Biology Practice Test 2

Created by Ali Durrani

MDCAT Practice Tests

Biology Practice Test 2

This is the Free Access to Limited MCQs. Enroll to PLS Boost Premium Bundle to Get More MCQs HERE

1 / 100

Category: Biology Ch 2 Class 11

Which bond provides stability to complex carbohydrate molecules?

C-H

C-O

C-C

C-N

2 / 100

Category: Biology Ch 12 Class 11

Midgut in cockroach is a short narrow tube called

Hepatic caeca

Gizzard

Stomach

Rectum

3 / 100

Category: Biology Ch 10 Class 12

Choose the correct combination:

NUMS 2019 Cancelled
Biology
Evolution
Elimination Tool:

A) Darwin – survival of the fittest

B) Darwin – no extinction

C) Lamarck – acquired transmission

D) Both Darwin – survival of the fittest and Lamark – acquired transmission

4 / 100

Category: Biology Ch 3 Class 12

The sense organs of taste in tongue are known as:

NUMS 2014
Biology
Coordination and Control
Elimination Tool:

A) Olfactory receptors

B) Gustatory receptors

C) Cutaneous receptors

D) All of these

5 / 100

Category: Biology Ch 7 Class 11

Radiolarians belong to which of the following protozoal group?

Zooflagellates

Actinopods

Foraminifera

Apicomplexans

6 / 100

Category: Biology Ch 5 Class 11

The long chains of HIV-proteins are cut down by proteases enzyme of ______.

PMC Sample 2
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) HIV virus

B) Host proteases

C) Both viral and host proteases

D) None of these options is correct

7 / 100

Category: Biology Ch 1 Class 12

The technique used for the non-surgical removal of kidney stones is called:

NUMS 2016
Biology
Homeostasis
Elimination Tool:

A) Ultrasound

B) Lithotripsy

C) Dialysis

D) X-rays

8 / 100

Category: Biology Ch 4 Class 11

Magnifying power of electron microscope as compared to eye is

500 X

250000X

500000X

250X

9 / 100

Category: Biology

Q.65 Which of the following statements about the systemic affect of bacterial cells are true?

A. Gram-negative bacteria are more likely to cause systemic effects because their lack of an outer membrane means they can more quickly infect host cells.

B. Gram-negative bacteria are more likely to cause Systemic effects because the outer membrane protects them from antibiotics

C. Both A and B

D. None of these

10 / 100

Category: Biology

The RNA found in Ribosomes is:

NUMS Mock 1
Biology
Chromosomes and DNA

A) mRNA

B) rRNA

C) tRNA

D) Polysome

11 / 100

Category: Biology

Q37 The muscle contraction depends on:

A. Nerve impulse

B. Energy

C. Calcium

D. All of these

12 / 100

Category: Biology

Egg-Laying mammals are called:

NUMS Mock 3
Biology
Reproduction

B) Protozoa

C) Chordata

D) Monotremes

E) Both A and D

13 / 100

Category: Biology

The only possible treatment in end stage renal failure is:

NUMS Mock 3
Biology

A) Hemodialysis

B) Peritoneal dialysis

C) Lithotripsy

D) Kidney transplantation

14 / 100

Category: Biology Ch 3 Class 11

The optimum pH of catalase is:

NUMS 2018
Biology
Enzymes
Elimination Tool:

A) Slightly alkaline

B) Highly acidic

C) Highly alkaline

D) Slightly acidic

15 / 100

Category: Biology Ch 7 Class 12

Meiosis occur in

Diploid cells only

Haploid cells only

Both diploid and haploid cells

Monoploid cells

16 / 100

Category: Biology

Which one of the following muscles are considered as “Voluntary muscles”?

NUMS Mock 1
Biology
Support and Movement

A) Smooth muscles

B) Cardiac muscles

C) Skeletal muscles

D) Glandular muscles

17 / 100

Category: Biology Ch 11 Class 12

The role a species plays in a community including behavior and influence is

Nichon

Niche

Autecology

Profession

18 / 100

Category: Biology

Q.20 Cytochromes are electron transport intermediates containing?

A. myoglobin

B. heam

C. globulin

D. fibrin

19 / 100

Category: Biology

Which of the following will not undergo aldol condensation?

NUMS Mock 2
Chemistry
Aldehydes and Ketones

A) Acetaldehyde

B) Propanaldehyde

C) Benzaldehyde

D) Trideuteroacetaldehyde

20 / 100

Category: Biology Ch 5 Class 12

Apical meristems are located at

Tips of leaves

Tips of flowers

Tips of roots and stems

Tips of roots only

21 / 100

Category: Biology Ch 6 Class 12

Mutations can occur in:

NUMS 2016
Biology
Chromosomes and DNA
Elimination Tool:

A) DNA

B) Protein

C) RNA

D) A and C

22 / 100

Category: Biology Ch 1 Class 12

The concentration of Na ions in the body fluids is controlled by the ____ hormone.

NTS 2012
Biology
Homeostasis
Elimination Tool:

A) ADH

B) Parathormone

C) Aldosterone

D) Estrogen

23 / 100

Category: Biology Ch 9 Class 12

Genetic engineering has been successfully used for producing;

UHS 2019
Biology
Biotechnology
Elimination Tool:

A) Animals, with inferior traits.

B) Transgenic mice for testing safety of polio vaccine before use in humans

C) Animals, that have the same genetic constitution.

D) None of the above

24 / 100

Category: Biology

Q.10 Synaptic vesicles discharge which hormone at the neuromuscular junction?

A, acetylcholine

B. adrenaline

C. estradiol

D. testosterone

25 / 100

Category: Biology

Q.56 Which of the following is nota viral disease?

A. Smallpox

Mumps

C. Tetanus

D. Cowpox

26 / 100

Category: Biology

Q.54 Structures that were once functional in the past but no longer serve a purpose due to evolutionary adaptations and physiological changes are referred to as?

A Vestigial
B. Analogous structures
C. Homologous structures
D. None of these

A Vestigial

B. Analogous structures

C. Homologous structures

D. None of these

27 / 100

Category: Biology Ch 6 Class 11

Which of the following structure primarily helps in attachment of bacteria on various surfaces?

Flagella

Pili

Both of these

None of these

28 / 100

Category: Biology

DNA made by joining pieces from two or more different sources:

NUMS Mock 3
Biology
Biotechnology

A) Probes

B) Restriction endonuclease

C) Mutated DNA

D) Recombinant DNA

29 / 100

Category: Biology

Q.15 The inhibitory effect of which inhibitor can be more dangerous in Krebs cycle?

A. Irreversible inhibitors

B. Competitive inhibitor

C. Reversible inhibitors

D. Non-competitive inhibitor

30 / 100

Category: Biology Ch 14 Class 11

Semilunar valves are not present:

NUMS 2015
Biology
Transport
Elimination Tool:

A) At the base of the pulmonary trunk

B) At the base of the aorta

D) In the coronary arteries

C) In veins

31 / 100

Category: Biology Ch 13 Class 11

The structural and functional unit of the lungs is:

PMC Practice 2
Biology
Gaseous Exchange
Elimination Tool:

A) Alveoli

B) Trachea

C) Bronchiole

D) Bronchus

32 / 100

Category: Biology Ch 12 Class 11

Milk drinking babies have an additional enzyme called:

NUMS 2016
Biology
Nutrition
Elimination Tool:

A) Rennin

B) Amylase

C) Lipase

D) None of these options are correct

33 / 100

Category: Biology Ch 4 Class 12

Duration of menstrual cycle is how many days on average?

PMC Sample 1
Biology
Reproduction
Elimination Tool:

A) 25

B) 26

C) 27

D) 28

34 / 100

Category: Biology Ch 5 Class 11

Five steps of the lytic cycle of a T4 stage are given below:

The T4 phage uses its tails to stick to specific receptor
The cell’s metabolic machinery, directed by phage DNA, produces phage proteins and nucleotides from the cells degraded DNA are used to make copies of the phage genome.
The phage then directs production of an enzyme that digests the cell.
The empty capsid of the phage is left as a ghost outside the cell
The sheath of the tail contracts, thrusting a hollow core through the wall and membrane of the cell.
Which of the following is the correct sequence of the cycle?

NTS 2015 SMBBMC
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) 3-5-4-2-1

B) 2-4-5-1-3

C) 5-1-4-2-3

D) 1-5-4-2-3

35 / 100

Category: Biology Ch 8 Class 11

Fungi can tolerate pH from

3?7

2?6

2?9

. 3?6

36 / 100

Category: Biology Ch 7 Class 11

Which of the protozoa has a striking resemblance to collar cells in sponges?

Zooflagellates

Choanflagellates

Trypanosomoa

Trichonymphas

37 / 100

Category: Biology Ch 10 Class 12

Archaebacteria can survive at

150?C

300?C

120?C

200?C

38 / 100

Category: Biology Ch 2 Class 12

Exoskeleton of a marine snail is composed of

CaPO4

CaCO3

CaSO4

SiO2

39 / 100

Category: Biology Ch 14 Class 11

Which valve action results from an increase in pressure in the ventricles of the heart?

NTS 2012
Biology
Transport
Elimination Tool:

A) The closing of all the heart valves

B) The closing of semilunar valves

C) The opening of the bicuspid valve

D) The opening of the semilunar valves

40 / 100

Category: Biology Ch 8 Class 11

Fungi store surplus food in the form of

UHS 2010
Biology
Kingdom Fungi
Elimination Tool:

A) Cellulose

B) Glycogen

C) Starch

D) Both B and C

41 / 100

Category: Biology Ch 4 Class 12

Which of these cycles operate in human females?

PMC Sample 2
Biology
Reproduction
Elimination Tool:

A) Oestrous cycle

B) Menstrual cycle

C) Both Options A and B are correct

D) None of these options is correct

42 / 100

Category: Biology Ch 4 Class 12

Which of the following hormones of the pituitary gland regulates the menstrual cycle?

PMC 2020
Biology
Reproduction
Elimination Tool:

A) Follicle Stimulating hormone and Estrogen

B) Luteinizing hormone and Estrogen

C) Follicle Stimulating hormone and Luteinizing hormone

D) Estrogen and Progesterone

43 / 100

Category: Biology Ch 6 Class 11

In a bacterial cell, plasma membrane with all things present within it is called:

PMC Sample 3
Biology
Kingdom Prokaryote
Elimination Tool:

A) Cytoplasmic matrix

B) Cytoplasm

C) Protoplast

D) Cell Structure

44 / 100

Category: Biology Ch 6 Class 11

A Dutch scientist firstly observed very small creatures in

PMC Practice 6
Biology
Kingdom Prokaryote
Elimination Tool:

A) Vinegar

B) Saliva

C) Rain water

D) All of Above

45 / 100

Category: Biology Ch 14 Class 11

Fibrinogen is necessary for:

NUMS 2014
Biology
Transport
Elimination Tool:

A) Metabolism

B) Respiration

C) Reproduction

D) Clotting

46 / 100

Category: Biology Ch 8 Class 11

Those fungi which can grow only on their living host and cannot be grown on available defined growth culture medium e.g. various mildews and most rust species are called

Parasitic fungi

Obligate parasitic fungi

Facultative parasitic fungi

All of these

47 / 100

Category: Biology Ch 11 Class 11

Quantitative study of energy relationships in biological systems obeys.

Bioenergetics

Laws of thermodynamics

Laws of thermo chemistry

Laws of chemical energeti

48 / 100

Category: Biology

In cross-section each Centriole consist of nine (each in triplets) of:

NUMS Mock 2
Biology
Cell Structure and Function

A) Microfilaments

B) Microvilli

C) Microtubules

D) Intermediate filaments

49 / 100

Category: Biology Ch 4 Class 11

_______ organelles are involved in the synthesis of the plant cell wall.

NUMS 2020
Biology
Cell Structure and Function
Elimination Tool:

A) Endoplasmic reticulum

B) Golgi complex

C) Lysosomes

D) Peroxisomes

50 / 100

Category: Biology Ch 3 Class 11

A reaction will proceed faster if the activation energy is?

PMC Sample 1
Biology
Enzymes
Elimination Tool:

A) High

B) Low

C) Remains the same

D) None of these options is correct

51 / 100

Category: Biology Ch 2 Class 11

Antibodies are

NUMS 2019 Cancelled
Biology
Biological Molecules
Elimination Tool:

A) Primary proteins

B) Secondary proteins

C) Tertiary proteins

D) Quaternary proteins

52 / 100

Category: Biology Ch 8 Class 12

The type of gene interaction in which the effect caused by a gene at one locus interfere with the effect caused by another gene at another locus is known as:

NUMS 2018
Biology
Variation and Genetics
Elimination Tool:

A) Pleiotropy

B) Epistasis

C) Polygenic inheritance

D) Gene linkage

53 / 100

Category: Biology Ch 11 Class 11

Where do the light – dependent reactions of photosynthesis occur?

NTS 2016 SMBBMC
Biology
Bioenergetics
Elimination Tool:

A) In the guard cells of the stomata

B) Stroma of chloroplast

C) In the thylakoid membrane of chloroplast

D) Cytoplasm of leaf cell

54 / 100

Category: Biology Ch 2 Class 11

5 different amino acids, numbered 1, 2, 3, 4, and 5, below from the following sequence in the path of a polypeptide chain:

1-2-3-4-2-5-3

Messenger RNA codon, which correspond to the amino acids, are:
amino acid 1 UGU

amino acid 2 GAU

amino acid 3 CAC

amino acid 4 UAG

amino acid 5 AAG

Which one of the following DNA bases sequences could provide the code for the given section of the polypeptide?

NTS 2015 DUHS and JSMU
Biology
Biological Molecules
Elimination Tool:

A) ACACTTGTGATGCTATTCGTG

B) ACACUAGUGAUGCUAUUCGUG

C) ACACTAGTGATGCTAAACGTG

D) ACACTAGTGATCCTATTCGTG

55 / 100

Category: Biology Ch 9 Class 11

“Vascular System absent; gametophyte dominant, sporophyte attached to gametophyte; homosporous” are distinguishing characters of

UHS 2010
Biology
Kingdom Plantae
Elimination Tool:

A) Psilopsida

B) Pteropsida

C) Angiosperms

D) Bryophyta

56 / 100

Category: Biology Ch 9 Class 12

A method of DNA sequencing in which DNA threads are chemically cut into pieces of different sizes is

Sanger's method

Maxam-Gilbert method

Hamilton's method

Vortex method A

57 / 100

Category: Biology Ch 8 Class 11

Yeasts, the unicellular fungi belongs mostly to the group:

UHS 2018
Biology
Kingdom Fungi
Elimination Tool:

A) Deuteromycota

C) Basidiomycota

B) Zygomycota

D) Ascomycota

58 / 100

Category: Biology Ch 8 Class 11

Antibiotics are produced by fungi and certain bacteria of group:

UHS 2013
Biology
Kingdom Fungi
Elimination Tool:

A) Actinomycetes

B) Oomycetes

C) Ascomycetes

D) Basidiomycetes

59 / 100

Category: Biology Ch 9 Class 11

Gymnosperms are referred to as “naked seeded plants”, because

NUMS 2016
Biology
Kingdom Plantae
Elimination Tool:

A) They lack ovule

B) They lack ovaries

C) The embryo is unprotected

D) They have no seed coat

60 / 100

Category: Biology

Which of the following is NOT a difference that would allow one to distinguish between a prokaryotic and a eukaryotic cell?

Presence of absence of the nucleus
Presence or absence of the cell wall
Membrane bound versus no membrane bound organelles
NUMS Mock 3
Biology
Cell Structure and Function

A) I only

B) II only

C) III only

D) I and II only

61 / 100

Category: Biology Ch 4 Class 12

What is the commercial method of producing millions of seedlings in limited time?

NUMS 2016
Biology
Reproduction
Elimination Tool:

A) Parthenogenesis

B) Parthenocarpy

C) Cutting

D) Grafting

62 / 100

Category: Biology Ch 10 Class 11

In mosquitoes, the plasmodium is found in?

NTS 2015 SMBBMC
Biology
Kingdom Animalia
Elimination Tool:

A) Salivary glands

B) Wings

C) Blood

D) Both Options A and B are correct

63 / 100

Category: Biology

Q.18 Which of these is not a reflex action?

A, Secretion of sweat

B. salivation

C. Flexion due to needle prick

D. blinking of eyes due to strong light

64 / 100

Category: Biology

The element in basic structure of proteins which differentiate them from carbohydrates is?

NUMS Mock 1
Biology
Biological Molecules

A) Carbon.

B) Hydrogen.

C) Nitrogen.

D) None of these options is correct.

65 / 100

Category: Biology Ch 7 Class 12

Condensation of chromosomes reaches to the maximum during:

NUMS 2015
Biology
Cell Cycle
Elimination Tool:

A) Zygote

B) Pachytene

D) Diakinesis

C) Diplotene

66 / 100

Category: Biology Ch 6 Class 11

The size of Spirochete is

0.1 -600 um

100-200 nm

500 um

0.75-1.25 um

67 / 100

Category: Biology Ch 6 Class 12

Central dogma is

Transfer of information from DNA to mRNA

Basic mechanism of reading and expressing genes

Transfer of information from RNA to proteins

Synthesis of all three types of RNA

68 / 100

Category: Biology Ch 7 Class 11

Which of the following results from conjugation in paramecium?

PMC Practice 3
Biology
Kingdom Protista
Elimination Tool:

A) Cell death

B) Cell division

C) Budding

D) Recombination

69 / 100

Category: Biology Ch 1 Class 12

Purine and pyrimidine catabolism results in production of

Creatinine

Trimethyamine oxide

Xanthine

None of these

70 / 100

Category: Biology

Q3 These animals show radial symmetry.

A. Chordates

B. Annelids

C. Cnidarian

D Round worms

71 / 100

Category: Biology

_____ are more common in human males and females.

NUMS Mock 3
Biology
Variation and Genetics

A) X-linked dominant traits

B) X-linked recessive traits

C) Y-linked dominant traits

D) Autosomal linked recessive traits

72 / 100

Category: Biology Ch 14 Class 11

All of the following protect the body against the entrance of germs except:

NTS 2017
Biology
Transport
Elimination Tool:

A) Tears

B) Mucous membranes

C) Ciliated cells

E) Red blood cells,

73 / 100

Category: Biology Ch 13 Class 11

As pH of blood decreases, H+ ions increases, which combine the proteins part of hemoglobin, to decrease its ability to bind with:

NUMS 2019 Reconduct
Biology
Gaseous Exchange
Elimination Tool:

A) O2

B) CO2

C) CO

D) H2

74 / 100

Category: Biology

Q.60 Which of the following statements correctly describes how the host cell membrane is changed by viral replication?

A. Pores develop.

B. Glycocalyx layer is formed.

C. Membrane is resynthesized

D. Viral proteins are acquired

75 / 100

Category: Biology Ch 3 Class 12

The only promoter of leaf senescence in the following plant hormones is:

Gibberellins

Cytokinins

Auxins

Abscisic Acid

76 / 100

Category: Biology Ch 3 Class 11

The Induced fit model was introduced by Koshland in which of the following year?

PMC Sample 1
Biology
Enzymes
Elimination Tool:

A) 1960

B) 1961

C) 1959

D) 1966

77 / 100

Category: Biology Ch 9 Class 11

Which characteristic led to the evolution of seed?

NUMS 2020
Biology
Kingdom Plantae
Elimination Tool:

A) Heterogamous condition

B) Development of heterospory

C) Embryo formation

D) Protection of reproductive cells

78 / 100

Category: Biology Ch 5 Class 11

The genome of viruses is composed of

NTS 2019
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) DNA

B) RNA

C) Protien

D) Both A and B

79 / 100

Category: Biology Ch 12 Class 11

Which process takes place during the movement of glucose from the body fluid to the blood?

NUMS 2016
Biology
Nutrition
Elimination Tool:

A) Endosmosis

B) Osmosis

C) Active transport

D) Facilitated diffusion

80 / 100

Category: Biology Ch 4 Class 11

During digesting the phagocytosed food particles vesicles formed from fusion of phagocytic vacuole with the enzymes secreted by Golgi apparantus are called

Lysosomes

Primary lysosomes

Secondary lysosomes

Food vacuole

81 / 100

Category: Biology

Q.41 Corpus luteum is yellow glandular mass and is important source of:

A. Estrogen

B. FSH

C. Testosterone

D. Progesterone

82 / 100

Category: Biology Ch 3 Class 12

Chemically auxins are

Indole propionic acid.

Indole carboxylic acid.

Indole acetaldehyde

Indole acetic acid

83 / 100

Category: Biology

Q.19 Darwins theory mainly focuses o

A. Origin of life

B. How Orgais extinct

C. How new Species arise

D How organism form

84 / 100

Category: Biology Ch 1 Class 12

The human body maintains all of its cells’ internal concentration _____ to internal body fluid.

NUMS 2019 Cancelled
Biology
Homeostasis
Elimination Tool:

A) Isotonic

B) Hypotonic

C) Hypertonic

D) Hyposmotic

85 / 100

Category: Biology Ch 10 Class 11

The animals in which coelom is formed due to splitting of mesocerm are known as

Pseudocoelous

Schizocoelous

Enterocoelous

Emphicoelous

86 / 100

Category: Biology

During cell division, the spindle fibres get attached to condensing chromosome at a highly differentiated region. This region is called as:

NUMS Mock 1
Biology
Cell Cycle

A) Chromosome

B) Chromocentre

C) Centriole

D) Kinetochore

87 / 100

Category: Biology

The scientific name of thorn Apple is?

NUMS Mock 2
Biology
Kingdom Plantae

A) Sycopodium phlogmaria

B) Anthocoros fusiform

C) Ginkgo biloba

D) Datura alba

88 / 100

Category: Biology Ch 4 Class 12

Luteinizing hormone, which is produced by the pituitary gland, promotes ovulation and stimulate the ovaries to produce:

NUMS 2019 Cancelled
Biology
Reproduction
Elimination Tool:

A) Estrogen

B) Estrogen and progesterone

C) Progesterone

D) Oxytocin

89 / 100

Category: Biology

_________ is the exact position of a gene on the chromosome.

NUMS Mock 3
Biology
Chromosomes and DNA

A) Trait

B) Centromere

C) Genotype

D) Locus

90 / 100

Category: Biology Ch 6 Class 12

The total of all the alleles in a population is called a:

NUMS 2014
Biology
Chromosomes and DNA
Elimination Tool:

A) Genetic drift

B) Genotype

C) Gene pool

D) Gene mutation

91 / 100

Category: Biology Ch 5 Class 11

The shape of the tobacco mosaic virus is:

NUMS 2016
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Spring shape

B) Rod shape

C) Comma shape

D) Spherical shape

92 / 100

Category: Biology Ch 13 Class 12

Conversion of ammonium into nitrates is:

UHS 2018
Biology
Man and His Environment
Elimination Tool:

A) Nitrification

B) Nitrogen Fixation

C) Ammonification

D) Denitrification

93 / 100

Category: Biology Ch 3 Class 12

All of the following hormones are secreted from anterior lobe of pituitary gland BUT:

NUMS 2019 Reconduct
Biology
Coordination and Control
Elimination Tool:

A) Somatotropin hormone

B) Thyroid stimulating hormone

C) Antidiuretic hormone

D) Gonadotrophic hormone

94 / 100

Category: Biology

Q.25 Which of the following is an example of a marine annelid?

A. Neries

B. Stylaria

C. Earthworm

D. Leech

95 / 100

Category: Biology Ch 13 Class 12

Grassland of Argentina is:

NUMS 2015
Biology
Man and His Environment
Elimination Tool:

A) Prairies

B) Savana

C) Boreal

D) Pampas

96 / 100

Category: Biology

Q.61 Herbivores always occupy :

A. T1

B. T3

C. T2

D. T4

97 / 100

Category: Biology Ch 10 Class 11

The name animal is derived from the word.

Anima

Anemia

Aname

All of these

98 / 100

Category: Biology Ch 6 Class 12

A typical human chromosome contains _________ nucleotides in its DNA

240 million

140 million

150 million

160 million

99 / 100

Category: Biology

Q.7 A neuron located in the cential hervous system that projects its axon outside the CNS is called:

A. Motor nerve

B. Sensory nerve

C. Both A and B

D. Mixed nerve

100 / 100

Category: Biology Ch 10 Class 12

According to the Hardy-Weinberg theorem, what will be the frequency of heterozygote when ‘p’ is 0.2?

NUMS 2019 Reconduct
Biology
Evolution
Elimination Tool:

A) 0.32

B) 0.38

C) 0.42

D) 0.48

Your score is

The average score is 57%

0%

PLS Academy – LearnoSpot

PLS Boost Bundle