both A and B

D) None of the above

53 / 100

Category: Biology Ch 4 Class 11

Which property of water helps to maintain the integrity of lipid-containing membranes?

PMC 2020
Biology
Cell Structure and Function
Elimination Tool:

A) Specific Heat Capacity

B) Hydrogen Bonding

C) Cohesion and Adhesion

D) Hydrophobic exclusion

54 / 100

Category: Biology Ch 10 Class 11

Platyhelminthes means:

NTS 2017
Biology
Kingdom Animalia
Elimination Tool:

A) Flat worms

B) Roundworms

C) Segmented worms

D) None of the above

55 / 100

Category: Biology

Hemoglobin carries more oxygen than plasma by:

NUMS Mock 1
Biology
Gaseous Exchange

A) 50 times

B) 20 times

C) 70 times

D) 100 times

56 / 100

Category: Biology Ch 1 Class 12

The technique used for the non-surgical removal of kidney stones is called:

NUMS 2016
Biology
Homeostasis
Elimination Tool:

A) Ultrasound

B) Lithotripsy

C) Dialysis

D) X-rays

57 / 100

Category: Biology Ch 2 Class 11

Which of the following substance is most favorable to form structural component of biological membranes?

Hydrophilic Carbohydrates

Hydrophobic fats.

Both a and b

None of these

58 / 100

Category: Biology Ch 8 Class 11

Which of the following endoparasites of humans does show viviparity?

NTS 2018
Biology
Kingdom Fungi
Elimination Tool:

A) Trichinella spiralis

B) Ascaris lumbricoides

C) Ancylostoma duodenale

D) Enterobius vermicularis

59 / 100

Category: Biology Ch 10 Class 12

Most of the fossils are found in which of the following?

PMC Sample 1
Biology
Evolution
Elimination Tool:

A) Metamorphic rocks

B) soil

C) Volcanic mountains

D) Sedimentary rocks

60 / 100

Category: Biology

As pH of blood decreases, H+ ions increases, which combine the proteins part of hemoglobin, to decrease its ability to bind with:

NUMS Mock 2
Biology
Gaseous Exchange

A) O2

B) CO2

C) CO

D) H2

61 / 100

Category: Biology Ch 13 Class 11

Lungs are separated from abdominal cavity by a muscular sheath called:

NUMS 2018
Biology
Gaseous Exchange
Elimination Tool:

A) Pleura

B) Rib cage

C) Pericardium

D) Diaphragm

62 / 100

Category: Biology Ch 7 Class 11

Which type of chlorophyll is found in all types of algae?

NUMS 2015
Biology
Kingdom Protista
Elimination Tool:

A) Chlorophyll a

B) Chlorophyll b

C) Chlorophyll c

D) Chlorophyll d

63 / 100

Category: Biology Ch 2 Class 12

Which vertebrae together are called pelvic vertebrae?

NUMS 2020
Biology
Support and Movement
Elimination Tool:

A) Coccygeal and lumbar

B) Sacral and lumbar

C) Sacral and coccygeal

D) Sacral and thoracic

64 / 100

Category: Biology

In which of the following phases of bacterial growth, is the death rate more rapid than the multiplication rate?

NUMS Mock 2
Biology
Kingdom Prokaryote

A) Stationary phase

B) LAG phase

C) Decline phase

D) LOG phase

65 / 100

Category: Biology Ch 10 Class 12

Carolus Linnaeus was believer of

Special creation

Natural selection

Catastrophism

. Inheritance of acquired characters

66 / 100

Category: Biology Ch 10 Class 12

Most fossils are found in the

Metamorphic rocks

Soil

Sedimentary rocks

Volcanic mountains

67 / 100

Category: Biology Ch 7 Class 12

Which statement is not true about phragmoplast?

Formed from vesicle originating from Golgi apparatus

Present in plants only

Formed at the end of anaphase

Centre of dividing cell

68 / 100

Category: Biology Ch 9 Class 12

Which of the following is NOT true for genes used in recombinant DNA technology?

NUMS 2019 Reconduct
Biology
Biotechnology
Elimination Tool:

A) It can isolated from chromosome

B) It can be synthesized chemically

C) It can be made from protein

D) It can be made from mRNA

69 / 100

Category: Biology

Q.60 A small size gene can be get easily by/from:

A. From chromosome

B. Reverse transcription of mRNA

C. Chemically synthesized it

D. Genomic material

70 / 100

Category: Biology

Which organ(s) in the male reproductive system produce gametes?

NUMS Mock 4
Biology
Reproduction

A) Vas deferens

B) Malpighian tubule system

C) Seminiferous tubules

D) Ejaculatory duct

71 / 100

Category: Biology Ch 11 Class 11

Which is the correct order of energy transfer from assessory pigments to main photosynthetic pigment?

. Carotenoids ? Chlorophyll a ? Chlorophyll b.

Chlorophyll b ? Carotenoids ? Chlorophyll a.

. Carotenoids ? Chlorophyll b ? Chlorophyll a.

Chlorophyll a ? Chlorophyll b ? Carotenoids.

72 / 100

Category: Biology Ch 6 Class 12

The true E.Coli replicating enzyme is

DNA polymerase I

DNA polymerase II

DNA polymerase III

All of these

73 / 100

Category: Biology Ch 8 Class 11

Fungi which get their food directly from dead organic matter are called?

Parasitic fungi

Predators

Mutualists

Decomposers

74 / 100

Category: Biology Ch 4 Class 11

DNA is found in which of the following structures?

NUMS 2016
Biology
Cell Structure and Function
Elimination Tool:

A) Golgi complex

B) Lysosomes

C) Mitochondria

D) Ribosomes

75 / 100

Category: Biology Ch 10 Class 12

The actual remains or traces of organisms that lived in ancident geological times

Vestigial remains

Fossils

Fuel

None of these

76 / 100

Category: Biology Ch 1 Class 12

The human body maintains all of its cells’ internal concentration _____ to internal body fluid.

NUMS 2019 Cancelled
Biology
Homeostasis
Elimination Tool:

A) Isotonic

B) Hypotonic

C) Hypertonic

D) Hyposmotic

77 / 100

Category: Biology Ch 2 Class 11

Which one are most complex sugar:

Monosaccharides

Oligosaccharides

Polysaccharides

None of these

78 / 100

Category: Biology

The numbers of capsomeres found in adenovirus capsid is?

NUMS Mock 3
Biology
Bio-diversity | Variety of Life

A) 162

B) 200

C) 252

D) 155

79 / 100

Category: Biology Ch 5 Class 12

Amniotic fluid in human embryo protects it from:

NUMS 2014
Biology
Growth and Development
Elimination Tool:

A) Degeneration

C) Encasement

B) Jerks

D) None of these

80 / 100

Category: Biology Ch 5 Class 11

Viral disease that is widely spread and caused by enveloped RNA virus is:

NUMS 2015
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) AIDS

B) Hepatitis

C) Measles

D) Influenza

81 / 100

Category: Biology Ch 7 Class 11

In which of the following pigments major energy reserves and cell wall are like plants?

Rhodophyta

Chlorophyta

Phaeophyta

Chrysophyta

82 / 100

Category: Biology Ch 6 Class 11

The bacteria can cope in unfavorable condition by producing:

NUMS 2017
Biology
Kingdom Prokaryote
Elimination Tool:

A) Mesosomes

B) Zygospores

C) Endospores

D) Hyphae

83 / 100

Category: Biology Ch 11 Class 11

What is the function of Ribulose?

PMC 2020
Biology
Bioenergetics
Elimination Tool:

A) Intermediates in photosynthesis

B) Respiratory fuel

C) Intermediates in cellular respiration

D) Component of DNA and RNA

84 / 100

Category: Biology Ch 5 Class 11

Vaccines for all of these have been developed EXCEPT:

NUMS 2019 Reconduct
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Polio

B) Mumps

C) Measles

D) Cancer

85 / 100

Category: Biology Ch 3 Class 11

Restriction endonucleases

PMC Sample 2
Biology
Enzymes
Elimination Tool:

A) are bacterial enzyme

B) convert RNA to DNA

C) hydrolyze protein into amino acids

D) get mutated for DNA repair

86 / 100

Category: Biology

They serve as a scaffold for formation of higher order chromatin structure:

NUMS Mock 2
Biology
Cell Structure and Function

A) Nucleosome

B) Nucleus

C) Chromosomes

D) Histones

87 / 100

Category: Biology

Q.44 To produce ATP (adenosine triphosphate) in muscles, creatine phosphate (CP) transfers__________________ to adenosine diphosphate (ADP).

A. Oxygen

B. Adenosine

C. Cytosine

D. Phosphate

88 / 100

Category: Biology Ch 6 Class 12

A typical human chromosome contains _________ nucleotides in its DNA

240 million

140 million

150 million

160 million

89 / 100

Category: Biology Ch 1 Class 12

Urine formation is the result of:

NTS 2015 SMBBMC
Biology
Homeostasis
Elimination Tool:

A) Ultrafiltration

B) Reabsorption

C) Tubular secretion

D) All of the above

90 / 100

Category: Biology

Q.62 Which of the following is not a sterilization method for the control of bacteria?

A. Radiation

B. Filtration

C. High temperature

D. Antiseptics

91 / 100

Category: Biology Ch 13 Class 12

Which of the following is not correct for food web?

NUMS 2019 Cancelled
Biology
Man and His Environment
Elimination Tool:

A) Start with primary consumers

B) Formed from food chain

C) Stable than food chain

D) Complex with food chain

92 / 100

Category: Biology Ch 7 Class 11

Which of the following is TRUE about Amoebae?

PMC 2020
Biology
Kingdom Protista
Elimination Tool:

A) They have flagella

B) They are multicellular

C) They do not cause any disease in humans

D) They move by forming specialized cytoplasmic projections called pseudopodia

93 / 100

Category: Biology Ch 9 Class 11

Which one of the following types of cell are found in secondary xylem of angiosperms?

NTS 2015 DUHS and JSMU
Biology
Kingdom Plantae
Elimination Tool:

A) Tracheids parenchyma fibres collenchyma but no vessels

B) Vessels tracheids parenchyma collenchyma but no fibres

C) Vessels tracheids fibres collenchyma but no parenchyma

D) Vessels tracheids fibres parenchyma but no collenchyma

94 / 100

Category: Biology Ch 11 Class 11

Photophosphorylation takes place in the _____ of the chloroplasts:

PMC 2020
Biology
Bioenergetics
Elimination Tool:

A) Stroma

B) Granum

C) Inner membrane

D) Outer membrane

95 / 100

Category: Biology Ch 11 Class 11

RuBP + O2 —Rubisco—> PGA + _______

NTS 2016 DUHS & JSMU
Biology
Bioenergetics
Elimination Tool:

A) Phosphoglycerate

B) Phosphoglycolate

C) Glycerate

D) Glycolate

96 / 100

Category: Biology Ch 5 Class 11

Which one of the following is NOT a mode of transmission of AIDS?

NTS 2019
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Through unsterilized needles

B) Through contact with open wounds

D) Through holding hands

C) Through blood transfusion

97 / 100

Category: Biology

The bacteria can cope in unfavorable condition by producing:

NUMS Mock 4
Biology
Kingdom Prokaryote

A) Mesosomes

B) Zygospores

C) Endospores

D) Hyphae

98 / 100

Category: Biology

Q.48 Which of the following is incorrectly matched?

A. Glucagon- Beta cells

B. Corpus luteum- Progesterone

C. Insulin- Diabetes mellitus

D. Thyroid gland- Grave’s disease

99 / 100

Category: Biology Ch 4 Class 11

Tissue is a

PMC 2020
Biology
Cell Structure and Function
Elimination Tool:

A) group of cells

B) group of organs

C) group of tissues

D) group of organisms

100 / 100

Category: Biology

The number and sequence of amino acids along a polypeptide chain is called _______ structure of a protein.

NUMS Mock 2
Biology
Biological Molecules

A) Quaternary

B) Tertiary

C) Primary

D) Secondary

Your score is

The average score is 57%

Structured Practice for Best Entry Test Preparation

This topic-wise and chapter-wise practice test allows students to focus on individual biology concepts, including diagrams, processes, and conceptual questions. Regular practice enhances understanding, sharpens problem-solving skills, and builds confidence to tackle both board and competitive exam questions efficiently.

Free Resources for Best Entry Test Preparation

Students can access free Biology Practice Test 2 to systematically improve knowledge, recall, and problem-solving abilities. This test is suitable for FSC Board Exams as well as major entry tests, helping students perform better in the biology section. PLS Academy provides these resources to support students in their preparation.

JazakAllah