Biology Practice Test 2

Biology Practice Test 2 is designed to help students strengthen their understanding of key biological concepts, theories, and processes for competitive entry tests like MDCAT, NUMS, AKU, UET, ECAT, NTS, as well as FSC Board Exams. This test covers topics from molecular biology, cell division, human physiology, plant physiology, and more, helping students improve accuracy and retention.

PLS Academy

Get Access to 20 thousands+ MCQs Including Topical MCQs, Practice Tests, Mock Tests, Solved Past Papers, Flashcards, Notes, FLPS, and Much More.

UNLOCK PREMIUM🔐

2514

Created by Ali Durrani

MDCAT Practice Tests

Biology Practice Test 2

This is the Free Access to Limited MCQs. Enroll to PLS Boost Premium Bundle to Get More MCQs HERE

1 / 100

Category: Biology Ch 14 Class 11

The main cause of creation of tension between water molecules is ______ which helps to make water chains pulled up xylem sap.

NUMS 2019 Reconduct
Biology
Transport
Elimination Tool:

A) Root pressure

B) Imbibition

C) Water potential

D) Hydrogen bonding

2 / 100

Category: Biology Ch 4 Class 11

Resolution power of a compound microscope is

2.0 ?m

2-4 A

24 ?m

24 A

3 / 100

Category: Biology

Q.49 In reproduction, semen refers to which of the following?

A. fluid and sperms

B. Blood and water

C. Blood and sperms

D. Blood and fluid

4 / 100

Category: Biology Ch 6 Class 11

The process of recombination in prokaryotes takes place in which of the following ways?

PMC Sample 2
Biology
Kingdom Prokaryote
Elimination Tool:

A) transformation

B) conjugation

C) transduction

D) all of these

5 / 100

Category: Biology Ch 13 Class 11

Chest cavity is bounded by ribs and muscles on the sides, while the floor of chest cavity is called:

NUMS 2015
Biology
Gaseous Exchange
Elimination Tool:

A) Pleura

B) Alveoli

C) Chest cage

D) Diaphragm

6 / 100

Category: Biology Ch 4 Class 12

Testes are structures that produce:

NTS 2015 SMBBMC
Biology
Reproduction
Elimination Tool:

A) Spores

B) Sperms

C) Seeds

D) Ova

7 / 100

Category: Biology

Q.30 Arterial blood contains ___________of CO2/100 ml of blood:

8 / 100

Category: Biology Ch 2 Class 11

Mono-saccharides have a general formula represented by:

PMC 2020
Biology
Biological Molecules
Elimination Tool:

A) (CH2O)n

B) C(H2O)n

C) C2(H2O)n

D) C2(H2O)n

9 / 100

Category: Biology Ch 8 Class 11

Yeast reproduces by:

PMC 2021 Tested
Biology
Kingdom Fungi
Elimination Tool:

A) Budding

B) Sperm

C) Fission

D) Conidia

10 / 100

Category: Biology

Q.3 Which statement about cell membrane is incorrect?

A. Proteins are embedded in lipid bilayer

B. Cholesterol molecules are present in hydrophobic core

C. Central core is hydrophobic

D. Carbohydrates are present on both inner and outer face of the membrane

11 / 100

Category: Biology

The system involved in preparing our body in condition of stress and emergency:

NUMS Mock 2
Biology
Coordination and Control

A) Nervous system only

B) Endocrine system only

C) Both nervous & endocrine system

D) Both endocrine & exocrine

12 / 100

Category: Biology Ch 6 Class 12

Who discovered DNA?

P.A.Levene

Frederick Griffith

Friedrich Miescher

Rosalind Franklin

13 / 100

Category: Biology Ch 3 Class 11

Enzymes binds with chemical reactant which is known as?

PMC Sample 3
Biology
Enzymes
Elimination Tool:

A) product

C) substrate

B) reactant

D) all of these

14 / 100

Category: Biology

Q.32 Which one of the following is not a feature of the nervous system of Planaria?

A. Neurons are differentiated into sensory, motor and associative neurons.

B. Nerves are present.

C. No specialized sensory organs are present

D. All of the above.

15 / 100

Category: Biology

Q.59 Which of the following is not an evidence for evolution?

A. Fossil record

B. Common ancestor organisms

C. Vestigial structures

D. none of these

16 / 100

Category: Biology Ch 10 Class 11

The simplest form in Kingdom Animalia belongs to:

NUMS 2018
Biology
Kingdom Animalia
Elimination Tool:

A) Eumetazoa

B) Bilateria

C) Protozoa

D) Parazoa

17 / 100

Category: Biology

To overcome infertility, which technique is used?

NUMS Mock 4
Biology
Reproduction

A) In vitro fertilization

B) In vivo fertilization

C) Both Options A and B are correct

D) None of these options is correct

18 / 100

Category: Biology

Q.63 Ozone depletion is commonly caused by:

A. CFC’s

B. Industrial smoke

C. Nitrogen gases

D. Green house gases

19 / 100

Category: Biology Ch 1 Class 12

Malpighian tubules are involved in excretion in:

NTS 2011
Biology
Homeostasis
Elimination Tool:

A) Cockroach

B) Earthworm

C) Human

D) Planaria

20 / 100

Category: Biology Ch 12 Class 11

Chlorosis refers to the lack of:

NUMS 2016
Biology
Nutrition
Elimination Tool:

A) Growth

B) Chlorophyll

C) Yellowing of leaf margin

D) Width of leaf

21 / 100

Category: Biology

Q.47 The chemical nature of oxytocin is:

A. Protein

B. Amino acid derivative

C. Polypeptide

D. Steroid Incorrect

22 / 100

Category: Biology Ch 13 Class 11

The oxygen-binding protein present in skeletal muscles is:

NUMS 2017
Biology
Gaseous Exchange
Elimination Tool:

A) Globin

B) Glycogen

C) Myo Glycogen

D) Myoglobin

23 / 100

Category: Biology Ch 2 Class 11

Which of the following has the ability to develop ester linkage with the OH group of Pentose sugar?

NUMS 2015
Biology
Biological Molecules
Elimination Tool:

A) Purine

B) Pyrimidine

C) H3PO4

D) HNO3

24 / 100

Category: Biology Ch 6 Class 11

Which of the following bacteria possesses a spherical shape?

PMC Practice 4
Biology
Kingdom Prokaryote
Elimination Tool:

A) Bacillus anthracis

B) Escherichia coli

C) Spirillum minus

D) Staphylococcus aureus

25 / 100

Category: Biology Ch 3 Class 12

Direction of reflex action is from:

NUMS 2019 Reconduct
Biology
Coordination and Control
Elimination Tool:

A) Receptor to sensory neuron to motor neuron and then through associative neurons to effect.

B) Receptor to sensory neuron to associative neuron and then through motor neurons to effector.

C) Effector to sensory neuron to associative neuron and then through motor neurons to Receptor.

D) Effector to sensory neuron to motor neuron and then through associative neurons to Receptor.

26 / 100

Category: Biology Ch 6 Class 12

Haploid and monoploid numbers of chromosomes of hexaploid wheat are:

NTS 2014
Biology
Chromosomes and DNA
Elimination Tool:

A) 21 and 42

B) 7 and 21

C) 21 and 7

D) 42 and 21

27 / 100

Category: Biology Ch 6 Class 12

A tortion of chromatin that is condensed only during cell division is

Euchromatin

Heterochromatin

Biochromatin

Nucleochromatin

28 / 100

Category: Biology Ch 9 Class 12

Passive immunity is used against:

UHS 2015
Biology
Biotechnology
Elimination Tool:

A) Malaria

B) Typhoid

C) Dengue

D) Tetanus

29 / 100

Category: Biology Ch 13 Class 12

Flow of energy in an ecosystem is:

NUMS 2014
Biology
Man and His Environment
Elimination Tool:

A) Unidirectional

B) Tridirectional

C) Multidirectional

D) Bidirectional

30 / 100

Category: Biology Ch 12 Class 11

Which process takes place during the movement of glucose from the body fluid to the blood?

NUMS 2016
Biology
Nutrition
Elimination Tool:

A) Endosmosis

B) Osmosis

C) Active transport

D) Facilitated diffusion

31 / 100

Category: Biology Ch 9 Class 12

Human genome is ______ times larger than any other genome sequenced so far

32 / 100

Category: Biology Ch 3 Class 11

A reaction will proceed faster if the activation energy is?

PMC Sample 1
Biology
Enzymes
Elimination Tool:

A) High

B) Low

C) Remains the same

D) None of these options is correct

33 / 100

Category: Biology

Q.28 Flame cells in Planaria constitute the:

A. Digestive system

B. Reproductive system

C. Respiratory system

D. Excretory system

34 / 100

Category: Biology Ch 8 Class 12

Pick the correct option about Drosophila.

NUMS 2015
Biology
Variation and Genetics
Elimination Tool:

A) The Male is larger with a pointed abdomen

B) The female has sex combs on its front legs

C) It has a generation time of just eight weeks

D) Salivary gland cells have giant chromosomes in their nuclei

35 / 100

Category: Biology Ch 7 Class 12

During which stage of meiosis do centromeres divide?

NTS 2016 DUHS & JSMU
Biology
Cell Cycle
Elimination Tool:

A) Prophase I

B) Metaphase I

C) Prophase II

D) Metaphase II

36 / 100

Category: Biology Ch 12 Class 11

Puccinia is a parasitic:

Plant

Fungus

Animal

Algae

37 / 100

Category: Biology Ch 5 Class 11

Syphilis is caused by:

NUMS 2018
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Coccus

B) Bacillus

C) Spirillum

D) Spirochete

38 / 100

Category: Biology Ch 6 Class 11

Bacteria having a tuft of flagella at one end are called:

NTS 2017
Biology
Kingdom Prokaryote
Elimination Tool:

A) Peritrichous

B) Monotrichous

C) Lophotrichous

D) Amphitrichous

39 / 100

Category: Biology

Q.31 Due to short distance between lungs and heart, walls of right ventricle are:

A. Thicker than left ventricle

B. Thicker than right atrium

C. Thinner than right atrium

D. Thinner than left ventricle

40 / 100

Category: Biology Ch 5 Class 11

Viruses without nuclear envelope is called as?

PMC Sample 1
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) icosahedral virus

B) naked virus

C) enveloped virus

D) bilayer virus

41 / 100

Category: Biology

Which trait is not sex-linked recessive:

NUMS Mock 2
Biology
Variation and Genetics

A) Haemophilia

B) Colour blindness

C) Hypophosphatemia

D) TFM syndrome

42 / 100

Category: Biology

Q.17 Teichoic acids are the characters of:

A. Gram Positive bacteria

B. Mycoplasma

C. Gram Negative bacteria

D. Archaeobacteria

43 / 100

Category: Biology Ch 11 Class 11

How does chemosynthesis differ from photosynthesis?

NUMS 2020
Biology
Bioenergetics
Elimination Tool:

A) Source of energy to carry out the reaction

B) Production of organic compounds

C) Reduction of CO2

D) Carried out by bacteria

44 / 100

Category: Biology Ch 11 Class 11

Estimating relative CO2 consumption or O2 release during photosynthesis at different wavelengths of light, is termed as:

NUMS 2019 Reconduct
Biology
Bioenergetics
Elimination Tool:

A) Action spectrum

B) Absorption spectrum

C) Dark reaction

D) Light reaction

45 / 100

Category: Biology Ch 2 Class 11

Ribose sugar that is the main part of RNA is a type of _____ sugar.

NUMS 2019 Reconduct
Biology
Biological Molecules
Elimination Tool:

A) Triose

B) Tetrose

C) Pentose

D) Hexose

46 / 100

Category: Biology Ch 2 Class 11

Peptide bonds are formed between:

NUMS 2014
Biology
Biological Molecules
Elimination Tool:

A) Hydrogen groups of adjacent amino acids

B) Non-functional groups of the amino acids

C) Carboxyl groups and amino groups

D) Functional groups and hydrogen groups of adjacent amino acids

47 / 100

Category: Biology Ch 2 Class 12

Unpaired facial bones are:

NUMS 2018
Biology
Support and Movement
Elimination Tool:

A) Maxilla, Zygomatic

B) Palatine, Inferior concha

C) Nasal, Lacrimal

D) Mandible, Vomer

48 / 100

Category: Biology Ch 4 Class 12

Which one of the following represents the changes that occur in the ovary and the uterus approximately every 28 days involving ovulation with the breakdown and loss of the lining of the uterus?

PMC 2020
Biology
Reproduction
Elimination Tool:

A) Ovulation

B) Menstrual cycle

C) Uterine cycle

D) Embryo formation

49 / 100

Category: Biology Ch 8 Class 12

In the pea plants, the factors round and yellow seeds (RRYY) is dominant over wrinkled and green seeds (rryy). Keeping this in mind, identify the seed that has the genotype round and green.

NTS 2011
Biology
Variation and Genetics
Elimination Tool:

A) Rryy

B) rrYy

C) RrYy

D) RRYy

50 / 100

Category: Biology Ch 8 Class 12

Mendel concluded that each organism has two hereditary factors for each trait, now called:

NTS 2015 SMBBMC
Biology
Variation and Genetics
Elimination Tool:

A) Chromatids

B) Alleles

C) Chromosomes

D) None of the above

51 / 100

Category: Biology Ch 9 Class 12

The technique use of identification of criminals is called:

NTS 2018
Biology
Biotechnology
Elimination Tool:

A) Cloning

B) DNA fingerprinting

C) Restriction Analysis

D) Polymorphism

52 / 100

Category: Biology Ch 4 Class 11

Spherical or tubular membranes which separate the material present in endoplasmic reticulum from that of cytoplasmic material are called

Cytosol

Cisternae

Polysomes

Cristae

53 / 100

Category: Biology Ch 10 Class 12

Which of the following theories or evolution can best explain the vestigial organs.

NUMS 2014
Biology
Evolution
Elimination Tool:

A) Darwinism

B) Lamarckism

C) Natural selection

D) Special creation

54 / 100

Category: Biology Ch 5 Class 12

Amniotic fluid in human embryo protects it from:

NUMS 2014
Biology
Growth and Development
Elimination Tool:

A) Degeneration

C) Encasement

B) Jerks

D) None of these

55 / 100

Category: Biology Ch 5 Class 12

Wood is not formed in:

NUMS 2015
Biology
Growth and Development
Elimination Tool:

A) Monocots

B) Dicots

C) Gymnosperms

D) All of given

56 / 100

Category: Biology Ch 6 Class 12

Central dogma is

Transfer of information from DNA to mRNA

Basic mechanism of reading and expressing genes

Transfer of information from RNA to proteins

Synthesis of all three types of RNA

57 / 100

Category: Biology Ch 1 Class 12

Which of the following types of transpiration account for 5 – 7 % of total transpiration that take place in plants?

NUMS 2019 Cancelled
Biology
Homeostasis
Elimination Tool:

A) Cuticular

B) Lenticular

C) Stomatal

D) Leaves

58 / 100

Category: Biology Ch 7 Class 11

Golden algae are also known as

Chrysophyta

Phaeophyta

Pyrrophyta

Rhodophyta

59 / 100

Category: Biology Ch 4 Class 11

Percentage of proteins in cell membrane is

20-40%

40-50%

60-80%

80-100%

60 / 100

Category: Biology Ch 2 Class 11

NAD is an example of:

PMC 2020
Biology
Biological Molecules
Elimination Tool:

A) Mononucleotide

B) Dinucleotide

C) Trinucleotide

D) Tetranucleotide

61 / 100

Category: Biology

Red-green color-blindness is an X-linked recessive disorder. Jacob’s paternal grandfather and father are both color-blind, but his mother has two normal alleles. What is the probability that Jacob is red-green color-blind?

NUMS Mock 2
Biology
Variation and Genetics

A) 0%

B) 25%

C) 50%

D) 75%

62 / 100

Category: Biology Ch 4 Class 11

The first layer of cell wall which is formed is:

Primary wall

Secondary wall

Middle lamella

All of these

63 / 100

Category: Biology Ch 3 Class 12

Resting membrane potential of neurons is _______, while during active membrane potential the inner membrane surface becomes more _____ than the outside.

NUMS 2019 Reconduct
Biology
Coordination and Control
Elimination Tool:

A) +70 mV ; negative

B) -70 mV ; negative

C) +70 mV ; positive

D) -70 mV ; positive

64 / 100

Category: Biology Ch 5 Class 11

The viruses are:

NTS 2011
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Cellular

B) Prokaryotes

C) Non-cellular

D) Eukaryotes

65 / 100

Category: Biology Ch 3 Class 12

Chemically auxins are

Indole propionic acid.

Indole carboxylic acid.

Indole acetaldehyde

Indole acetic acid

66 / 100

Category: Biology Ch 9 Class 12

The process of replacing or supplementing the defective allele with a functional, normal allele is known as ______.

NTS 2012
Biology
Biotechnology
Elimination Tool:

A) Allele transplant

B) Physiotherapy

C) Gene therapy

D) Mutation

67 / 100

Category: Biology

Which of the following photosystems is involved in cyclic photophosphorylation?

NUMS Mock 2
Biology
Bioenergetics

A) PS II

B) PS I

C) PS I and PS II

D) PS III

68 / 100

Category: Biology Ch 12 Class 11

Parasites capable of living independently of its host at times is called as _______ parasite.

Obligate

Strict

Facultative

Endoparasite

69 / 100

Category: Biology

Eukaryotic, multicellular, and consumers belong to ______ kingdom.

NUMS Mock 3
Biology
Bio-diversity | Variety of Life

A) Monera

B) Protista

C) Fungi

D) Animalia

70 / 100

Category: Biology Ch 4 Class 12

Seeds are dormant in conditions of

Water scarcity

Low temperature

Harsh winters

All of these

71 / 100

Category: Biology Ch 4 Class 11

Which one of the following combinations is NOT the part of an animal cell?

NUMS 2019 Reconduct
Biology
Cell Structure and Function
Elimination Tool:

A) Central vacuole, Cell Membrane, Ribosomes

B) Chloroplast, Ribosome , Mitochondrion

C) Cell wall, Chloroplast, Central vacuole

D) Ribosome, Mitochondrion, Cell wall

72 / 100

Category: Biology Ch 4 Class 12

In cloning, nucleus is introduced into

Somatic cell

Egg cell

Sperm cell

None of thes

73 / 100

Category: Biology Ch 8 Class 11

The most common example of members of the kingdom fungi is/are:

NUMS 2017
Biology
Kingdom Fungi
Elimination Tool:

A) Starfish

B) Mushrooms

C) Algae

D) Human

74 / 100

Category: Biology Ch 6 Class 11

Vibrio cholera is an example of ______ type of bacteria.

NUMS 2017
Biology
Kingdom Prokaryote
Elimination Tool:

A) Cocci

B) Bacilli

C) Spirilla

D) Commas

75 / 100

Category: Biology Ch 2 Class 11

5 different amino acids, numbered 1, 2, 3, 4, and 5, below from the following sequence in the path of a polypeptide chain:

1-2-3-4-2-5-3

Messenger RNA codon, which correspond to the amino acids, are:
amino acid 1 UGU

amino acid 2 GAU

amino acid 3 CAC

amino acid 4 UAG

amino acid 5 AAG

Which one of the following DNA bases sequences could provide the code for the given section of the polypeptide?

NTS 2015 DUHS and JSMU
Biology
Biological Molecules
Elimination Tool:

A) ACACTTGTGATGCTATTCGTG

B) ACACUAGUGAUGCUAUUCGUG

C) ACACTAGTGATGCTAAACGTG

D) ACACTAGTGATCCTATTCGTG

76 / 100

Category: Biology Ch 3 Class 11

Which of the following statements is incorrect?

PMC Practice 1
Biology
Enzymes
Elimination Tool:

A) The competitive inhibitor affects the rate of breakdown of the enzyme-substrate complex

B) The presence of the competitive inhibitor decreases the Km of the enzyme for the substrate

C) A competitive inhibitor reacts reversibly with the enzyme to form an enzyme-inhibitor complex

D) In competitive inhibition, the inhibitor molecule is not chemically changed by the enzyme

77 / 100

Category: Biology Ch 8 Class 12

Two animals are mated. One is homozygous dominant for one character and homozygous recessive for another. The other animal Is heterozygous for both characters. How many phenotypes are expected in the offspring of this cross?

NTS 2016 DUHS & JSMU
Biology
Variation and Genetics
Elimination Tool:

A) 1

B) 2

C) 3

D) 4

78 / 100

Category: Biology Ch 4 Class 11

In which type of cells, cell wall is not present?

PMC 2020
Biology
Cell Structure and Function
Elimination Tool:

A) Plant cells

B) Fungal cells

C) Bacterial cells

D) Liver cells

79 / 100

Category: Biology Ch 10 Class 12

Inheritance of acquired characteristics is based on:

NTS 2016 DUHS & JSMU
Biology
Evolution
Elimination Tool:

A) Genetic role in reproduction

B) Use and disuse of organ

C) Survival of the fittest

D) Mutations

80 / 100

Category: Biology

Q.18 The internal buds are known as which of the following?

A. Spicules

B. Choanocytes

C. Gemmules

D. Both A and B

81 / 100

Category: Biology Ch 12 Class 11

Amylase is not produced by the following type(s) of salivary gland:

NUMS 2015
Biology
Nutrition
Elimination Tool:

A) Parotid

B) Submandibular

C) Sublingual

D) None of the given options are correct

82 / 100

Category: Biology

Q.14 Protein coat of a virus enclosing nucleic acid is called?

A. Vector

B. Capsid

C. Plasmid

D. Genome

83 / 100

Category: Biology Ch 4 Class 11

A group of ribosomes attached to mRNA is known as

Polymer

Polypeptide

Polysomes

Monomer

84 / 100

Category: Biology Ch 10 Class 12

Change in frequency of alleles that occurs by chance Is called as:

UHS 2019
Biology
Evolution
Elimination Tool:

A) Genetic drift

B) Mutation

C) Migration

D) Natural selection

85 / 100

Category: Biology

The prolactin hormone, responsible for the activation of mammary glands to start producing milk, is a hormone of the:

NUMS Mock 3
Biology
Coordination and Control

A) Pituitary gland

B) Pancreas

C) Thyroid gland

D) Thymus gland

86 / 100

Category: Biology Ch 1 Class 12

The human body maintains all of its cells’ internal concentration _____ to internal body fluid.

NUMS 2019 Cancelled
Biology
Homeostasis
Elimination Tool:

A) Isotonic

B) Hypotonic

C) Hypertonic

D) Hyposmotic

87 / 100

Category: Biology Ch 3 Class 12

Deficient production of hormones by adrenal glands results in: .

NTS 2011
Biology
Coordination and Control
Elimination Tool:

A) Cushing's syndrome

B) Addison's disease

C) Diabetes Mellitus

D) Goiter

88 / 100

Category: Biology Ch 8 Class 11

The most common example of members of the kingdom fungi is/are:

NUMS 2019 Reconduct
Biology
Kingdom Fungi
Elimination Tool:

A) Star fish

B) Mushrooms

C) Algae

D) Human

89 / 100

Category: Biology Ch 6 Class 12

A fern has _____ pairs of chromosomes.

NTS 2012
Biology
Chromosomes and DNA
Elimination Tool:

A) 23

B) 40

C) 500

D) 13

90 / 100

Category: Biology Ch 3 Class 11

The effect of competitive inhibitor on enzyme activity is such that it affects which of the following?

PMC Sample 2
Biology
Enzymes
Elimination Tool:

A) Increases enzyme activity

B) Doesn't change enzyme activity

C) Decreases enzyme activity

D) None of these options is correct

91 / 100

Category: Biology

In chemiosmosis, the proton (H+) moves from _______.

NUMS Mock 4
Biology
Bioenergetics

A) Stroma to Lumen

B) Cytoplasm to Stroma

C) Lumen to Stroma

D) Stroma to cytoplasm

92 / 100

Category: Biology

Q.47 Which of the following are believed to have common origin with annelids?

A. Nematodes

B. Arthropods

C. Molluses

D. None of these

93 / 100

Category: Biology Ch 1 Class 12

Deamination in the liver initially produces:

NTS 2010
Biology
Homeostasis
Elimination Tool:

A) Ammonia

B) Arginine

C) Ornithine

D) Urea

94 / 100

Category: Biology Ch 7 Class 12

Gametes are produced by:

PMC 2021 Tested
Biology
Cell Cycle
Elimination Tool:

A) Meiosis

B) Mitosis

C) None of these

D) Fission

95 / 100

Category: Biology

Steroids consist of _____ 6 membered carbon rings and one 5 membered carbon ring.

NUMS Mock 4
Biology
Biological Molecules

A) Four

B) Three

C) Two

D) Five

96 / 100

Category: Biology Ch 8 Class 11

Parasitic fungi absorb nutrients directly from the living host cytoplasm with the help of special hyphal tips called

Mildew

Constricting ring

Haustoria

All of thes

97 / 100

Category: Biology Ch 3 Class 12

Cell membrane under resting conditions is impermeable to all the ions except

Na+

. K+

Cl-

PO4-2

98 / 100

Category: Biology Ch 4 Class 11

Which of the following cell organelles involved in the synthesis of cell wall and middle lamella?

PMC 2020
Biology
Cell Structure and Function
Elimination Tool:

A) Endoplasmic reticulum

B) Golgi apparatus

C) Lysosomes

D) Peroxisomes

99 / 100

Category: Biology Ch 9 Class 12

Which one has antibiotic resistance gene for tetracycline and ampicillin?

pSC 101

pBR 322

pCR 322

None of these

100 / 100

Category: Biology

Q.15 Urethra and vagina have openings to the exterior:

A. common

B. independent

C. Both A and B

D. None of these

Your score is

The average score is 57%

Structured Practice for Best Entry Test Preparation

This topic-wise and chapter-wise practice test allows students to focus on individual biology concepts, including diagrams, processes, and conceptual questions. Regular practice enhances understanding, sharpens problem-solving skills, and builds confidence to tackle both board and competitive exam questions efficiently.

Free Resources for Best Entry Test Preparation

Students can access free Biology Practice Test 2 to systematically improve knowledge, recall, and problem-solving abilities. This test is suitable for FSC Board Exams as well as major entry tests, helping students perform better in the biology section. PLS Academy provides these resources to support students in their preparation.

JazakAllah