Biology Practice Test 1

Created by Ali Durrani

MDCAT Practice Tests

Biology Practice Test 1

This is the Free Access to Limited MCQs. Enroll to PLS Boost Premium Bundle to Get More MCQs HERE

1 / 100

Category: Biology

The finger like infoldings, which are formed by inner membrane of mitochondria, are called:

NUMS Mock 2
Biology
Cell Structure and Function

A) Ribosomes

B) Matrix

C) Porin

D) Cristae

2 / 100

Category: Biology Ch 6 Class 11

Which of the following structure is not present in all the bacteria?

Cell membrane

Chromatin bodies

Ribosomes

Capsule

3 / 100

Category: Biology Ch 5 Class 12

Germ cells give rise to:

NTS 2012
Biology
Growth and Development
Elimination Tool:

A) Legs

B) Head

C) Eggs and sperms

D) Hands

4 / 100

Category: Biology Ch 7 Class 12

Gametes are produced by:

PMC 2021 Tested
Biology
Cell Cycle
Elimination Tool:

A) Meiosis

B) Mitosis

C) None of these

D) Fission

5 / 100

Category: Biology

What is the effect of enzyme DNA ligase?

NUMS Mock 2
Biology
Chromosomes and DNA

A) DNA is broken up at specific sites

B) DNA fragments are joined together

C) DNA replication occurs

D) DNA transcription occurs

6 / 100

Category: Biology Ch 13 Class 11

During inspiration, the space inside the chest cavity is increased due to:

UHS 2019
Biology
Gaseous Exchange
Elimination Tool:

A) The relaxation of the muscles of the diaphragm

B) Relaxation of the external intercostal muscles

D) The contraction of the muscles of the diaphragm

C) Increased pressure

7 / 100

Category: Biology Ch 7 Class 12

Mitotic apparatus in animals is formed by

Aster and spindle

Polar and kinetochore microtubules

Spindle and RNA

Spindle only

8 / 100

Category: Biology Ch 2 Class 11

5 different amino acids, numbered 1, 2, 3, 4, and 5, below from the following sequence in the path of a polypeptide chain:

1-2-3-4-2-5-3

Messenger RNA codon, which correspond to the amino acids, are:
amino acid 1 UGU

amino acid 2 GAU

amino acid 3 CAC

amino acid 4 UAG

amino acid 5 AAG

Which one of the following DNA bases sequences could provide the code for the given section of the polypeptide?

NTS 2015 DUHS and JSMU
Biology
Biological Molecules
Elimination Tool:

A) ACACTTGTGATGCTATTCGTG

B) ACACUAGUGAUGCUAUUCGUG

C) ACACTAGTGATGCTAAACGTG

D) ACACTAGTGATCCTATTCGTG

9 / 100

Category: Biology Ch 5 Class 11

Which of the following is the simplest form of pathogens causing diseases?

NTS 2018
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Viruses

B) Prions

C) Fungus

D) Amoeba

10 / 100

Category: Biology Ch 8 Class 11

Unicellular fungi which is non-hyphal is

Mushroom

Yeast

Penicillium

Mold

11 / 100

Category: Biology Ch 4 Class 12

Ovulation is induced by ______ hormone secreted by the pituitary gland.

NUMS 2019 Reconduct
Biology
Reproduction
Elimination Tool:

A) Follicle stimulating

B) Estrogen

C) Luteinizing hormone

D) Progesterone

12 / 100

Category: Biology

Q.13 Without enzymes, the biological reaction would proceed at:

A. Same speed

B. Constant speed

C. Very slow speed

D. Variable speed

13 / 100

Category: Biology Ch 10 Class 12

Adaptation of traits to better fill a niche is known as which of the following?

PMC Sample 3
Biology
Evolution
Elimination Tool:

A) polymorphism

B) gene linkage

C) specialization

D) replication

14 / 100

Category: Biology Ch 11 Class 11

The end product of glycolysis in anaerobic respiration is:

PMC 2020
Biology
Bioenergetics
Elimination Tool:

A) Ethanol and Carbon dioxide

B) Lactate

C) Pyruvate

D) Both A and B

15 / 100

Category: Biology Ch 11 Class 11

The point at which there is no net exchange of gases between leaves and atmosphere is known as

Neutral point

Compensation point

Parallel point

Competitive point

16 / 100

Category: Biology Ch 6 Class 11

Coccobacillus has a shape similar to

Diplobacillus

Sarcina

Egg

None of these

17 / 100

Category: Biology Ch 1 Class 12

Deamination in the liver initially produces:

NTS 2010
Biology
Homeostasis
Elimination Tool:

A) Ammonia

B) Arginine

C) Ornithine

D) Urea

18 / 100

Category: Biology Ch 2 Class 11

Ptyalin can convert starch into:

NUMS 2015
Biology
Biological Molecules
Elimination Tool:

A) Monosaccharide form

B) Oligosaccharide form

C) Polysaccharide form

D) All given options

19 / 100

Category: Biology Ch 14 Class 11

Humoral immunity is carried by a special group of cells called:

NTS 2017
Biology
Transport
Elimination Tool:

A) B-cells

B) Killer cells

C) Helper cells

D) Null cells

20 / 100

Category: Biology Ch 5 Class 12

Leukaemia is associated with an increased number of _____ in blood.

NTS 2016 DUHS & JSMU
Biology
Growth and Development
Elimination Tool:

A) Erythrocytes

B) Basophils

C) Eosinophils

D) Leucocytes

21 / 100

Category: Biology Ch 11 Class 11

The organisms able to use sunlight directly as a source of energy are

Plants

Animals

Omnivores

Fungi

22 / 100

Category: Biology Ch 5 Class 12

A plant has a growth pattern called

Closed growth

Open growth

In between the two

23 / 100

Category: Biology

Q.12 In enzymatic mechanism, the substrate bind to enzyme active site to produce?

A. Reactants

B. Enzyme

C. Products

D. all of these

24 / 100

Category: Biology Ch 13 Class 12

Flow of energy in an ecosystem is:

NUMS 2014
Biology
Man and His Environment
Elimination Tool:

A) Unidirectional

B) Tridirectional

C) Multidirectional

D) Bidirectional

25 / 100

Category: Biology Ch 12 Class 11

Stunted growth of roots is due to the deficiency of _____ in plants

Potassium

Magnesium

Phosphorus

Iron

26 / 100

Category: Biology Ch 6 Class 11

The first simplest oxygen producing organism:

NUMS 2016
Biology
Kingdom Prokaryote
Elimination Tool:

A) Methanogens

B) Cyanobacteria

C) Euglena

D) Spirogyra

27 / 100

Category: Biology Ch 2 Class 11

Which of the following are instant sources of energy in living organisms, like glucose? Their general formula is:

NUMS 2019 Cancelled
Biology
Biological Molecules
Elimination Tool:

A) Cx(H2O)y

B) C6H12O6

C) Cx(H2O)x

D) Cx(HO)y

28 / 100

Category: Biology Ch 6 Class 12

A fern has _____ pairs of chromosomes.

NTS 2012
Biology
Chromosomes and DNA
Elimination Tool:

A) 23

B) 40

C) 500

D) 13

29 / 100

Category: Biology Ch 6 Class 12

Chromosomes are composed of

40% protein and 60% DNA

50% protein and 50% DNA

70% protein and 30% DNA

60% protein and 40% DNA

30 / 100

Category: Biology

When the concentration of the external medium is equal to the concentration of the internal medium of a cell, the situation is called:

NUMS Mock 1
Biology
Biological Molecules

A) Hypertonic

B) Hypotonic

C) Isotonic

D) Heterotonic

31 / 100

Category: Biology Ch 11 Class 11

Glucose → 2 pyruvic acid + 2H2O

2ADP + 2Pi → 2 ATP

2NAD + 4H → 2NADH + 2H+

These three reactions collectively constitute ______.

NTS 2012
Biology
Bioenergetics
Elimination Tool:

A) Kreb’s cycle

B) Calvin’s cycle

C) Electron Transport Chain

E) Glycolysis

32 / 100

Category: Biology Ch 2 Class 11

Which chemical component has the same % in bacterial as well as the mammalian cell?

Water

Carbohydrate

Proteins

Lipids

33 / 100

Category: Biology

Phenylketonuria is

NUMS Mock 2
Biology
Chromosomes and DNA

A) Sex linked dominant trait

B) Sex linked recessive trait

C) Autosomal dominant trait

D) Autosomal recessive trait

34 / 100

Category: Biology

The function of respiratory passage, Cilia is to keep the airways clear of:

NUMS Mock 4
Biology
Gaseous Exchange

A) Carbon dioxide

B) Oxygen

C) Dust

D) Carbon Monoxide

35 / 100

Category: Biology Ch 4 Class 11

Chief material present in the cell wall of plants, fungal, and prokaryotic cells is:

NUMS 2020
Biology
Cell Structure and Function
Elimination Tool:

A) Proteins

B) Lipids

C) Polysaccharides

D) Phospholipids

36 / 100

Category: Biology Ch 2 Class 11

The number of calories required to raise the temperature of 1g of water from 15 to 16?C is called?

Specific Heat of Vaporization

Specific Heat capacity

Caloric Heat

Both A and C

37 / 100

Category: Biology

The idea that opposed the idea of abiogenesis was proposed by?

NUMS Mock 4
Biology
Cell Structure and Function

A) Robert Hooke

B) Robert Brown

C) Rudolph Virchow

D) Lorenz Oken

38 / 100

Category: Biology Ch 6 Class 11

Which of the following structures provides greater pathogenicity to the bacteria?

PMC Practice 3
Biology
Kingdom Prokaryote
Elimination Tool:

A) Slime

B) Cell wall

C) Cell membrane

D) Capsule

39 / 100

Category: Biology Ch 11 Class 11

Which of the following light is least absorbed by the plants:

Orange

Red

Blue

Green

40 / 100

Category: Biology Ch 13 Class 11

There are ______ stomata per square cm of leaf surface in Tobacco plants.

1200

12000

100,000

1000

41 / 100

Category: Biology

Q.58 Which of the following is incorrect for ascent of sap?

A. water potential

B. Cohesion tension

C. root pressure

D. imbibition

42 / 100

Category: Biology Ch 10 Class 12

Prokaryotes are considered to be evolved

. 3.5 billion years ago

1.5 billion years ago

4.5 billion years ag

1000 million years ago

43 / 100

Category: Biology Ch 10 Class 12

Modification in the organization of the basic pentadactyl limb structure found in vertebrates provides good evidence for the principle of:

NUMS 2020
Biology
Evolution
Elimination Tool:

A) Adaptive radiation

B) Convergent evolution

C) Genetic drift

D) Inheritance of acquired characters

44 / 100

Category: Biology Ch 13 Class 11

Pharynx leads air into _____ through glottis.

NTS 2012
Biology
Gaseous Exchange
Elimination Tool:

A) Trachea

B) Bronchus

C) Alveoli

E) Larynx

45 / 100

Category: Biology Ch 10 Class 12

In the Hardy – Weinberg principle, p2 + 2pq + q2 = 1 . q2 represents the frequency of the:

NTS 2010
Biology
Evolution
Elimination Tool:

A) Homozygous dominant

B) Heterozygous dominant

C) Heterozygous recessive

D) Homozygous recessive

46 / 100

Category: Biology

Pick the correct option about Drosophila.

NUMS Mock 3
Biology
Variation and Genetics

A) The Male is larger with a pointed abdomen

B) The female has sex combs on its front legs

C) It has a generation time of just eight weeks

D) Salivary gland cells have giant chromosomes in their nuclei

47 / 100

Category: Biology Ch 1 Class 12

Capillaries present around the loop of Henle:

NUMS 2018
Biology
Homeostasis
Elimination Tool:

A) Vasa recta

B) Peritubular

C) Lacteals

D) Glomerulus

48 / 100

Category: Biology Ch 6 Class 12

Genetic information in the DNA is encoded as:

NTS 2018
Biology
Chromosomes and DNA
Elimination Tool:

A) Deoxyribose sugar

B) Ribose sugar

C) Phosphate group

D) Sequence of nitrogenous bases

49 / 100

Category: Biology Ch 6 Class 11

A Dutch scientist firstly observed very small creatures in

PMC Practice 6
Biology
Kingdom Prokaryote
Elimination Tool:

A) Vinegar

B) Saliva

C) Rain water

D) All of Above

50 / 100

Category: Biology

Q.19 Of the following, which one is not included in protostomes:

A. Arthropods

B. Poriferans

C. Annelids

D. Coelenterates

51 / 100

Category: Biology Ch 2 Class 11

Carbon atom is

Monovalent

Divalent

Trivalent

52 / 100

Category: Biology Ch 7 Class 11

Which of the protozoa has a striking resemblance to collar cells in sponges?

Zooflagellates

Choanflagellates

Trypanosomoa

Trichonymphas

53 / 100

Category: Biology Ch 7 Class 11

These protists are mostly unicellular (a few are colonial) organisms with spherical or elongated bodies with a single central nucleus. They possess from one to many long, whip-like flagella that enable them to move. Flagellates move rapidly, pulling themselves forward by lashing flexible flagella that are usually located at the anterior end. Examples include trypanosome, euglena, etc.

The above give lines indicate which of the following group of protozoa:

NUMS 2017
Biology
Kingdom Protista
Elimination Tool:

A) Amoeba

B) Arthropods

C) Foraminifera

D) Zooflagellates

54 / 100

Category: Biology

Q.7 The thalamus and the hypothalamus are located in which region of the brain?

A. brain stem

B. cerebrum

C. cerebellum

D. Diencephalon

55 / 100

Category: Biology

The diagram represents two liquids, separated by a membrane through which osmosis can occur.

What movement of molecules will occur?

NUMS Mock 3
Biology
Transport

A) Molecules of dissolved substance move from left to right.

B) Molecules of dissolved substance move from right to left.

C) Overall, water molecules move from left to right.

D) Overall, water molecules move from right to left.

56 / 100

Category: Biology Ch 1 Class 12

Secondary cell wall of sclerenchyma cells is impregnated with

Cellulose

Peptidoglycan and murein.

Lignin

Pectin

57 / 100

Category: Biology

Q.60 A small size gene can be get easily by/from:

A. From chromosome

B. Reverse transcription of mRNA

C. Chemically synthesized it

D. Genomic material

58 / 100

Category: Biology Ch 5 Class 12

Meristems are group of cells that

Allow the surrounding region to divide

Provide nutrition

. Help in movement

Retain the potential to divide

59 / 100

Category: Biology Ch 5 Class 12

Higher plants grow through

Growing points

Whole plant body is capable of growing

Only roots grow

None of these

60 / 100

Category: Biology Ch 4 Class 12

Amniocentesis is performed between the:

NTS 2011
Biology
Reproduction
Elimination Tool:

A) 16th and 18th week of gestation

B) 1st and 2nd week of gestation

C) 30th and 32nd week of gestation

D) 37th and 38th week of gestation

61 / 100

Category: Biology Ch 12 Class 11

Fundography is relevant to:

NUMS 2016
Biology
Nutrition
Elimination Tool:

A) Heart

C) Stomach

B) Liver

D) Eyes

62 / 100

Category: Biology

Proteins and lipids are converted into glycolipids and glycoproteins by adding carbohydrates by?

NUMS Mock 4
Biology
Cell Structure and Function

A) Ribosomes

B) Cytoplasm

C) Golgi apparatus

D) Endoplasmic reticulum

63 / 100

Category: Biology Ch 13 Class 11

Which one of the following is a genetic disorder in which abnormally thick mucus is produced in the lungs and other parts of the body?

NUMS 2020
Biology
Gaseous Exchange
Elimination Tool:

A) Lung cancer

B) Chronic bronchitis

C) Cystic fibrosis

D) Emphysema

64 / 100

Category: Biology Ch 11 Class 12

The actual location or place where an organism lives is

Environment

Biosphere

Biomass

Habitat

65 / 100

Category: Biology Ch 8 Class 11

Parasitic fungi absorbs nutrients directly from the living host with the help of special hyphae tips called _______.

NTS 2012
Biology
Kingdom Fungi
Elimination Tool:

A) Roots

B) Root hair

C) Rhizoids

D) Haustoria

66 / 100

Category: Biology Ch 1 Class 11

The experiments on DNA molecules in chromosomes for knowing the basis of inherited diseases are conducted by :

Molecular biologists

Freshwater biologists

Social biologist

67 / 100

Category: Biology

Q.34 What molecule would you not expect to find in a refrovirus

A. Adenine

B. Thymine

C. Uracil

D Guanine

68 / 100

Category: Biology Ch 10 Class 11

Of the following which one is not found in series proterostomia.

Annelida

Arthropoda

Mollusea

Echinodermata

69 / 100

Category: Biology Ch 2 Class 11

Movement of ions and large molecules with the help of protein molecules in and out of the cell is called _________.

NTS 2016 DUHS & JSMU
Biology
Biological Molecules
Elimination Tool:

A) Diffusion

B) Facilitated diffusion

C) Passive transport

D) Osmosis

70 / 100

Category: Biology Ch 3 Class 11

Which type of bonds are never formed when a substrate fits into the active site of an enzyme?

PMC Practice 1
Biology
Enzymes
Elimination Tool:

A) Hydrogen bonds

B) Ionic interactions

C) Hydrophobic interactions

D) Covalent linkages

71 / 100

Category: Biology

Q.41 The stretch reflex is also known as:

A. Stretch reflex

B. Spinal reflex

C. Golgi tendon reflex

D. Myotatic reflex

72 / 100

Category: Biology Ch 4 Class 12

Gametes in animals are produced by

Mitosis

RedMeiosis

BlueFission

Apomixis

73 / 100

Category: Biology Ch 10 Class 11

Class Elasmobranchi have an outer covering of?

NTS 2015 DUHS and JSMU
Biology
Kingdom Animalia
Elimination Tool:

A) Placoid scale

B) Cycloid

C) Ctenoid scales

D) Epidermal scales

74 / 100

Category: Biology Ch 6 Class 11

Under the microscope, the bacteria appear a bluish-purple color. Which class of bacteria are on the slide?

PMC Practice 5
Biology
Kingdom Prokaryote
Elimination Tool:

A) Helix

B) Around

C) Rod

D) Rigid helix

75 / 100

Category: Biology Ch 5 Class 12

In multicellular plants cell division occur by

Binary fission

Conjugation

Meiosis

Mitosis

76 / 100

Category: Biology Ch 9 Class 12

Organisms that have had a foreign gene inserted into them are

Transformed organisms

Transgenic organisms

Transfigured organisms

Recombinant organisms

77 / 100

Category: Biology Ch 9 Class 12

First restriction enzyme was isolated by

Kary Mullis B

Hamilton O. Smith

Maxam Gilbert

Hamilton John

78 / 100

Category: Biology Ch 10 Class 11

The mammals termed as the connecting link between reptilians and mammals are:

NUMS 2014
Biology
Kingdom Animalia
Elimination Tool:

A) Marsupials

B) Eutherians

C) Monotremes

D) Metatherians

79 / 100

Category: Biology Ch 9 Class 12

Which one of the following options is NOT an example of genetic engineering?

NTS 2019
Biology
Biotechnology
Elimination Tool:

A) Insulin-producing bacteria

B) Oil eating bacteria

C) Photosynthetic bacteria

D) Metal extracting bacteria

80 / 100

Category: Biology Ch 11 Class 11

What is the function of Ribulose?

PMC 2020
Biology
Bioenergetics
Elimination Tool:

A) Intermediates in photosynthesis

B) Respiratory fuel

C) Intermediates in cellular respiration

D) Component of DNA and RNA

81 / 100

Category: Biology Ch 13 Class 11

Active site of Rubisco is evolved to bind

CO2

O2

Both of these

H2O

82 / 100

Category: Biology Ch 5 Class 12

Sertoli cells

Provide liquid medium to cells in testes

Provide protection and nourishment to cells

Secrete testosterone

Both a and b

83 / 100

Category: Biology Ch 12 Class 11

Deficiency of K+ causes:

Stunted growth & strong chlorosis

No electron transport chains

Premature death of leaves.

Stunted growth of roots.

84 / 100

Category: Biology

5 different amino acids, numbered 1, 2, 3, 4, and 5, below from the following sequence in the path of a polypeptide chain:

1-2-3-4-2-5-3

Messenger RNA codon, which correspond to the amino acids, are:
amino acid 1 UGU

amino acid 2 GAU

amino acid 3 CAC

amino acid 4 UAG

amino acid 5 AAG

Which one of the following DNA bases sequences could provide the code for the given section of the polypeptide?

NUMS Mock 2
Biology
Biological Molecules

A) ACACTTGTGATGCTATTCGTG

B) ACACUAGUGAUGCUAUUCGUG

C) ACACTAGTGATGCTAAACGTG

D) ACACTAGTGATCCTATTCGTG

85 / 100

Category: Biology Ch 6 Class 11

Which of the following statement is incorrect regarding germ theory of diseases postulated by Robert Koch?

A specific organism can always be found in association with a given disease

The organism can be isolated and grown in pure culture in the laboratories

The pure culture cannot produce the disease when inoculated into susceptible animal however the causative organism isolated from pure culture can do so.

It is possible to recover the organism in pure culture from the experimentally infected animals.

86 / 100

Category: Biology

Q.29 Diaphragm is a sheet of:

A. Skeletal muscle

B. Cardiac muscles

C. Smooth muscles

D. Extension of intercostal muscles

87 / 100

Category: Biology Ch 13 Class 12

Which of the following describes an ecological niche?

NTS 2015 SMBBMC
Biology
Man and His Environment
Elimination Tool:

A) The habitat in which an organism finds its food supply

B) The habitat in which an organism find the most suitable climate

C) the relationship between an organism and other species

D) the way in which an environment is exploited by an organism

88 / 100

Category: Biology

Q.28 The vocal cords are stretched across:

A. Larynx

B. Glottis

C. Pharynx

D. Trachea

89 / 100

Category: Biology

Q.7 A neuron located in the cential hervous system that projects its axon outside the CNS is called:

A. Motor nerve

B. Sensory nerve

C. Both A and B

D. Mixed nerve

90 / 100

Category: Biology Ch 7 Class 12

In which stage of meiotic division centromere divides?

NUMS 2017
Biology
Cell Cycle
Elimination Tool:

A) Anaphase I

B) Anaphase II

C) Metaphase II

D) Both A and B

91 / 100

Category: Biology Ch 1 Class 12

Sperms of liverworts, mosses, ferns move towards archegonia, in response to uncleic acid released by the ovum. This is an example of:

Chemotropic movement

Chemotactic movement.

Chemosastic movement

. Haptonastic movement.

92 / 100

Category: Biology Ch 5 Class 12

The disease that arises due to increasing age is:

NTS 2018
Biology
Growth and Development
Elimination Tool:

A) Alzheimer's

B) Hepatitis C

C) Cholera

D) Malaria

93 / 100

Category: Biology

Q.52 A chromosome in which a centromere stays at one end is called?

A. Metacentric

Telocentric

C. Acrocentric

D. All of these

94 / 100

Category: Biology Ch 6 Class 11

Cyanobacteria have which of the following type of cell wall?

PMC Sample 2
Biology
Kingdom Prokaryote
Elimination Tool:

A) Gram positive

B) Gram negative

C) Cellulose

D) Acid fast

95 / 100

Category: Biology Ch 5 Class 11

Which of the following is not related to the enveloped virus?

PMC 2020
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) They survive for a short time

B) Their envelope is sensitive to sunlight

C) They are tolerant to antibodies

D) Envelope is derived from host

96 / 100

Category: Biology Ch 1 Class 11

Which one is not correct for a productive theory?

It is predictive

It has explanatory power

It discourage s suggestion of different hypotheses

It discourages suggestion of different hypotheses

97 / 100

Category: Biology

Many scientists believe that one of the following is evolutionary origin(s) of animals, plants and fungi?

NUMS Mock 1
Biology
Evolution

A) Protists

B) Algae

C) Bacteria

D) Protozoans

98 / 100

Category: Biology Ch 4 Class 12

In human females, oocytes are held in the second metaphase until ________.

NUMS 2019 Reconduct
Biology
Reproduction
Elimination Tool:

A) Death

B) Birth

C) Ovulation

D) Fertilization

99 / 100

Category: Biology

The cells which play a very important role in developing immunity are:

NUMS Mock 4
Biology
Transport

A) Monocytes

B) Neutrophils

C) Lymphocytes

D) Thrombocytes

100 / 100

Category: Biology Ch 13 Class 12

Process ensuring the survival of species over long periods of time, even though individual members of the species die.

UHS 2018
Biology
Man and His Environment
Elimination Tool:

A) Reproduction

B) Adaptability

C) Mitosis

D) Respiration

Your score is

The average score is 52%

0%

PLS Academy – LearnoSpot

PLS Boost Bundle

Comments

3 responses to “Biology Practice Test 1”