Biology Practice Test 2

Biology Practice Test 2 is designed to help students strengthen their understanding of key biological concepts, theories, and processes for competitive entry tests like MDCAT, NUMS, AKU, UET, ECAT, NTS, as well as FSC Board Exams. This test covers topics from molecular biology, cell division, human physiology, plant physiology, and more, helping students improve accuracy and retention.

PLS Academy

Get Access to 20 thousands+ MCQs Including Topical MCQs, Practice Tests, Mock Tests, Solved Past Papers, Flashcards, Notes, FLPS, and Much More.

UNLOCK PREMIUM🔐

2519

Created by Ali Durrani

MDCAT Practice Tests

Biology Practice Test 2

This is the Free Access to Limited MCQs. Enroll to PLS Boost Premium Bundle to Get More MCQs HERE

1 / 100

Category: Biology Ch 7 Class 12

In case of neurons, post mitotic cell escapes cell cycle and remain in _______ phase whthout proliferating further

G0 phase

G1 phase

G2 phase

S phase

2 / 100

Category: Biology

Two species can avoid competition and better use the environment’s resources by occupying different ____.

NUMS Mock 4
Biology
Evolution

A) Adaptations

B) Polymorphism

C) Niches

D) Specialization

3 / 100

Category: Biology

Transport of glucose across the cell membrane occurs by:

NUMS Mock 1
Biology
Cell Structure and Function

A) Simple diffusion

B) Facilitated diffusion

C) Osmosis

D) Primary active transport

4 / 100

Category: Biology Ch 13 Class 11

Pharynx leads air into _____ through glottis.

NTS 2012
Biology
Gaseous Exchange
Elimination Tool:

A) Trachea

B) Bronchus

C) Alveoli

E) Larynx

5 / 100

Category: Biology

As an excretory organ, liver:

NUMS Mock 3
Biology
Homeostasis

A) Detoxifies many chemical poisons

B) Produces ammonia for excretion by the kidneys

C) Produces urea and uric acids from the nitrogen of amino acids

D) All of the above

6 / 100

Category: Biology Ch 11 Class 11

Which component enters into mitochondria after glycolysis?

NUMS 2015
Biology
Bioenergetics
Elimination Tool:

A) Pyruvate

B) Acetate

C) Oxaloacetate

D) Acetyl – CoA

7 / 100

Category: Biology Ch 1 Class 11

Which one is a micromolecule?

Polysaccharide

Protein

Hemoglobin

ATP

8 / 100

Category: Biology

Bones of the skull are joined by:

NUMS Mock 2
Biology
Support and Movement

A) Fixed joints

B) Sliding joints

C) Pivot joints

D) Hinge joints

9 / 100

Category: Biology Ch 7 Class 12

Which of the following statements is true about metaphase?

PMC 2021 Tested
Biology
Cell Cycle
Elimination Tool:

A) Chromosomes are thickest during this phase

B) Chromosomes are shortest during this phase

C) Chromosomes are longest during this phase

D) Chromosomes are shortest and thickest during this phase

10 / 100

Category: Biology Ch 4 Class 12

Example of ovoviviparous

Reptiles

Mammal s

Duckbill platypus

Frog

11 / 100

Category: Biology Ch 13 Class 11

Lungs are covered with double layered thin membranous sac called

Disphragm

Pleura

Pericardium

Rib cage

12 / 100

Category: Biology Ch 13 Class 12

Overgrazing results in:

NUMS 2019 Cancelled
Biology
Man and His Environment
Elimination Tool:

A) Totally barren lands

B) Good pastured lands

C) Salinity

D) Rocky areas

13 / 100

Category: Biology

Q.28 The enzyme which plays important role in HIV pathogenesis

A. RNA polymerase I

B. DNA polymerase II

C. Reverse Transcriptase I

D. Reverse Transcriptase

14 / 100

Category: Biology Ch 7 Class 12

DNA is synthesized and chromosome number is doubled in

G1 phase

S phase

G2 phase

G0 phase

15 / 100

Category: Biology

Q.32 Which one of the following is not a feature of the nervous system of Planaria?

A. Neurons are differentiated into sensory, motor and associative neurons.

B. Nerves are present.

C. No specialized sensory organs are present

D. All of the above.

16 / 100

Category: Biology Ch 2 Class 12

Which of the following sets of bones does not included in the axial skeleton?

NUMS 2019 Cancelled
Biology
Support and Movement
Elimination Tool:

A) Cranium and facial bones

B) Sternum, ribs, vertebrae

C) Lumbar, Thoracic and pelvic bones

D) Pectoral girdles, pelvic girdle, and appendages

17 / 100

Category: Biology Ch 5 Class 11

A bacteriophage consists solely of:

NTS 2011
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) DNA and protein

B) RNA and protein

C) RNA only

D) Protein only

18 / 100

Category: Biology Ch 14 Class 11

Identify the incorrect statement from the following:

NTS 2010
Biology
Transport
Elimination Tool:

A) Apical growth increases the length of stems and roots.

B) Xylem is situated on the outer side of the cambium ring and the phloem on the inner side.

C) Secondary growth increases the diameter of stems and roots.

D) The cells in the elongation phase don't divide.

19 / 100

Category: Biology

Q37 An entire skeletal muscle is surrounded by

A. Sarcolemma

B. Epimysium

C. Both A and B

D. Microtubules

20 / 100

Category: Biology Ch 6 Class 11

A bacterial cell envelope of mollicutes does not include?

PMC Sample 1
Biology
Kingdom Prokaryote
Elimination Tool:

A) Slime

B) Capsule

C) Cell wall

D) Cell membrane

21 / 100

Category: Biology Ch 5 Class 11

Where can viruses replicate?

PMC Sample 1
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Animals

B) Plants

C) Bacteria

D) All of these options are correct

22 / 100

Category: Biology Ch 8 Class 12

The type of gene interaction in which the effect caused by a gene at one locus interfere with the effect caused by another gene at another locus is known as:

NUMS 2018
Biology
Variation and Genetics
Elimination Tool:

A) Pleiotropy

B) Epistasis

C) Polygenic inheritance

D) Gene linkage

23 / 100

Category: Biology Ch 9 Class 12

Passive immunity is used against:

UHS 2015
Biology
Biotechnology
Elimination Tool:

A) Malaria

B) Typhoid

C) Dengue

D) Tetanus

24 / 100

Category: Biology

Q.11 Which of the following statement regarding lecithin is correct?

A. Contain only one fatty acid

B. Choline attached with phosphatidic acid at carbon 3

C. Phosphate group is positively charged

D. Have five carbon glycerol molecules

25 / 100

Category: Biology Ch 6 Class 11

Germ theory of disease has ______ postulates

26 / 100

Category: Biology Ch 9 Class 12

The technique use of identification of criminals is called:

NTS 2018
Biology
Biotechnology
Elimination Tool:

A) Cloning

B) DNA fingerprinting

C) Restriction Analysis

D) Polymorphism

27 / 100

Category: Biology

The table shows the characteristics of the blood in one blood vessel in the body.

Which blood vessel contains blood with these characteristics?

NUMS Mock 1
Biology
Transport

A) Aorta

B) Pulmonary artery

C) Pulmonary vein

D) Vena cava

28 / 100

Category: Biology

When were bacteriophages discovered by Twort?

NUMS Mock 2
Biology
Bio-diversity | Variety of Life
Variety of Life

A) 1915

B) 1920

C) 1910

D) 1820

29 / 100

Category: Biology Ch 2 Class 11

5 different amino acids, numbered 1, 2, 3, 4, and 5, below from the following sequence in the path of a polypeptide chain:

1-2-3-4-2-5-3

Messenger RNA codon, which correspond to the amino acids, are:
amino acid 1 UGU

amino acid 2 GAU

amino acid 3 CAC

amino acid 4 UAG

amino acid 5 AAG

Which one of the following DNA bases sequences could provide the code for the given section of the polypeptide?

NTS 2015 DUHS and JSMU
Biology
Biological Molecules
Elimination Tool:

A) ACACTTGTGATGCTATTCGTG

B) ACACUAGUGAUGCUAUUCGUG

C) ACACTAGTGATGCTAAACGTG

D) ACACTAGTGATCCTATTCGTG

30 / 100

Category: Biology Ch 2 Class 11

Reactive parts of an amino acid are:

NUMS 2015
Biology
Biological Molecules
Elimination Tool:

A) Alpha carbon & amino group

C) Carboxyl & R group

B) Amino group & carboxyl group

D) R group & alpha carbon

31 / 100

Category: Biology Ch 7 Class 11

Lime stone deposits are formed from

Zooflagellates

Foraminferans

Aetinopods

Apicomplexans

32 / 100

Category: Biology Ch 4 Class 12

Fallopian tube in humans is important for:

NUMS 2018
Biology
Reproduction
Elimination Tool:

A) Ovulation

B) Primary oocyte

D) Ova

C) Secondary oocyte

33 / 100

Category: Biology Ch 7 Class 11

Golden algae are also known as

Chrysophyta

Phaeophyta

Pyrrophyta

Rhodophyta

34 / 100

Category: Biology Ch 8 Class 12

How many pairs of homologous chromosomes are present in Pisum sativum

Five pairs

Six pairs

Seven pairs

Eight pairs

35 / 100

Category: Biology Ch 5 Class 11

The size of smallest virus is:

10 nm

20 nm

30 nm

40 nm

36 / 100

Category: Biology Ch 5 Class 12

Microcephaly, the small sized skull is due to:

NUMS 2016
Biology
Growth and Development
Elimination Tool:

A) Nutritional causes

B) Skeleton causes

C) Hormonal causes

D) Genetic defects

37 / 100

Category: Biology Ch 4 Class 11

Protein layers which are NOT continuous on the surface make ________ percent of total in plasma membrane.

NUMS 2019 Cancelled
Biology
Cell Structure and Function
Elimination Tool:

A) 50 – 60

B) 60 – 70

C) 60 – 80

D) 70 – 80

38 / 100

Category: Biology

Lock and Key Model for enzyme action propose by Emil Fischer suggests that:

NUMS Mock 4
Biology
Enzymes

A) Enzymes are unbiased for the substrate

B) Enzymes can modify their active sites

C) Enzymes are restricted to one reaction type

D) An enzyme can catalyze variety of reactions

39 / 100

Category: Biology Ch 1 Class 12

High level of _____ and _____ in the blood and the contributing factors in the formation of kidney stones.

NUMS 2018
Biology
Homeostasis
Elimination Tool:

A) Calcium, oxalate

B) Calcium, magnesium

C) Calcium, sodium

D) Sodium, sulphate

40 / 100

Category: Biology

What type of virus is the smallpox virus?

NUMS Mock 1
Biology
Bio-diversity | Variety of Life

A) DNA enveloped virus

B) RNA enveloped virus

C) DNA virus

D) RNA naked virus

41 / 100

Category: Biology Ch 4 Class 12

In asexual reproduction offspring are produced by which of the following?

PMC Sample 2
Biology
Reproduction
Elimination Tool:

A) meiosis

B) mitosis

C) both a and b

D) none of these

42 / 100

Category: Biology Ch 13 Class 11

In most birds air sacs are _____ in number

43 / 100

Category: Biology Ch 9 Class 11

The release of droplets of water from hydathodes is called:

PMC 2021 Tested
Biology
Kingdom Plantae
Elimination Tool:

A) Respiration

B) Guttation

C) Vaporization

D) Transportation

44 / 100

Category: Biology Ch 4 Class 11

The second most abundant bio element in the human body is:

NUMS 2020
Biology
Cell Structure and Function
Elimination Tool:

A) Oxygen

B) Carbon

C) Hydrogen

D) Nitrogen

45 / 100

Category: Biology

Which of the following compounds possesses a single covalent bond between carbon and hydrogen?

NUMS Mock 4
Chemistry
Hydrocarbons

A) CH4

B) C2H2

C) C2H4

D) All of the above

46 / 100

Category: Biology

Q.21 All of the following are true for platyhelminthes except:

A. Flatworms

B. Triploblastic

C. Coelomates

D. Bilateral symmetry

47 / 100

Category: Biology

Q.51 The heavy and light chains of an antibody molecule is held together by:

A. H-bonds

B. Disulphide bridges

C. Ionic interactions

D. Hydrophobic interactions

48 / 100

Category: Biology Ch 13 Class 12

Wild life refers to

All plants of the world

All non cultivated plant

Non domesticated animals

Both b and c

49 / 100

Category: Biology Ch 2 Class 11

Which of the following has the ability to develop ester linkage with the OH group of Pentose sugar?

NUMS 2015
Biology
Biological Molecules
Elimination Tool:

A) Purine

B) Pyrimidine

C) H3PO4

D) HNO3

50 / 100

Category: Biology Ch 5 Class 11

Chicken pox is caused by:

NTS 2011
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Hepatitis A virus

B) Varicella zoster virus

C) Influenza virus

D) Human immunodeficiency virus

51 / 100

Category: Biology

In the commercial manufacture of insulin, a human gene is inserted into which one of the following?

NUMS Mock 1
Biology
Biotechnology

A) A chromosome of a human cell

B) A protein molecule in a yeast cell

C) The DNA of a bacterium

D) The nucleic acid in a virus

52 / 100

Category: Biology Ch 5 Class 12

Typical symptoms like enlarged breasts and small testis in male are attributed to:

UHS 2015
Biology
Growth and Development
Elimination Tool:

A) Down’s Syndrome

B) Turner’s Syndrome

C) Klinefelter’s Syndrome

D) Phenylketonuria

53 / 100

Category: Biology Ch 5 Class 12

The condition due to loss of appetite for food is termed as:

NTS 2016 DUHS & JSMU
Biology
Growth and Development
Elimination Tool:

A) Anorexia nervosa

B) Bulimia nervosa

C) Colour blindness

D) Retarded growth

54 / 100

Category: Biology Ch 10 Class 11

Select an anamniote from the following:

PMC 2020
Biology
Kingdom Animalia
Elimination Tool:

A) Snake

B) Parrot

C) Frog

D) Crocodile

55 / 100

Category: Biology Ch 6 Class 12

The length of okazaki fragments in eukayotes is

150–250 nucleotides long

200-300 nucleotides

1000-2000 nucleotde

100-200 nucleotides

56 / 100

Category: Biology Ch 2 Class 11

The cell wall of most of the bacteria have a unique macromolecule called_______.

NTS 2012
Biology
Biological Molecules
Elimination Tool:

A) Cellulose

B) Chitin

C) Fibres

E) Peptidoglycan

57 / 100

Category: Biology Ch 10 Class 11

Aschelminthes is also known as

Protozoans

Eumatazoa

Nematodes

Protoctist ancestors

58 / 100

Category: Biology Ch 13 Class 12

Geothermal energy is

. Energy obtained from nuclear fuel

Energy obtained from burning natural fuels

Heat energy trapped underground

Energy obtained from blowing hot winds

59 / 100

Category: Biology

Q.22 Pick the one which releases anticoagulant in human intestine to prevent clotting:

A. Ascaris lumbricoides

B. Ancylostoma duodenale

C. Enterobius vermicularis

D. Hirudo medicinalis

60 / 100

Category: Biology Ch 8 Class 11

Constricting ring around nematode is formed by

Arthrobotrys

Pleurotus ostreatus

Mildews

All of these

61 / 100

Category: Biology Ch 4 Class 11

The cell membrane surrounds the:

NUMS 2016
Biology
Cell Structure and Function
Elimination Tool:

A) Nucleoplasm

B) Cell wall

C) Protoplasm

D) None of the above

62 / 100

Category: Biology Ch 1 Class 12

The water content of mammalian blood is regulated by antidiuretic hormone(ADH). In which part of the nephron does regulation occur ?

NTS 2015 SMBBMC
Biology
Homeostasis
Elimination Tool:

A) The ascending limb of the loop of gentle

B) The collecting duct

C) The descending limb of the loop of gentle

D) The proximal convoluted tubule

63 / 100

Category: Biology Ch 5 Class 11

Other name for Kingdom monera is:

Protoctista

Prokaryotae

Archae

None of these

64 / 100

Category: Biology

During cell division, the spindle fibres get attached to condensing chromosome at a highly differentiated region. This region is called as:

NUMS Mock 1
Biology
Cell Cycle

A) Chromosome

B) Chromocentre

C) Centriole

D) Kinetochore

65 / 100

Category: Biology Ch 13 Class 11

Lungs are spongy due to the presence of million of

Air sacs

Alveoli

Bronchioles

Parabronchi

66 / 100

Category: Biology Ch 13 Class 11

The infection of lungs is called:

PMC Practice 1
Biology
Gaseous Exchange
Elimination Tool:

A) Emphysema

B) Asthma

C) Pneumonia

D) Bronchitis

67 / 100

Category: Biology Ch 5 Class 11

Vaccine Was discovered by :

Louis Pasteur

Edward Jennar

Ivanowski

Stanely

68 / 100

Category: Biology Ch 11 Class 12

A dual organism composed of symbiotic association of an alga living within a fungus myceliium is

Mycorrhiza

Rhizobium

Lichen

Legume

69 / 100

Category: Biology

Eukaryotic, multicellular, and consumers belong to ______ kingdom.

NUMS Mock 3
Biology
Bio-diversity | Variety of Life

A) Monera

B) Protista

C) Fungi

D) Animalia

70 / 100

Category: Biology Ch 3 Class 11

Biological molecules (proteins) which catalyze a biochemical reaction and remain unchanged after completion of reaction are called

Cofactor

Coenzymes

Activator

Enzymes

71 / 100

Category: Biology Ch 13 Class 11

Chest cavity is bounded by ribs and muscles on the sides, while the floor of chest cavity is called:

NUMS 2015
Biology
Gaseous Exchange
Elimination Tool:

A) Pleura

B) Alveoli

C) Chest cage

D) Diaphragm

72 / 100

Category: Biology

In the human cell, ______ is responsible for producing hydrogen peroxide.

NUMS Mock 2
Biology
Cell Structure and Function

A) Lysosomes

B) Mitochondria

C) Peroxisomes

D) Glyoxysomes

73 / 100

Category: Biology Ch 11 Class 11

Glucose → 2 pyruvic acid + 2H2O

2ADP + 2Pi → 2 ATP

2NAD + 4H → 2NADH + 2H+

These three reactions collectively constitute ______.

NTS 2012
Biology
Bioenergetics
Elimination Tool:

A) Kreb’s cycle

B) Calvin’s cycle

C) Electron Transport Chain

E) Glycolysis

74 / 100

Category: Biology Ch 1 Class 12

Which of the following structure in plant’s body is called excretophores?

Stem

Leaves

Flowers

Roots

75 / 100

Category: Biology Ch 5 Class 12

Vegetative roots and shoots grow by

Determinate growth

Primary growth only

Indeterminate growth

None of these

76 / 100

Category: Biology Ch 8 Class 12

How many genes control Rh blood group system?

One

Two

Three

Four

77 / 100

Category: Biology Ch 1 Class 12

Terrestrial animals like kangaroo rat survive even without drinking water since

They don't require water for their metabolic process

They can retain excessive water in their body during raining season.

They feed on carbohydrate rich seeds which can provide them with metabolic water

They are anhydrobiotic organisms

78 / 100

Category: Biology Ch 3 Class 11

Which statement is incorrect about Lock and Key Model?

Specific enzyme can transform only a specific substrate

Active site of an enzyme is a non flexible structure.

Active site does not change before during or even after the reaction.

It explains the mechanism of every chemical reaction.

79 / 100

Category: Biology

The passageways of the respiratory system have mucous secreting cells called:

NUMS Mock 3
Biology
Gaseous Exchange

A) Tracheal cells

B) Goblet cells

C) Surfactant cells

D) Pleural cells

80 / 100

Category: Biology Ch 6 Class 12

Mutations can occur in:

NUMS 2016
Biology
Chromosomes and DNA
Elimination Tool:

A) DNA

B) Protein

C) RNA

D) A and C

81 / 100

Category: Biology

Which of the following RNA sequences would be transcribed from the DNA sequence ATGGCTAGGAC?

NUMS Mock 4
Biology
Chromosomes and DNA

A) TACGGATCCTG

B) UAGCGAUCCUG

C) AUGCCUAGGAC

D) UACCGAUCCUG

82 / 100

Category: Biology Ch 9 Class 11

It looks like a single flower but it is in fact an inflorescence called:

NUMS 2014
Biology
Kingdom Plantae
Elimination Tool:

A) Pencil

B) Typical receme

C) Compound umbel

D) Capitulum

83 / 100

Category: Biology Ch 3 Class 12

Type of neurons found exclusively in CNS are:

Sensory neurons

Motor neurons

Associative neurons

None of these

84 / 100

Category: Biology Ch 8 Class 12

Ahmed’s blood CANNOT clot properly; he was diagnosed with hemophilia A. He passed this trait to his grandson through his:

NUMS 2019 Reconduct
Biology
Variation and Genetics
Elimination Tool:

A) Wife

B) Son

C) Daughter

D) Brother

85 / 100

Category: Biology Ch 3 Class 11

Which one forms the raw material for coenzymes?

Vitamins

Carbohydrates

Proteins

Metals

86 / 100

Category: Biology Ch 3 Class 11

If we add more substrate to an already occurring enzymatic reaction and it has no affect on the rate of reaction, the process is called?

PMC Practice 2
Biology
Enzymes
Elimination Tool:

A) Denaturation

B) Saturation

C) Composition

D) Inhibition

87 / 100

Category: Biology Ch 3 Class 11

Cyanide for enzymes act as:

NUMS 2018
Biology
Enzymes
Elimination Tool:

A) Substrate

C) Cofactor

B) Prosthetic group

D) Inhibitor

88 / 100

Category: Biology Ch 10 Class 11

In some cases the blastomere can produce complete embryo the cleavage will be

Spiral and determinate

Radial and indeterminate

Spiral and indeterminate

Radial and determinate

89 / 100

Category: Biology

How many ml of blood is pumped by each contraction of the heart?

NUMS Mock 1
Biology
Transport

A) 80 ml

B) 90 ml

C) 70 ml

D) 60 ml

90 / 100

Category: Biology

Which trait is not sex-linked recessive:

NUMS Mock 2
Biology
Variation and Genetics

A) Haemophilia

B) Colour blindness

C) Hypophosphatemia

D) TFM syndrome

91 / 100

Category: Biology Ch 13 Class 11

The gas-exchange portion of the human respiratory system is the:

NTS 2016 SMBBMC
Biology
Gaseous Exchange
Elimination Tool:

A) Larynx

B) Trachea

C) Bronchi

D) Alveoli

92 / 100

Category: Biology

Q.12 In enzymatic mechanism, the substrate bind to enzyme active site to produce?

A. Reactants

B. Enzyme

C. Products

D. all of these

93 / 100

Category: Biology Ch 11 Class 11

Exposure to ______ light is effective in photosynthesis as it enables guard cells to take up K+ and opening of stomata.

NUMS 2019 Reconduct
Biology
Bioenergetics
Elimination Tool:

A) Red

B) Blue

C) Green

D) Orange

94 / 100

Category: Biology Ch 12 Class 11

Ileum is about ______ long:

NTS 2010
Biology
Nutrition
Elimination Tool:

A) 3.6 centimeters

B) 3.6 mllimeters

C) 3.6 inches

D) 3.6 meters

95 / 100

Category: Biology Ch 10 Class 11

Bipinnaria is the larval form of:

NUMS 2014
Biology
Kingdom Animalia
Elimination Tool:

A) Coelenterate

B) Potychaeta

C) Echinodermata

D) Cestoda

96 / 100

Category: Biology

Q43 The animals in which there are separate male and female individuals are called?

A. Unisexual

B. bisexual

C. Asexual

D. hermaphrodite

97 / 100

Category: Biology Ch 7 Class 11

Cyanobacteria resemble photosynthetic eukaryotes because they have:

PMC 2021 Tested
Biology
Kingdom Protista
Elimination Tool:

A) PS-I

B) None of these

C) PS-I and PS-II both

D) PS-II

98 / 100

Category: Biology Ch 10 Class 12

Important point/s of Lamarck’s theory

Use and disuse of organs

Inheritance of acquired characters

Natural selection

Both a and b

99 / 100

Category: Biology Ch 10 Class 11

An amphibian’s heart has ______ chambers:

NUMS 2016
Biology
Kingdom Animalia
Elimination Tool:

A) Two

B) Three

C) Four

D) Five

100 / 100

Category: Biology

Q.19 Sm0oth endoplasmic reticulum is abundant in which types of cells?

A. lipid metabolism

B. protein metabolism

C. glucose metabolism

D. calcium metabolism

Your score is

The average score is 57%

Structured Practice for Best Entry Test Preparation

This topic-wise and chapter-wise practice test allows students to focus on individual biology concepts, including diagrams, processes, and conceptual questions. Regular practice enhances understanding, sharpens problem-solving skills, and builds confidence to tackle both board and competitive exam questions efficiently.

Free Resources for Best Entry Test Preparation

Students can access free Biology Practice Test 2 to systematically improve knowledge, recall, and problem-solving abilities. This test is suitable for FSC Board Exams as well as major entry tests, helping students perform better in the biology section. PLS Academy provides these resources to support students in their preparation.

JazakAllah