Biology Practice Test 1

Created by Ali Durrani

MDCAT Practice Tests

Biology Practice Test 1

This is the Free Access to Limited MCQs. Enroll to PLS Boost Premium Bundle to Get More MCQs HERE

1 / 100

Category: Biology Ch 6 Class 12

Gene mutations take place in:

NUMS 2014
Biology
Chromosomes and DNA
Elimination Tool:

A) Ribosomes

B) Chloroplasts

C) Deoxyribonucleic acids

D) None of them

2 / 100

Category: Biology Ch 8 Class 12

The position of a gene on chromosome is called

Habitat

Position

Locus

Location

3 / 100

Category: Biology Ch 10 Class 12

Which condition can be explained by Lamarckism?

PMC Sample 1
Biology
Evolution
Elimination Tool:

A) How giraffes got their long neck

B) How humans lost their tail

C) How humans became bipedal

D) all of these

4 / 100

Category: Biology Ch 9 Class 11

Chlorophyta is considered to be closest to plants but do not resemble plants in having:

NUMS 2020
Biology
Kingdom Plantae
Elimination Tool:

A) Chlorophyll a and b

B) Starch as stored food

C) Cellulose cell wall

D) Multicellular sex organs

5 / 100

Category: Biology Ch 3 Class 12

The nerve center for sight is located in the

NUMS 2014
Biology
Coordination and Control
Elimination Tool:

A) Thalamus

B) Myopic

C) Both a and b

D) None of these

6 / 100

Category: Biology Ch 1 Class 12

Which of the following statement about conifers is correct?

Stored excretory products in vacuoles, at a concentration that leads to crystal formation.

ccumulate waste in leaves, which fall in autumn.

Production of black wood in the center.

Excrete some of the waste materials directly into soil, occasionally using them as a chemical weapon against other competing plants.

7 / 100

Category: Biology Ch 10 Class 11

The radial symmetry is found in the animals of

Protozoa

Porifera

Cnidaria

All of these

8 / 100

Category: Biology

Process ensuring the survival of species over long periods of time, even though individual members of the species die.

NUMS Mock 2
Biology
Man and His Environment

A) Reproduction

B) Adaptability

C) Mitosis

D) Respiration

9 / 100

Category: Biology

Q.67 Interaction between genes occupying different loci is:

A. Dominance

B. Pleiotropy

C. Epistasis

D. Gene linkage

10 / 100

Category: Biology Ch 11 Class 11

1 NADH in respiratory chain produces:

NUMS 2015
Biology
Bioenergetics
Elimination Tool:

A) 1 ATP

B) 2 ATP

C) 3 ATP

D) 4 ATP

11 / 100

Category: Biology Ch 9 Class 12

Chimaeric DNA is also known as

Recombinant DNA

Complementary DNA

Vector

Plasmid

12 / 100

Category: Biology Ch 10 Class 11

Archaeopteryx is a transitional stage between the members of which one of the following pairs?

NTS 2013
Biology
Kingdom Animalia
Elimination Tool:

A) Amphibian … bird

B) Fish … amphibian

C) Reptile … mammal

D) Reptile … bird

13 / 100

Category: Biology

The region of the chromosome or, more specifically, the length of the DNA molecule, which has a particular function is called _______.

NUMS Mock 2
Biology
Chromosomes and DNA

A) Kinetochore

B) Locus

C) Allele

D) Gene

14 / 100

Category: Biology

How many ml of blood is pumped by each contraction of the heart?

NUMS Mock 1
Biology
Transport

A) 80 ml

B) 90 ml

C) 70 ml

D) 60 ml

15 / 100

Category: Biology Ch 9 Class 12

Gel electrophoresis is a technique:

PMC 2020
Biology
Biotechnology
Elimination Tool:

A) Employed by forensic scientist to assist in the identification of the individuals by their respective type of DNA

B) Collect all the genes found in one complete set of chromosome

C) Is a technique to separate different sizeds fragment of charge bearing polymers (proteins, RNA or DNA)

D) Grows single cell or a group of cells in a glass ware on artificial medium under aseptic conditions

16 / 100

Category: Biology

The position of an organism in a food chain of an ecosystem called:

NUMS Mock 2
Biology
Man and His Environment

A) Level of ecosystem

B) Food chain

C) Food web

D) Trophic level

17 / 100

Category: Biology Ch 10 Class 11

Which vertebrate groups have scaly skin?

NTS 2013
Biology
Kingdom Animalia
Elimination Tool:

A) amphibians and fish

B) amphibians and mammals

C) fish and mammals

D) fish and reptiles

18 / 100

Category: Biology Ch 13 Class 12

In a forest, there are a lot of plants; trees, shrubs, and herbs. What will the Palm trees face if they grow in the same forest?

NTS 2019
Biology
Man and His Environment
Elimination Tool:

A) Intraspecific competition.

B) Interspecific competition

C) Environmental competition

D) All of the above

19 / 100

Category: Biology Ch 3 Class 11

An activated enzyme consisting of polypeptide chain and a cofactor is called:

Apoenzyme

Holoenzyme

Activated enzyme

Both b and c

20 / 100

Category: Biology Ch 11 Class 11

Aerobic respiration results in how much ATP?

NUMS 2016
Biology
Bioenergetics
Elimination Tool:

A) 2

B) 36

C) 18

D) 32

21 / 100

Category: Biology

Photosystems are located in _

A. Stroma

B. Chloroplast envelope

C. Thylakoid membranes

D. The intergrana

22 / 100

Category: Biology Ch 5 Class 11

Numerous opportunistic diseases might attack a person suffering from which of the following diseases?

NUMS 2020
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Measles

B) Influenza

C) Hepatitis A

D) AIDS

23 / 100

Category: Biology Ch 14 Class 11

The main cause of creation of tension between water molecules is ______ which helps to make water chains pulled up xylem sap.

NUMS 2019 Reconduct
Biology
Transport
Elimination Tool:

A) Root pressure

B) Imbibition

C) Water potential

D) Hydrogen bonding

24 / 100

Category: Biology Ch 3 Class 11

The lock and key model of enzyme action was proposed by:

PMC Sample 3
Biology
Enzymes
Elimination Tool:

A) Louis Pasteur

B) Emil Fischer

C) Daniel Koshland

D) Urey Miller

25 / 100

Category: Biology

Q.2 Competitive inhibition can be overcome by using

A. Low concentration of substrate

B. High concentration of inhibitor

C. Moderate concentration of inhibitor

D. High concentration of substrate

26 / 100

Category: Biology Ch 9 Class 12

Treatment of hereditary disorders by gene manipulations is called:

NUMS 2016
Biology
Biotechnology
Elimination Tool:

A) Biotechnology

B) Genetic engineering

C) Gene therapy

D) None of these

27 / 100

Category: Biology Ch 6 Class 11

Which of the following is not a sterilization method for the control of bacteria?

PMC Practice 4
Biology
Kingdom Prokaryote
Elimination Tool:

A) Radiation

C) High temperature

B) Filtration

D) Antiseptic

28 / 100

Category: Biology Ch 10 Class 12

Which of the following is a vestigial organ?

PMC Sample 2
Biology
Evolution
Elimination Tool:

A) Teeth

B) Nails

C) Body hair

D) Ears

29 / 100

Category: Biology

HIV is a:

NUMS Mock 3
Biology
Bio-diversity | Variety of Life

A) Virus

B) Prions

C) Viroid

D) Venom

30 / 100

Category: Biology Ch 1 Class 12

Which organ is called the body thermostat?

NUMS 2020
Biology
Homeostasis
Elimination Tool:

A) Pituitary gland

B) Kidneys

C) Hypothalamus

D) Adrenal gland

31 / 100

Category: Biology

The type of plastids found in roots of plants are _____.

NUMS Mock 4
Biology
Cell Structure and Function

A) Chloroplasts

B) Chromoplasts

C) Leucoplasts

D) All of these options are correct

32 / 100

Category: Biology Ch 7 Class 11

Trypanosoma belongs to class:

NTS 2011
Biology
Kingdom Protista
Elimination Tool:

A) Sarcodina

B) Flagellata

C) Ciliata

D) Suctoria

33 / 100

Category: Biology Ch 13 Class 12

Grassland of Argentina is:

NUMS 2015
Biology
Man and His Environment
Elimination Tool:

A) Prairies

B) Savana

C) Boreal

D) Pampas

34 / 100

Category: Biology

Q.11 In cocci, three plane division result in formation of sarcine which is a

A. Cuba of 8 cocci

B. Square of 4 cocci

C. Irregular structure

D. Triangular 6 cocci

35 / 100

Category: Biology Ch 12 Class 11

Puccinia is a parasitic:

Plant

Fungus

Animal

Algae

36 / 100

Category: Biology Ch 5 Class 11

Bacteriophages, or phages are also known as:

PMC Sample 2
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Bacteria facilitator

B) Bacteria eater

C) Animal viruses

D) Plant viruse

37 / 100

Category: Biology Ch 10 Class 11

Pseudocoelom is actually derived from:

NUMS 2016
Biology
Kingdom Animalia
Elimination Tool:

A) Blastocoel

B) Gastrocoel

C) Neurocoel

D) Haemocoel

38 / 100

Category: Biology

As an excretory organ, liver:

NUMS Mock 3
Biology
Homeostasis

A) Detoxifies many chemical poisons

B) Produces ammonia for excretion by the kidneys

C) Produces urea and uric acids from the nitrogen of amino acids

D) All of the above

39 / 100

Category: Biology Ch 10 Class 12

The total aggregate of genes in a population at any one time is called population’s

Genome

Genomic library

Genetic group

Gene pool

40 / 100

Category: Biology Ch 7 Class 11

Which of the following statement about eiliates in incorrect?

Contain mainly unicellular organisms.

Their contractile vacoule is respobsible for water regulation.

They are even capable of sexual reproduction.

Diploid nucleus being smaller is responsible for cells metabolism and growth while polyploidy nucleus functions in sexual process.

41 / 100

Category: Biology

Q.49 Another name for the sex cell is:

A. Hormone

B. Gamete

C. Zygote

D. Testicle

42 / 100

Category: Biology

Q.36 The retinal is important for___________ of human

A. Vision

B. Metabolism

C. Muscle contraction

D. Muscle twitch

43 / 100

Category: Biology Ch 12 Class 11

A part of the digestive system that is not in contact with food is the:

NTS 2017
Biology
Nutrition
Elimination Tool:

A) Small intestine

C) Liver

B) Stomach

D) Large intestine

44 / 100

Category: Biology Ch 5 Class 12

Wood is not formed in:

NUMS 2015
Biology
Growth and Development
Elimination Tool:

A) Monocots

B) Dicots

C) Gymnosperms

D) All of given

45 / 100

Category: Biology Ch 9 Class 12

A single stranded nucleotide sequence that will hybridize into a certain piece of DNA is

Primer

Probe

Genome

Both a & b

46 / 100

Category: Biology Ch 11 Class 11

Quantitative study of energy relationships in biological systems obeys.

Bioenergetics

Laws of thermodynamics

Laws of thermo chemistry

Laws of chemical energeti

47 / 100

Category: Biology

Q.12 An enzyme without its cofactor is called.

A. Coenzyme

B. Apoenzyme

C. Holoenzyme

D. Proenzyme

48 / 100

Category: Biology Ch 10 Class 12

On Galapagos island, among the birds, ____ caught much attention of Darwin in formulating his work, related to adaptations.

NUMS 2019 Reconduct
Biology
Evolution
Elimination Tool:

A) Pigeons

B) Ravens

C) Finches

D) Parrots

49 / 100

Category: Biology Ch 1 Class 12

Right kidney is slightly lower than left kidney due to:

NUMS 2018
Biology
Homeostasis
Elimination Tool:

A) Heart

B) Liver

D) Lungs

C) Pancreas

50 / 100

Category: Biology Ch 13 Class 12

Greenhouse gases are those that:

NUMS 2015
Biology
Man and His Environment
Elimination Tool:

A) Prevent entry of ultraviolet rays

B) Prevent rainfall

C) Prevent heat to escape

D) All given options are correct

51 / 100

Category: Biology Ch 5 Class 11

The genome of the virus includes the:

PMC Sample 1
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Deoxyribonucleic acid

B) Ribonucleic acid

C) Amino acids

D) Deoxyribonucleic acid and ribonucleic acids

52 / 100

Category: Biology Ch 7 Class 11

All of the following are the characteristics of the kingdom Protista except:

NTS 2019
Biology
Kingdom Protista
Elimination Tool:

A) Members can be photosynthetic

B) Members can be free living

C) Some members move via flagella

D) Some members are shaped like rods and termed bacilli

53 / 100

Category: Biology

Q.52 The patellar reflex and the Achilles reflex are examples of:

A. Monosynaptic reflex

B. Polysynaptic reflex

C. Hemi Synaptic reflex

D. Both A and B

54 / 100

Category: Biology

Q.25 For respiratory metabolism, bacterial cell membrane contains

A. Proteins

B. Lipids

C.Enzymes

D. Chemicals

55 / 100

Category: Biology Ch 2 Class 11

5 different amino acids, numbered 1, 2, 3, 4, and 5, below from the following sequence in the path of a polypeptide chain:

1-2-3-4-2-5-3

Messenger RNA codon, which correspond to the amino acids, are:
amino acid 1 UGU

amino acid 2 GAU

amino acid 3 CAC

amino acid 4 UAG

amino acid 5 AAG

Which one of the following DNA bases sequences could provide the code for the given section of the polypeptide?

NTS 2015 DUHS and JSMU
Biology
Biological Molecules
Elimination Tool:

A) ACACTTGTGATGCTATTCGTG

B) ACACUAGUGAUGCUAUUCGUG

C) ACACTAGTGATGCTAAACGTG

D) ACACTAGTGATCCTATTCGTG

56 / 100

Category: Biology Ch 3 Class 11

Identify the wrong statements.

(a) The substrate binds to active site of enzyme and not fitting into active site

(b) The binding of substrate induces the enzyme to alter its shape

(c) Chemical bonds of substrate break down not to form new enzyme-product complex

(d) The enzyme releases the products of the reaction and runs through catalytic cycle once again

NUMS 2019 Reconduct
Biology
Enzymes
Elimination Tool:

A) A, C

B) B, D

C) B, C

D) A, D

57 / 100

Category: Biology Ch 12 Class 12

Coniferous forests located at high altitude are called

Taiga

Alpine

Boreal

Arctic

58 / 100

Category: Biology

Q4 The branch that deals with the study of viruses fs known as?

A.. Entomology

B. Bacteriology

Virology

D. Epidemiology

59 / 100

Category: Biology Ch 5 Class 11

The social organization of howling monkeys was studied by:

NUMS 2014
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Allen

B) Thorpe

C) Schjeldeup ebbe

D) Carpenter

60 / 100

Category: Biology Ch 2 Class 11

Human cells maintain concentration gradients across their plasma membranes, such that there is a high sodium concentration outside the cell and a high potassium concentration inside the cell.

Suppose that within the cell membrane are sodium leak channels or carrier proteins. These channels would allow sodium to:

NTS 2017
Biology
Biological Molecules
Elimination Tool:

A) move out of the cell by simple diffusion

B) move into the cell by simple diffusion

C) move out of the cell by facilitated diffusion

D) move into the cell by facilitated diffusion

61 / 100

Category: Biology Ch 3 Class 11

The optimum pH for the enzyme arginase is which of the following?

PMC Sample 2
Biology
Enzymes
Elimination Tool:

A) 9.0

B) 9.3

C) 9.7

D) 10

62 / 100

Category: Biology Ch 1 Class 12

The human body maintains all of its cells’ internal concentration _____ to internal body fluid.

NUMS 2019 Cancelled
Biology
Homeostasis
Elimination Tool:

A) Isotonic

B) Hypotonic

C) Hypertonic

D) Hyposmotic

63 / 100

Category: Biology Ch 7 Class 11

Who first separated bacteria from other protists as a group?

John Hogg

Ernst Haeckel

Margulis and Schwartz

Herbert Copeland

64 / 100

Category: Biology Ch 2 Class 12

Which one of the following forms the blk of exoskeleton of an arthropod?

Epicuticle

Procuticle

Ectocuticle

None of these

65 / 100

Category: Biology Ch 4 Class 12

Development of an egg into zygote without fertilization is called

Parthenogenesis

Apomixes

Parthenocarpy

None of these

66 / 100

Category: Biology Ch 1 Class 12

Malpighian tubules are involved in excretion in:

NTS 2011
Biology
Homeostasis
Elimination Tool:

A) Cockroach

B) Earthworm

C) Human

D) Planaria

67 / 100

Category: Biology Ch 3 Class 12

The autonomic nervous system controls all of the following activities except:

NTS 2014
Biology
Coordination and Control
Elimination Tool:

A) Digestion of food

B) Heart beat

C) Contraction of pupil of eye

D) Thought

68 / 100

Category: Biology Ch 9 Class 11

Protonema is

Thallus like

Algae like

Fungus like

Plant like

69 / 100

Category: Biology Ch 10 Class 12

Choose the correct combination:

NUMS 2019 Cancelled
Biology
Evolution
Elimination Tool:

A) Darwin – survival of the fittest

B) Darwin – no extinction

C) Lamarck – acquired transmission

D) Both Darwin – survival of the fittest and Lamark – acquired transmission

70 / 100

Category: Biology Ch 13 Class 11

During breathing air from Pharynx enters to:

UHS 2018
Biology
Gaseous Exchange
Elimination Tool:

A) Trachea

B) Bronchioles

C) Alveoli

D) Bronchi

71 / 100

Category: Biology Ch 5 Class 11

The virus can only survive and reproduce inside a:

NTS 2019
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Animal Cell

B) Bacterial cell

C) Living cell

D) Non-living cell

72 / 100

Category: Biology Ch 13 Class 11

The passageways of the respiratory system mucous secreting cells called:

NTS 2019
Biology
Gaseous Exchange
Elimination Tool:

A) Tracheal cells

B) Goblet cells

C) Surfactant cells

D) Pleural cells

73 / 100

Category: Biology Ch 5 Class 12

Thymus is found in the human body in _____.

PMC Practice 2
Biology
Growth and Development
Elimination Tool:

A) The medulla oblongata

B) The mediastinum of the upper thorax

C) Both Options A and B are correct

D) None of these options is correct

74 / 100

Category: Biology Ch 10 Class 11

Filter feeders extract food particles from:

NUMS 2014
Biology
Kingdom Animalia
Elimination Tool:

A) Water

B) Soil

C) Air

D) Blood

75 / 100

Category: Biology

Phenylmethyl ketone can be converted into ethyl benzene in one step by using:

NUMS Mock 4
Chemistry
Aldehydes and Ketones

A) LiAlH4

B) Zn(Hg)-HCl

C) NaBH4

D) CH3Mgl

76 / 100

Category: Biology

The RNA found in Ribosomes is:

NUMS Mock 1
Biology
Chromosomes and DNA

A) mRNA

B) rRNA

C) tRNA

D) Polysome

77 / 100

Category: Biology Ch 12 Class 11

Carbohydrates, fats & proteins are essential for:

Metabolic processes of an organism

Providing energy

Formation of sturctures

All of these

78 / 100

Category: Biology Ch 10 Class 11

Of the following which one is non-cellular in most cases in animals?

Mesenchyme

Sclerenchyma

Chlorenchyma

Mesoderm

79 / 100

Category: Biology

Q31 What happens during muscle contraction to the length of each myosin and actin filament?

A. A band becomes short

B. I band elongates

C. There is no change in sarcomere

D. Z- lines get closer

80 / 100

Category: Biology Ch 10 Class 11

Pseudocoelem develops from

Blastopore

Plastoquinone

Blastocoel

Splitting of mesoderm

81 / 100

Category: Biology Ch 2 Class 12

The movement of plants in response to touch stimulus is called:

NTS 2012
Biology
Support and Movement
Elimination Tool:

A) Hydrotropism

B) Chemotropism

C) Geotropism

D) Thigmotropism

82 / 100

Category: Biology

Q.57 Which of the following is paired correctly?

A. Pisces-jellyfish

B. Echinodermata- cuttlefish

C. Mollusca- starfish

D. Arthropoda- silver fish

83 / 100

Category: Biology Ch 9 Class 11

Which type of leucoplasts store lipids?

NUMS 2020
Biology
Kingdom Plantae
Elimination Tool:

A) Amyloplast

B) Elaioplast

C) Proteinoplast

D) Etioplast

84 / 100

Category: Biology Ch 11 Class 11

Where do the light – dependent reactions of photosynthesis occur?

NTS 2016 SMBBMC
Biology
Bioenergetics
Elimination Tool:

A) In the guard cells of the stomata

B) Stroma of chloroplast

C) In the thylakoid membrane of chloroplast

D) Cytoplasm of leaf cell

85 / 100

Category: Biology Ch 10 Class 11

The simplest form in Kingdom Animalia belongs to:

NUMS 2018
Biology
Kingdom Animalia
Elimination Tool:

A) Eumetazoa

B) Bilateria

C) Protozoa

D) Parazoa

86 / 100

Category: Biology Ch 10 Class 12

Who developed a theory of natural selection essentially identical to Darwin’s

Hardy-Weinberg

Alfred Wallace

Malthus

Lyell

87 / 100

Category: Biology Ch 4 Class 12

Menstruation, the shedding of the lining of the uterus (endometrium), is accompanied by:

NUMS 2019 Cancelled
Biology
Reproduction
Elimination Tool:

A) Shivering

B) Fever

C) Bleeding

D) Vomiting

88 / 100

Category: Biology

Q.41 Corpus luteum is yellow glandular mass and is important source of:

A. Estrogen

B. FSH

C. Testosterone

D. Progesterone

89 / 100

Category: Biology

Q.21 The spent energy in the form pf ADP is regeneratèd by mitochondria into which of the following forni?

A. AMP

B.ATP

C.ADP

D.All of these

90 / 100

Category: Biology Ch 6 Class 12

During DNA replication ______ attaches the fragment to the lagging strand.

NUMS 2019 Reconduct
Biology
Chromosomes and DNA
Elimination Tool:

A) Ligase

B) Invertase

C) Helicase

D) Topoisomerase

91 / 100

Category: Biology Ch 3 Class 12

Gibberellins may be substituted for _____ light, therefore promote flowering in long day plants.

White

Red

Blue

Green

92 / 100

Category: Biology Ch 12 Class 12

Desert ecosystem of Mianwali is

Thar

Thal

Cholistan

None

93 / 100

Category: Biology Ch 2 Class 12

Type of sclerenchyma cells found in seed coats are:

NUMS 2015
Biology
Support and Movement
Elimination Tool:

A) Fibers

B) Tracheids

C) Sclereids

D) Vessels

94 / 100

Category: Biology

Q.18 The internal buds are known as which of the following?

A. Spicules

B. Choanocytes

C. Gemmules

D. Both A and B

95 / 100

Category: Biology Ch 13 Class 11

The glycolate produced diffuses into the membrane bounded organelles called

Glyoxisomes

Peroxisomes

Lysosomes

Mitochondria

96 / 100

Category: Biology Ch 14 Class 11

In human heart, the left atrium receives:

PMC 2020
Biology
Transport
Elimination Tool:

A) The superior vena cava

B) The inferior vena cava

C) The coronary sinus

D) The four pulmonary veins

97 / 100

Category: Biology Ch 4 Class 11

Which among the following sentence is not correct about the organelles?

NUMS 2019 Reconduct
Biology
Cell Structure and Function
Elimination Tool:

A) They are found in all Eukaryotic cells.

B) They are only found in multicellular organisms.

C) They coordinate to produce the cell.

D) They are small sized and mostly internal.

98 / 100

Category: Biology

Lymph nodes are not present:

NUMS Mock 1
Biology
Coordination and Control

A) Neck region

B) Axilla

C) Groin

D) Spleen

99 / 100

Category: Biology Ch 8 Class 12

Linked genes with closer loci ______ Mendel’s law of independent assortment as they _____ assort independently.

NUMS 2019 Reconduct
Biology
Variation and Genetics
Elimination Tool:

A) Don’t obey: cannot

B) Don’t obey: can

C) obey : cannot

D) obey : can

100 / 100

Category: Biology Ch 2 Class 12

Muscles that are attached to bones and have voluntary movements are termed as ______ muscles.

NUMS 2019 Reconduct
Biology
Support and Movement
Elimination Tool:

A) Cardiac

B) Smooth

C) Skeletal

D) Hard

Your score is

The average score is 52%

0%

PLS Academy – LearnoSpot

PLS Boost Bundle

Comments

3 responses to “Biology Practice Test 1”