Biology Practice Test 1

Biology Practice Test 1 is designed to help students strengthen their understanding of key biological concepts, theories, and processes for competitive entry tests like MDCAT, NUMS, AKU, UET, ECAT, NTS, as well as FSC Board Exams. This test covers topics from cell biology, genetics, physiology, ecology, evolution, and more, helping students improve accuracy and retention.

PLS Academy

Get Access to 20 thousands+ MCQs Including Topical MCQs, Practice Tests, Mock Tests, Solved Past Papers, Flashcards, Notes, FLPS, and Much More.

UNLOCK PREMIUM🔐

8083

Created by Ali Durrani

MDCAT Practice Tests

Biology Practice Test 1

This is the Free Access to Limited MCQs. Enroll to PLS Boost Premium Bundle to Get More MCQs HERE

1 / 100

Category: Biology Ch 4 Class 11

Cellulose is the major component of

Primary wall

Secondary wall

Middle lamella

all of the above

2 / 100

Category: Biology Ch 9 Class 11

The release of droplets of water from hydathodes is called:

PMC 2021 Tested
Biology
Kingdom Plantae
Elimination Tool:

A) Respiration

B) Guttation

C) Vaporization

D) Transportation

3 / 100

Category: Biology Ch 4 Class 12

Luteinizing hormone, which is produced by the pituitary gland, promotes ovulation and stimulate the ovaries to produce:

NUMS 2019 Cancelled
Biology
Reproduction
Elimination Tool:

A) Estrogen

B) Estrogen and progesterone

C) Progesterone

D) Oxytocin

4 / 100

Category: Biology

A group of biologically active molecules formed from amino acids which interact with the surface of the lipid bilayer of cell membranes are called:

NUMS Mock 3
Biology
Biological Molecules

A) Integral Proteins

B) Peripheral proteins

C) Cell wall

D) Plasmodesmata

5 / 100

Category: Biology

Q.55 The type of bronchitis that causes no permanent damage to the lungs and lasts for two weeks is known as

A. Acute bronchitis

B. Chronic bronchitis

C. Coastal bronchitis

D. Intercostal bronchitis

6 / 100

Category: Biology Ch 1 Class 12

Sunken stomata are found in:

NUMS 2014
Biology
Homeostasis
Elimination Tool:

A) Mesophytes

B) Xerophytes

C) Halophytes

D) Hydrophytes

7 / 100

Category: Biology Ch 8 Class 11

Those fungi which can grow only on their living host and cannot be grown on available defined growth culture medium e.g. various mildews and most rust species are called

Parasitic fungi

Obligate parasitic fungi

Facultative parasitic fungi

All of these

8 / 100

Category: Biology Ch 12 Class 11

Which enzyme present in the stomach curdles the milk?

NUMS 2016
Biology
Nutrition
Elimination Tool:

A) Rennin

B) Trypsin

C) Pepsin

D) Lipase

9 / 100

Category: Biology

It is a method for rapid production of a very large number of copies of a particular fragment of DNA:

NUMS Mock 2
Biology
Biotechnology

A) Gel electrophoresis

B) Polymerase chain reaction

C) DNA extraction

D) Recombination

10 / 100

Category: Biology Ch 11 Class 12

Hydrosere is

Secondary succession starting in a pond

. Primary succession starting in a pond

Primary succession starting on a dry soil

All of these

11 / 100

Category: Biology Ch 13 Class 11

The passageways of the respiratory system mucous secreting cells called:

NTS 2019
Biology
Gaseous Exchange
Elimination Tool:

A) Tracheal cells

B) Goblet cells

C) Surfactant cells

D) Pleural cells

12 / 100

Category: Biology Ch 11 Class 11

Which of the following pigment is Blue- green in colour:

Chlorophyll a

. Chlorophyll b

Chlorophyll c

Chlorophyll d.

13 / 100

Category: Biology Ch 12 Class 11

A hormone called _______ controls the secretion of gastric juice.

NUMS 2018
Biology
Nutrition
Elimination Tool:

A) Gastrin

B) Secretin

C) Thyroxine

D) Iodothyronine

14 / 100

Category: Biology Ch 7 Class 11

Bacteria that live in intestine and produce vitamin K belong to?

PMC 2021 Tested
Biology
Kingdom Protista
Elimination Tool:

A) Vibrio

B) Cocci

C) Spirilla

D) Bacilli

15 / 100

Category: Biology Ch 10 Class 11

Coelom is a cavity lined by:

NUMS 2016
Biology
Kingdom Animalia
Elimination Tool:

A) Mesoderm

B) Endoderm

D) Ectoderm

C) Epiderm

16 / 100

Category: Biology Ch 6 Class 11

In which phase of bacterial growth, does divison at an exponential rate occur?

NUMS 2020
Biology
Kingdom Prokaryote
Elimination Tool:

A) Lag phase

B) Log phase

C) Stationary phase

D) Decline phase

17 / 100

Category: Biology Ch 2 Class 11

Ribosomes are composed of almost an equal amount of:

NUMS 2018
Biology
Biological Molecules
Elimination Tool:

A) Protein & Lipid

B) Protein & RNA

C) RNA & Lipid

D) RNA & Carbohydrates

18 / 100

Category: Biology Ch 8 Class 12

Erythroblastosis foetalis occurs when:

NTS 2011
Biology
Variation and Genetics
Elimination Tool:

D) Both mother and baby are Rh-positive

A) Mother is Rh-positive and baby is Rh-negative

B) Mother is Rh-negative and the baby is Rh-positive

C) Both mother and baby are Rh-negative

D) Both mother and baby are Rh-positive

19 / 100

Category: Biology Ch 13 Class 11

Which one of the following is a genetic disorder in which abnormally thick mucus is produced in the lungs and other parts of the body?

NUMS 2020
Biology
Gaseous Exchange
Elimination Tool:

A) Lung cancer

B) Chronic bronchitis

C) Cystic fibrosis

D) Emphysema

20 / 100

Category: Biology Ch 6 Class 12

Histones have abundance of amino acids

Valine and lysine

Arginine and lysine

Valine and arginine

Histidione and threonine

21 / 100

Category: Biology Ch 10 Class 11

Bipinnaria is the larval form of:

NUMS 2014
Biology
Kingdom Animalia
Elimination Tool:

A) Coelenterate

B) Potychaeta

C) Echinodermata

D) Cestoda

22 / 100

Category: Biology Ch 5 Class 12

Amniotic fluid in human embryo protects it from:

NUMS 2014
Biology
Growth and Development
Elimination Tool:

A) Degeneration

C) Encasement

B) Jerks

D) None of these

23 / 100

Category: Biology Ch 7 Class 11

Which of the following is divided by fission?

NTS 2018
Biology
Kingdom Protista
Elimination Tool:

A) Viruses

B) Viroids

C) Bacteria

D) Fungus

24 / 100

Category: Biology Ch 10 Class 12

Who developed a theory of natural selection essentially identical to Darwin’s?

PMC Sample 2
Biology
Evolution
Elimination Tool:

A) Hardy-Weinberg

B) Malthus

C) Lamark

D) Alfred Wallace

25 / 100

Category: Biology Ch 5 Class 11

The complete, mature and infection virus particle is known as:

PMC 2020
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Venome

B) Genome

C) Virion

D) Capsid

26 / 100

Category: Biology Ch 10 Class 12

At what point are two populations descending from the same ancestral stock considered separate species?

NTS 2014
Biology
Evolution
Elimination Tool:

A) When they can no longer produce viable, fertile offspring

B) When they look significantly different from each other

C) When they can interbreed successfully and produce offspring

D) When their habitats are separated by a significantly large distance so that they cannot meet

27 / 100

Category: Biology Ch 12 Class 11

Nitrogen

Magnesium

Iron

Both A and B

28 / 100

Category: Biology Ch 13 Class 11

Thick, waxy & leathery cuticle around leaves is present in which of the following?

PMC Sample 2
Biology
Gaseous Exchange
Elimination Tool:

A) Hydrophytes

C) Halophytes

B) Mesophytes

D) Xerophytes

29 / 100

Category: Biology Ch 8 Class 11

All of the following are characteristics of kingdom fungi except:

NUMS 2017
Biology
Kingdom Fungi
Elimination Tool:

A) Heterotrophy

B) Sessil

C) Cell wall

D) None of the above

30 / 100

Category: Biology Ch 2 Class 12

Many _______ expel a large amount of water by special structures called contractile vacuoles:

NUMS 2020
Biology
Support and Movement
Elimination Tool:

A) Protozoa

B) Porifera

C) Echinoderm

D) Fish

31 / 100

Category: Biology Ch 9 Class 12

Protoplasts are plant cells from which

. Cell walls are removed

Nucleus is removed

New organelles are added

Vacuoles are taken out

32 / 100

Category: Biology Ch 10 Class 11

Despite the structural diversities, ____ are characterized by having a soft body protected by a calcareous shell developing from the mantle layer.

NUMS 2014
Biology
Kingdom Animalia
Elimination Tool:

A) Corals

B) Foraminiferos

C) Molluscs

D) None of these

33 / 100

Category: Biology

When a fetus is in the uterus, what carries oxygen away from the placenta?

NUMS Mock 1
Biology
Reproduction

A) The amniotic fluid

B) The amniotic sac

C) The lining of the uterus

D) The umbilical cord

34 / 100

Category: Biology Ch 5 Class 12

The active sites of all enzyme are formed by:

NUMS 2016
Biology
Growth and Development
Elimination Tool:

A) R-groups of amino acids

B) NH2 groups of amino acids

C) -COOH groups of amino acids

D) Exposed disulphide bonds

35 / 100

Category: Biology

Digestion of which food components starts from the oral cavity?

NUMS Mock 3
Biology
Nutrition

A) Proteins

B) Fats

C) Carbohydrates

D) Vitamins

36 / 100

Category: Biology Ch 8 Class 11

How many species of fungi are known till now

10000

100000

10000000

1000

37 / 100

Category: Biology Ch 4 Class 11

Detoxification of drugs is the function of _____ in a cell.

NUMS 2016
Biology
Cell Structure and Function
Elimination Tool:

A) R.E.R

B) S.E.R

C) Liver cells

D) Lysosome

38 / 100

Category: Biology Ch 14 Class 11

Anti-bodies are produced by:

NUMS 2014
Biology
Transport
Elimination Tool:

A) Red blood cells

B) Platelets

C) B-lymphocytes

D) Hormones

39 / 100

Category: Biology

What part of the brain integrates sensory information such as pain and temperature?

NUMS Mock 2
Biology
Coordination and Control

A) Forebrain

B) Midbrain

C) Hindbrain

D) Spinal cord

40 / 100

Category: Biology Ch 9 Class 11

Ferns are included in

Psilopsida

Lycopsida

Sphenopsida

Pteropsida

41 / 100

Category: Biology Ch 14 Class 11

Which valve action results from an increase in pressure in the ventricles of the heart?

NTS 2012
Biology
Transport
Elimination Tool:

A) The closing of all the heart valves

B) The closing of semilunar valves

C) The opening of the bicuspid valve

D) The opening of the semilunar valves

42 / 100

Category: Biology

Q.53____________________are among smallest known virus

A. Picornavirus

B. Parvoviruses

C. Herpes virus

D. Rotavirus

43 / 100

Category: Biology Ch 13 Class 12

In air % of oxygen and carbon dioxide is

Oxygen 20%, CO2 0.03%

Oxygen 50%, CO2 50%

Oxygen 30%, CO2 0.05%

Oxygen 25%, CO2 0.02%

44 / 100

Category: Biology Ch 6 Class 12

The sequence of nucleotides that determines the amino acid sequence of a protein is

Chromosome

DNA

RNA

Gene

45 / 100

Category: Biology Ch 10 Class 12

According to the Hardy-Weinberg theorem, what will be the frequency of heterozygote when ‘p’ is 0.2?

NUMS 2019 Reconduct
Biology
Evolution
Elimination Tool:

A) 0.32

B) 0.38

C) 0.42

D) 0.48

46 / 100

Category: Biology

Pick the correct option about Drosophila.

NUMS Mock 3
Biology
Variation and Genetics

A) The Male is larger with a pointed abdomen

B) The female has sex combs on its front legs

C) It has a generation time of just eight weeks

D) Salivary gland cells have giant chromosomes in their nuclei

47 / 100

Category: Biology Ch 12 Class 11

Plants absorb it in the form of soluble phosphates. It is present abundantly in the growing and storage organs of plants. What is it?

NTS 2012
Biology
Nutrition
Elimination Tool:

A) H2O

B) CO2

C) K

D) P

48 / 100

Category: Biology Ch 6 Class 12

Phenotype is:

PMC 2020
Biology
Chromosomes and DNA
Elimination Tool:

A) The genetic component i.e. the genes in an individual for a particular trait

B) Partner of gene pair

C) The form of appearance of a trait

D) The position of a gene on the chromosome

49 / 100

Category: Biology

Arrange the following according to the level of protein structures:

a) lysozyme, b) haemoglobin, c) insulin, d) hairs.

NUMS Mock 4
Biology
Biological Molecules

A) c, d, a, b

B) a, b, c, d

C) d, c, b, a

D) a, d, c, b

50 / 100

Category: Biology Ch 6 Class 12

A fern has _____ pairs of chromosomes.

NTS 2012
Biology
Chromosomes and DNA
Elimination Tool:

A) 23

B) 40

C) 500

D) 13

51 / 100

Category: Biology Ch 4 Class 12

Ovulation is induced by ______ hormone secreted by the pituitary gland.

NUMS 2019 Reconduct
Biology
Reproduction
Elimination Tool:

A) Follicle stimulating

B) Estrogen

C) Luteinizing hormone

D) Progesterone

52 / 100

Category: Biology Ch 6 Class 11

A bacterium with tuft of flagella at both poles is called

Lophotrichus

Monotrichous

Peritrichous

Amphitrichous

53 / 100

Category: Biology Ch 1 Class 12

Higher turgor pressure in a plant cell is maintained by:

Large number of vacoules in a plant cell.

Higher ionic concentration inside vacuoles resulting from active pumping of ions at their tonoplastic membrane

Higher osmotic pressure of the cell vacuole

both b and c

54 / 100

Category: Biology Ch 13 Class 12

Which one is a non-renewable resource?

Wild life

Forests

Natural gas

Land

55 / 100

Category: Biology Ch 5 Class 11

The virus can only survive and reproduce inside a:

NTS 2019
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Animal Cell

B) Bacterial cell

C) Living cell

D) Non-living cell

56 / 100

Category: Biology Ch 10 Class 11

Which vertebrate groups have scaly skin?

NTS 2013
Biology
Kingdom Animalia
Elimination Tool:

A) amphibians and fish

B) amphibians and mammals

C) fish and mammals

D) fish and reptiles

57 / 100

Category: Biology Ch 6 Class 12

A typical human chromosome contains _________ nucleotides in its DNA

240 million

140 million

150 million

160 million

58 / 100

Category: Biology

Q.23 The vectors for disease spread belong to which of the following phylum?

A. Porifera

B. Platyhelminthes

C. Annelida

D. Arthropoda

59 / 100

Category: Biology Ch 7 Class 12

Exchange of segments between homologous chromosomes is called:

UHS 2012
Biology
Cell Cycle
Elimination Tool:

A) Segregation

B) Independent assortment

C) Crossing over

D) Mutation

60 / 100

Category: Biology Ch 5 Class 12

Turner’s syndrome is characterized by having:

UHS 2015
Biology
Growth and Development
Elimination Tool:

A) Trisomy 21

B) 44 + XXY

C) Trisomy

D) 44 + XO

61 / 100

Category: Biology Ch 2 Class 11

Carbon atom is

Monovalent

Divalent

Trivalent

62 / 100

Category: Biology Ch 3 Class 11

Non-protein but inorganic, detachable co-factors are called ______:

NUMS 2020
Biology
Enzymes
Elimination Tool:

A) Activators

B) Prosthetic groups

C) Coenzymes

D) Apo-enzymes

63 / 100

Category: Biology Ch 13 Class 11

______ respiration is the process by which cell utilized oxygen and produces CO2

Cellular

Organismic

Both of these

None of these

64 / 100

Category: Biology Ch 5 Class 12

Meristems are group of cells that

Allow the surrounding region to divide

Provide nutrition

. Help in movement

Retain the potential to divide

65 / 100

Category: Biology Ch 8 Class 12

The total number of genes present in a particular population, at a particular time is called:

NUMS 2019 Cancelled
Biology
Variation and Genetics
Elimination Tool:

A) Gene

B) Genome

C) Genotype

D) Gene Pool

66 / 100

Category: Biology Ch 3 Class 12

The gland known as the “gland of emergency” is the:

NTS 2014
Biology
Coordination and Control
Elimination Tool:

A) Pituitary

B) Adrenal

C) Thyroid

D) Parathyroid

67 / 100

Category: Biology Ch 7 Class 11

Which of the following bacteria are able to release oxygen into the environment?

NTS 2018
Biology
Kingdom Protista
Elimination Tool:

A) Saprotrophic bacteria

B) Parasitic bacteria

C) Cyanobacteria

D) Pathogenic bacteria

68 / 100

Category: Biology

5 different amino acids, numbered 1, 2, 3, 4, and 5, below from the following sequence in the path of a polypeptide chain:

1-2-3-4-2-5-3

Messenger RNA codon, which correspond to the amino acids, are:
amino acid 1 UGU

amino acid 2 GAU

amino acid 3 CAC

amino acid 4 UAG

amino acid 5 AAG

Which one of the following DNA bases sequences could provide the code for the given section of the polypeptide?

NUMS Mock 2
Biology
Biological Molecules

A) ACACTTGTGATGCTATTCGTG

B) ACACUAGUGAUGCUAUUCGUG

C) ACACTAGTGATGCTAAACGTG

D) ACACTAGTGATCCTATTCGTG

69 / 100

Category: Biology Ch 1 Class 12

Malpighian tubules are involved in excretion in:

NTS 2011
Biology
Homeostasis
Elimination Tool:

A) Cockroach

B) Earthworm

C) Human

D) Planaria

70 / 100

Category: Biology Ch 14 Class 11

The function of papillary muscles is to:

NUMS 2020
Biology
Transport
Elimination Tool:

A) Move blood from semilunar valve into pulmonary vein

B) Prevent the backward flow of blood from the ventricle

C) Push the blood from right atrium to left atrium

D) Push the blood from left atrium to aorta

71 / 100

Category: Biology Ch 13 Class 11

Oxygen contents per liter of air is

10 ml

100 ml

200 ml

100ml

72 / 100

Category: Biology Ch 14 Class 11

About 55% of the volume of the human blood is?

NTS 2015 SMBBMC
Biology
Transport
Elimination Tool:

A) Plasma

B) Blood proteins

C) Blood cells

D) Both B and C

73 / 100

Category: Biology

As pH of blood decreases, H+ ions increases, which combine the proteins part of hemoglobin, to decrease its ability to bind with:

NUMS Mock 2
Biology
Gaseous Exchange

A) O2

B) CO2

C) CO

D) H2

74 / 100

Category: Biology Ch 8 Class 11

Fungi whose growth is favored by fire is called:

NTS 2016 SMBBMC
Biology
Kingdom Fungi
Elimination Tool:

A) Pyrophilus

B) Prophilus

C) Philus

D) Prephylus

75 / 100

Category: Biology

Q.19 Of the following, which one is not included in protostomes:

A. Arthropods

B. Poriferans

C. Annelids

D. Coelenterates

76 / 100

Category: Biology Ch 4 Class 12

In which organism males are haploid

Aphids

Honey bee

Mosquito

Butterfly

77 / 100

Category: Biology Ch 7 Class 12

Process of uncontrolled cell division is due to which one of the following reasons?

NUMS 2018
Biology
Cell Cycle
Elimination Tool:

A) DNA replication

B) Mutations

C) Translation

D) Transcription

78 / 100

Category: Biology Ch 6 Class 12

An individual has an additional sex chromosome. Which syndrome does he have?

NUMS 2014
Biology
Chromosomes and DNA
Elimination Tool:

A) Down's syndrome

B) Turner's syndrome

C) Jacob's syndrome

D) Klinefelter's syndrome

79 / 100

Category: Biology Ch 10 Class 11

Which of the following is a freshwater sponge?

NUMS 2016
Biology
Kingdom Animalia
Elimination Tool:

A) Sycon

B) Leucosolenia

C) Euplectella

D) Spongilla

80 / 100

Category: Biology

As an excretory organ, liver:

NUMS Mock 3
Biology
Homeostasis

A) Detoxifies many chemical poisons

B) Produces ammonia for excretion by the kidneys

C) Produces urea and uric acids from the nitrogen of amino acids

D) All of the above

81 / 100

Category: Biology

Q.25 Which of the following is an example of a marine annelid?

A. Neries

B. Stylaria

C. Earthworm

D. Leech

82 / 100

Category: Biology Ch 10 Class 12

Neo-Darwinism has integrated discoveries and ideas from

Taxonomy

Paleontology

Genetics

All of these

83 / 100

Category: Biology

Lymph nodes are not present:

NUMS Mock 1
Biology
Coordination and Control

A) Neck region

B) Axilla

C) Groin

D) Spleen

84 / 100

Category: Biology

In a marine environment, the ion secreted by the kidney is:

NUMS Mock 1
Biology

A) Na+

B) K+

C) Mg2+

D) Cl-

85 / 100

Category: Biology Ch 10 Class 11

The simplest form in Kingdom Animalia belongs to:

NUMS 2018
Biology
Kingdom Animalia
Elimination Tool:

A) Eumetazoa

B) Bilateria

C) Protozoa

D) Parazoa

86 / 100

Category: Biology Ch 11 Class 11

The process by which one molecule of Glucose splits up into molecules of Pyruvate is called:

NTS 2018
Biology
Bioenergetics
Elimination Tool:

A) Glycolysis

B) Oxidative Phospholyration

C) Electron Transport Chain

D) Kreb's Cycle

87 / 100

Category: Biology

Unpaired facial bones are:

NUMS Mock 3
Biology
Support and Movement

A) Maxilla, Zygomatic

B) Palatine, Inferior concha

C) Nasal, Lacrimal

D) Mandible, Vomer

88 / 100

Category: Biology

Q.61 Herbivores always occupy :

A. T1

B. T3

C. T2

D. T4

89 / 100

Category: Biology Ch 8 Class 11

Fungi which get their food directly from dead organic matter are called?

Parasitic fungi

Predators

Mutualists

Decomposers

90 / 100

Category: Biology

The numbers of capsomeres found in adenovirus capsid is?

NUMS Mock 3
Biology
Bio-diversity | Variety of Life

A) 162

B) 200

C) 252

D) 155

91 / 100

Category: Biology

The thickest chamber of the human heart is:

NUMS Mock 4
Biology
Transport

A) Left atrium

B) Right atrium

C) Right ventricle

D) Left ventricle

92 / 100

Category: Biology Ch 11 Class 11

At which times there is no net gaseous exchange between leaves and the atmosphere.

Day time.

Night time

Dawn & Dusk

Mid night

93 / 100

Category: Biology

Why do some vegetables lose water when salt is applied to them?

NUMS Mock 3
Biology
Transport

A) Due to the less negative water potential of the external environment than the cell.

B) Due to the more negative water potential of the external environment that the cell

C) . Due to the less positive water potential of the external environment than the cell

D) Due to more positive water potential of the external environment than the cell

94 / 100

Category: Biology

Q.45 Muscle fatigue is characterized by all except:

A. Accumulation of lactic acid

B. pH drops

C. Cross bridges are unable to detach

D. Increased ATP concentration

95 / 100

Category: Biology

An enzyme that helps in the conversion of RNA to DNA is called:

NUMS Mock 3
Biology
Chromosomes and DNA

A) Transcriptase

B) Polymerase

C) Reverse transcriptase

D) Synthetase

96 / 100

Category: Biology Ch 3 Class 11

Malonic acid is an example of:

Irreversible inhibitor

Reversible inhibitor

Competitive inhibitor

Non-competitive inhibitor

97 / 100

Category: Biology Ch 7 Class 11

In which of the following pigments major energy reserves and cell wall are like plants?

Rhodophyta

Chlorophyta

Phaeophyta

Chrysophyta

98 / 100

Category: Biology Ch 14 Class 11

Fibrinogen is necessary for:

NUMS 2014
Biology
Transport
Elimination Tool:

A) Metabolism

B) Respiration

C) Reproduction

D) Clotting

99 / 100

Category: Biology

According to the theory of natural selection, organisms produce:

NUMS Mock 2
Biology
Evolution

A) Offspring according to the resources available

B) Offspring to create resources

C) To create resources

D) More offspring than supported

100 / 100

Category: Biology Ch 2 Class 12

The number of muscles in a human body is about:

NTS 2012
Biology
Support and Movement
Elimination Tool:

A) 200

B) 300

C) 400

E) 600

Your score is

The average score is 52%

Structured Practice for Best Entry Test Preparation

This topic-wise and chapter-wise practice test allows students to focus on individual biology concepts, including diagrams, processes, and conceptual questions. Regular practice enhances understanding, sharpens problem-solving skills, and builds confidence to tackle both board and competitive exam questions efficiently.

Free Resources for Best Entry Test Preparation

Students can access free Biology Practice Test 1 to systematically improve knowledge, recall, and problem-solving abilities. This test is suitable for FSC Board Exams as well as major entry tests, helping students perform better in the biology section. PLS Academy provides these resources to support students in their preparation.

JazakAllah

Comments

3 responses to “Biology Practice Test 1”

Anonymous

September 30, 2022

Hello sr thanks for your service
But there are some MCQ Wich are out of the PMC slabus in this test
But the test was very useful to me thanks
wajiha

October 5, 2022

Q:27 problem
Anonymous

October 13, 2022

AOA sir
Here in the test there are many mcqs that are not included in Nums r Pmc syllabus
Kindly check it out
Thanks
But it’s very helpful
Thanks