Biology Practice Test 3

Created by Ali Durrani

MDCAT Practice Tests

Biology Practice Test 3

This is the Free Access to Limited MCQs. Enroll to PLS Boost Premium Bundle to Get More MCQs HERE

1 / 100

Category: Biology Ch 8 Class 12

In the pea plants, the factors round and yellow seeds (RRYY) is dominant over wrinkled and green seeds (rryy). Keeping this in mind, identify the seed that has the genotype round and green.

NTS 2011
Biology
Variation and Genetics
Elimination Tool:

A) Rryy

B) rrYy

C) RrYy

D) RRYy

2 / 100

Category: Biology Ch 8 Class 11

Fungi which get their food directly from dead organic matter are called?

Parasitic fungi

Predators

Mutualists

Decomposers

3 / 100

Category: Biology Ch 12 Class 11

A part of the digestive system that is not in contact with food is the:

NTS 2017
Biology
Nutrition
Elimination Tool:

A) Small intestine

C) Liver

B) Stomach

D) Large intestine

4 / 100

Category: Biology

Q.60 A small size gene can be get easily by/from:

A. From chromosome

B. Reverse transcription of mRNA

C. Chemically synthesized it

D. Genomic material

5 / 100

Category: Biology Ch 4 Class 12

Testes are structures that produce:

NTS 2015 SMBBMC
Biology
Reproduction
Elimination Tool:

A) Spores

B) Sperms

C) Seeds

D) Ova

6 / 100

Category: Biology Ch 6 Class 11

The word Archaeobacteria (a division of bacteria) derived from Greek means

True bacteria

False bacteria

Recent bacteria

Ancient bacteria

7 / 100

Category: Biology Ch 12 Class 11

Amylase is not produced by the following type(s) of salivary gland:

NUMS 2015
Biology
Nutrition
Elimination Tool:

A) Parotid

B) Submandibular

C) Sublingual

D) None of the given options are correct

8 / 100

Category: Biology Ch 8 Class 12

How many pairs of homologous chromosomes are present in Pisum sativum

Five pairs

Six pairs

Seven pairs

Eight pairs

9 / 100

Category: Biology Ch 12 Class 11

Chlorosis refers to the lack of:

NUMS 2016
Biology
Nutrition
Elimination Tool:

A) Growth

B) Chlorophyll

C) Yellowing of leaf margin

D) Width of leaf

10 / 100

Category: Biology Ch 8 Class 12

Pick the correct option about Drosophila.

NUMS 2015
Biology
Variation and Genetics
Elimination Tool:

A) The Male is larger with a pointed abdomen

B) The female has sex combs on its front legs

C) It has a generation time of just eight weeks

D) Salivary gland cells have giant chromosomes in their nuclei

11 / 100

Category: Biology Ch 7 Class 12

Which of the following statements is true about metaphase?

PMC 2021 Tested
Biology
Cell Cycle
Elimination Tool:

A) Chromosomes are thickest during this phase

B) Chromosomes are shortest during this phase

C) Chromosomes are longest during this phase

D) Chromosomes are shortest and thickest during this phase

12 / 100

Category: Biology Ch 3 Class 11

An activated enzyme consisting of polypeptide chain and a cofactor is called:

Apoenzyme

Holoenzyme

Activated enzyme

Both b and c

13 / 100

Category: Biology

Q.25 The substrate of the trypsin is:

A. Proteins

B. Dipeptides

C. Polypeptides

D. Amino acids

14 / 100

Category: Biology Ch 6 Class 11

If lipopolysaccharides did not appear in the wall of bacteria on staining then it will be known as ________.

UHS 2018
Biology
Kingdom Prokaryote
Elimination Tool:

A) Gram negative

B) Gram positive

C) Capsule

D) Both Gram positive & negative

15 / 100

Category: Biology Ch 10 Class 11

The mammals termed as the connecting link between reptilians and mammals are:

NUMS 2014
Biology
Kingdom Animalia
Elimination Tool:

A) Marsupials

B) Eutherians

C) Monotremes

D) Metatherians

16 / 100

Category: Biology Ch 14 Class 11

The only vein in the human body carrying oxygenated blood is:

NUMS 2020
Biology
Transport
Elimination Tool:

A) Femoral

B) Pulmonary

C) Renal

D) Iliac

17 / 100

Category: Biology Ch 9 Class 12

Commonly used restriction enzyme is

pSC 101

pBR 322

EcoRI

All of these

18 / 100

Category: Biology

Q.5 Evaporation of water from aerial parts of plants is called:

A. ascent ofI Sap

B. deplasmolysis

C. deplasmolysis

D. none of these

19 / 100

Category: Biology Ch 10 Class 12

The ultimate source of all changes is:

NUMS 2015
Biology
Evolution
Elimination Tool:

A) Mutation

B) Migration

C) Genetic drift

D) Change in allele frequency

20 / 100

Category: Biology Ch 4 Class 11

Which of the following are related to the synthesis of excretory protein by the cell?

NUMS 2019 Cancelled
Biology
Cell Structure and Function
Elimination Tool:

A) Cell membranes

B) Rough Endoplasmic Reticulum

C) Smooth Endoplasmic Reticulum

D) Centrioles

21 / 100

Category: Biology Ch 10 Class 12

What is in q2 Hardy Weinberg equilibrium?

NTS 2019
Biology
Evolution
Elimination Tool:

A) Frequency of the dominant allele

B) Frequency of the recessive allele

C) Frequency of both alleles

D) Number of both alleles

22 / 100

Category: Biology Ch 10 Class 12

Neo-Darwinism has integrated discoveries and ideas from

Taxonomy

Paleontology

Genetics

All of these

23 / 100

Category: Biology

Q.66 Which of the following provides the strong evidence in support of evolution:

A. Fossil record

B. Comparative embryology

C. Comparative anatomy

D. Molecular biology

24 / 100

Category: Biology Ch 9 Class 12

Cloning is a form of:

NUMS 2016
Biology
Biotechnology
Elimination Tool:

A) Parthenogenesis

B) Apomixis

C) Sexual reproduction

D) Asexual reproduction

25 / 100

Category: Biology

Q.5 Which statement is incorrect?

A. In short day plants red light prevents flowering

B. In long day plants for red light promotes flowering

C. Leaf unrolling occurs in grasses

D. Henbane is a short-day plant

26 / 100

Category: Biology

Lock and Key Model for enzyme action propose by Emil Fischer suggests that:

NUMS Mock 4
Biology
Enzymes

A) Enzymes are unbiased for the substrate

B) Enzymes can modify their active sites

C) Enzymes are restricted to one reaction type

D) An enzyme can catalyze variety of reactions

27 / 100

Category: Biology

Which of the following is correct in humans?

NUMS Mock 1
Biology
Reproduction

A) Both sperm and egg contain yolk

B) All genetic information comes from sperm

C) Sperm contains little cytoplasm

D) Fertilization commonly occurs in the uterus

28 / 100

Category: Biology Ch 1 Class 12

Which of the following types of transpiration account for 5 – 7 % of total transpiration that take place in plants?

NUMS 2019 Cancelled
Biology
Homeostasis
Elimination Tool:

A) Cuticular

B) Lenticular

C) Stomatal

D) Leaves

29 / 100

Category: Biology Ch 5 Class 12

Thyroxine deficiency in adults’ results in a condition called:

UHS 2015
Biology
Growth and Development
Elimination Tool:

A) Cretinism

B) Hypothyroidism

C) Thyrotoximia

D) Myxoedema

30 / 100

Category: Biology Ch 9 Class 11

Which of the following is an ovoviviparous organism?

PMC Sample 3
Biology
Kingdom Plantae
Elimination Tool:

A) reptiles

B) mammals

C) frog

D) Duckbill platypus

31 / 100

Category: Biology Ch 11 Class 12

The biosphere covers about

. 8-10 km

5-10 km

15-30 km

16-20 km

32 / 100

Category: Biology Ch 11 Class 11

In paper chromatography xanthophyll will give ______ color:

NTS 2010
Biology
Bioenergetics
Elimination Tool:

A) Orange

B) Grey

C) Yellow

D) Blue-Green

33 / 100

Category: Biology Ch 2 Class 11

Which bond provides stability to complex carbohydrate molecules?

C-H

C-O

C-C

C-N

34 / 100

Category: Biology Ch 3 Class 11

Lock and Key Model for enzyme action propose by Emil Fischer suggests that:

PMC 2020
Biology
Enzymes
Elimination Tool:

A) Enzymes are unbiased for the substrate

B) Enzymes can modify their active sites

C) Enzymes are restricted to one reaction type

D) An enzyme can catalyze variety of reactions

35 / 100

Category: Biology

Muscular tube that passes through pharynx and joins stomach is:

NUMS Mock 1
Biology
Nutrition

A) Trachea

B) NG tube

C) Nerve canal

D) Esophagus

36 / 100

Category: Biology

Lamarck is best known for his theory of:

NUMS Mock 3
Biology
Evolution

A) Inheritance

B) Dominance

C) Inheritance of acquired characteristics

D) All of the above

37 / 100

Category: Biology Ch 10 Class 12

Choose the correct combination:

NUMS 2019 Cancelled
Biology
Evolution
Elimination Tool:

A) Darwin – survival of the fittest

B) Darwin – no extinction

C) Lamarck – acquired transmission

D) Both Darwin – survival of the fittest and Lamark – acquired transmission

38 / 100

Category: Biology Ch 13 Class 11

Thick, waxy & leathery cuticle around leaves is present in which of the following?

PMC Sample 2
Biology
Gaseous Exchange
Elimination Tool:

A) Hydrophytes

C) Halophytes

B) Mesophytes

D) Xerophytes

39 / 100

Category: Biology Ch 12 Class 11

The structure which prevents the entry of food particles into the respiratory passage is:

NUMS 2019 Cancelled
Biology
Nutrition
Elimination Tool:

A) Hard palate

B) Epiglottis

C) Soft palate

D) Larynx

40 / 100

Category: Biology

The sympathetic nervous system causes which of the following?

NUMS Mock 2
Biology
Coordination and Control

A) Constriction of the pupil

B) Decreased heart rate

C) Increased gastric section

E) Increased respiration

41 / 100

Category: Biology

Which of the following will not undergo aldol condensation?

NUMS Mock 2
Chemistry
Aldehydes and Ketones

A) Acetaldehyde

B) Propanaldehyde

C) Benzaldehyde

D) Trideuteroacetaldehyde

42 / 100

Category: Biology Ch 9 Class 11

What is the strengthening material of the prokaryotic cell wall?

PMC Practice 7
Biology
Kingdom Plantae
Elimination Tool:

A) Cellulose

B) Chitin

C) Silica waxes and lignin

D) Peptidoglycan or murein

43 / 100

Category: Biology

Why cannot viruses replicate on their own?

NUMS Mock 2
Biology
Variety of Life

A) They are too small.

B) They have no cell wall.

C) They lack metabolic machinery.

D) All of theoptions are correct.

44 / 100

Category: Biology Ch 3 Class 12

The correct option about spinal nerves is:

NUMS 2020
Biology
Coordination and Control
Elimination Tool:

A) 33 pairs

B) Mostly mixed nerves

C) Dorsal root contains sensory neurons

D) Ventral root contains motor neurons

E) C and D both

45 / 100

Category: Biology Ch 10 Class 11

The only aquatic arthropods:

PMC Sample 1
Biology
Kingdom Animalia
Elimination Tool:

A) Crustaceans

B) Arachnids

C) Myriapods

D) Gastopods

46 / 100

Category: Biology Ch 2 Class 11

5 different amino acids, numbered 1, 2, 3, 4, and 5, below from the following sequence in the path of a polypeptide chain:

1-2-3-4-2-5-3

Messenger RNA codon, which correspond to the amino acids, are:
amino acid 1 UGU

amino acid 2 GAU

amino acid 3 CAC

amino acid 4 UAG

amino acid 5 AAG

Which one of the following DNA bases sequences could provide the code for the given section of the polypeptide?

NTS 2015 DUHS and JSMU
Biology
Biological Molecules
Elimination Tool:

A) ACACTTGTGATGCTATTCGTG

B) ACACUAGUGAUGCUAUUCGUG

C) ACACTAGTGATGCTAAACGTG

D) ACACTAGTGATCCTATTCGTG

47 / 100

Category: Biology

Q.45 Muscle fatigue is characterized by all except:

A. Accumulation of lactic acid

B. pH drops

C. Cross bridges are unable to detach

D. Increased ATP concentration

48 / 100

Category: Biology Ch 11 Class 11

During the first three steps of glycolysis, glucose is converted to Fructose 1, 6-diphosphate by the rearrangement of the molecule and addition of two phosphate groups. The phosphate comes from?

NTS 2015 SMBBMC
Biology
Bioenergetics
Elimination Tool:

A) Phospholipids of the membrane

B) ADP

C) inorganic phosphates

D) ATP

49 / 100

Category: Biology

Q.54 First cardiac sound is associated with:

A. Closure of tricuspid and bicuspid valves

B. Closure of semilunar valves

C. Opening of tricuspid valves

D. Opening of semilunar valves

50 / 100

Category: Biology

Which valve action results from an increase in pressure in the ventricles of the heart?

NUMS Mock 3
Biology
Transport

A) The closing of all the heart valves

B) The closing of semilunar valves

C) The opening of the bicuspid valve

D) The opening of the semilunar valves

51 / 100

Category: Biology

In chemiosmosis, the proton (H+) moves from _______.

NUMS Mock 4
Biology
Bioenergetics

A) Stroma to Lumen

B) Cytoplasm to Stroma

C) Lumen to Stroma

D) Stroma to cytoplasm

52 / 100

Category: Biology Ch 14 Class 11

The causes of Cyanosis include:

NTS 2010
Biology
Transport
Elimination Tool:

A) Deficiency of vitamin C

B) Varicella-zoster virus

C) Degeneration of the cartilage of joints

D) Ventricular septum defect

53 / 100

Category: Biology Ch 2 Class 12

Growth movement caused in response to gravitational stimulus is called:

NTS 2011
Biology
Support and Movement
Elimination Tool:

A) Nutation

B) Geotropism

C) Nastic movement

D) Tropic movement

54 / 100

Category: Biology Ch 13 Class 11

A disease caused by gradual breakdown of the thin walls of alveoli is;

UHS 2019
Biology
Gaseous Exchange
Elimination Tool:

A) Tuberculosis

B) Asthma

C) Emphysema

D) Bronchitis

55 / 100

Category: Biology Ch 10 Class 12

Carolus Linnaeus was believer of

Special creation

Natural selection

Catastrophism

. Inheritance of acquired characters

56 / 100

Category: Biology Ch 4 Class 11

The following are all features of eukaryotic cells:

I. chloroplast

II. peroxisome

III. lysosome

IV. mitochondrion

v. nucleus

Which of these have a double membrane?

NTS 2014
Biology
Cell Structure and Function
Elimination Tool:

A) I, II and IV

B) I, III and V

C) I, IV and V

D) II, III and V

57 / 100

Category: Biology Ch 7 Class 12

Meiosis occur in

Diploid cells only

Haploid cells only

Both diploid and haploid cells

Monoploid cells

58 / 100

Category: Biology Ch 12 Class 11

Nitrogen

Magnesium

Iron

Both A and B

59 / 100

Category: Biology Ch 6 Class 12

The chromosomes with equal arms are called:

NTS 2018
Biology
Chromosomes and DNA
Elimination Tool:

A) Metacentric

B) Submetacentric

C) Acrocentric

D) Telocentric

60 / 100

Category: Biology Ch 5 Class 11

HIV is also known as:

NUMS 2014
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) AIDS

B) HAV

D) HBV

C) HTLV

61 / 100

Category: Biology Ch 9 Class 11

Of the following which one is most advanced ?

Anthoceropsida

Bryopsida

Hepaticopsida

None of these

62 / 100

Category: Biology Ch 9 Class 12

Recombinant DNA contains DNA from

2 different sources

3 different sources

2 same sources

3 same sources

63 / 100

Category: Biology

What are the functions of the inter, motor and sensory neurons in a reflex response?

NUMS Mock 4
Biology
Coordination and Control

A) Option A

B) Option B

C) Option C

D) Option D

64 / 100

Category: Biology Ch 11 Class 11

The end product of Glycolysis is:

NTS 2011
Biology
Bioenergetics
Elimination Tool:

A) Glucose-6-phosphate

B) Fructose-6-phosphate

C) Pyruvate

D) 3-Phosphoglycerate

65 / 100

Category: Biology Ch 1 Class 12

Which of the following fishes excrete large volume of diluted urine?

Bony Marine fishes

Fresh water fishes

Both depending upon the surrounding water

None of these

66 / 100

Category: Biology Ch 11 Class 11

Photosynthesis is process in which ________ compounds of carbon (CO2) and hydrogen (H2O) are reduced to carbohydrate like (glucose) using light energy.

Organic

Energy rich

Energy poor

Reduced

67 / 100

Category: Biology

Q.64 Which of the following conditions is not required to be true for a population in Hardy-Veinberg equilibrium?

A. Random mutation

B. Large population

C. No natural selection

D. Random mating

68 / 100

Category: Biology Ch 5 Class 11

Vaccine Was discovered by :

Louis Pasteur

Edward Jennar

Ivanowski

Stanely

69 / 100

Category: Biology Ch 10 Class 11

Which one of the following does not have intermediate host?

NUMS 2016
Biology
Kingdom Animalia
Elimination Tool:

A) Tapeworm

C) Liver fluke

B) Ascaris

D) Plasmodium

70 / 100

Category: Biology Ch 8 Class 12

Which traits are most likely to affect men than women?

PMC 2020
Biology
Variation and Genetics
Elimination Tool:

A) X linked recessive

B) X linked dominant

C) Autosomal dominant

D) Autosomal recessive

71 / 100

Category: Biology

In cross-section each Centriole consist of nine (each in triplets) of:

NUMS Mock 2
Biology
Cell Structure and Function

A) Microfilaments

B) Microvilli

C) Microtubules

D) Intermediate filaments

72 / 100

Category: Biology Ch 4 Class 11

It is the non living component of the cell, it is secreted and maintained by the living portion of the cell and is found only in plants. What is this structure?

NTS 2015 SMBBMC
Biology
Cell Structure and Function
Elimination Tool:

A) Golgi apparatus

B) lysosome

C) mitochondrion

D) cell wall

73 / 100

Category: Biology Ch 8 Class 12

A trait whose alleles are present in both males and females but prominent more in one sex than other is a:

NUMS 2016
Biology
Variation and Genetics
Elimination Tool:

A) Sex-linked trait

B) Sex limited trait

C) Sex influenced trait

D) X-linked trait

74 / 100

Category: Biology Ch 7 Class 11

Brown algae are also known as

Phaeophyta

Rhodophyta

Pyrrophyta

Chrysophyta

75 / 100

Category: Biology Ch 9 Class 11

Which of the following is true in angiosperm life cycle?

NTS 2014
Biology
Kingdom Plantae
Elimination Tool:

A) Gametophyte are photosynthetic and partially independent than sporophyte

B) Sporophytes are totally dependent on gametophytes

C) Gametophytes are totally dependent on sporophytes

D) Both gametophytes and sporophytes are totally dependent on each other

76 / 100

Category: Biology Ch 10 Class 12

Which of the following theories or evolution can best explain the vestigial organs.

NUMS 2014
Biology
Evolution
Elimination Tool:

A) Darwinism

B) Lamarckism

C) Natural selection

D) Special creation

77 / 100

Category: Biology

While working in a laboratory, before studying a sample under the microscope, it was immersed in a dye solution to obtain ______.

NUMS Mock 1
Biology
Biology and its Major Fields of Specialization

A) Magnification

B) Image

C) Match

D) Contrast

78 / 100

Category: Biology Ch 9 Class 11

Which one of the following is not in the group of Gymnosperm?

NTS 2012
Biology
Kingdom Plantae
Elimination Tool:

A) Cycads

B) Gingko

C) Gnetae

E) Musci

79 / 100

Category: Biology Ch 13 Class 12

Which statement is true?

20% of total water is in the form of frozen ice caps

80% is in oceans

1% as fresh water lakes, streams and rivers

10% is in canals

80 / 100

Category: Biology Ch 5 Class 11

Which of the following category is most general with its members lest resembling with each other than the other categries:

Species

Genus

Family

Order

81 / 100

Category: Biology Ch 2 Class 11

Which of the following has the ability to develop ester linkage with the OH group of Pentose sugar?

NUMS 2017
Biology
Biological Molecules
Elimination Tool:

A) Purine

B) Pyrimidine

C) H3PO4

D) HNO3

82 / 100

Category: Biology Ch 3 Class 12

Which one of the following is common to all neurons?

PMC 2020
Biology
Coordination and Control
Elimination Tool:

A) A cell body which contains a nucleus

B) A thick myelin sheath

C) Presence of node of Ranvier

D) Presence of Schwann cells

83 / 100

Category: Biology Ch 3 Class 11

Restriction endonucleases

PMC Sample 2
Biology
Enzymes
Elimination Tool:

A) are bacterial enzyme

B) convert RNA to DNA

C) hydrolyze protein into amino acids

D) get mutated for DNA repair

84 / 100

Category: Biology Ch 4 Class 11

Lysosomes are also called:

NTS 2012
Biology
Cell Structure and Function
Elimination Tool:

A) Suicide Sacs

B) Chondriosome

C) Storage organelle

D) Dicytosome

85 / 100

Category: Biology

Given figures shows:

NUMS Mock 4
Biology
Gaseous Exchange

A) Structure of Lenticel

B) Hydathode showing gaseous vapour exchange

C) Fungus reproducing by spore formation

D) Algae reproducing by spore formation

86 / 100

Category: Biology Ch 7 Class 12

Which of the following statements concerning nucleolus is correct?

NTS 2014
Biology
Cell Cycle
Elimination Tool:

A) It disappears at the time of cell division

B) There is only one nucleolus in every cell

C) It plays important role in the synthesis of ribonucleic acid and ribosomes in prokaryotic cells

D) It helps in destroying worn-out organelles

87 / 100

Category: Biology Ch 11 Class 11

Many substances which are urgently required by the cell while cell absorbs them against the concentration gradient by utilizing energy in the form of:

NUMS 2019 Reconduct
Biology
Bioenergetics
Elimination Tool:

A) ATP

B) Heat

C) GTP

D) Light

88 / 100

Category: Biology Ch 5 Class 11

Bacteriophages, or phages are also known as:

PMC Sample 2
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Bacteria facilitator

B) Bacteria eater

C) Animal viruses

D) Plant viruse

89 / 100

Category: Biology Ch 2 Class 12

Vertebrae of the neck are called:

NUMS 2020
Biology
Support and Movement
Elimination Tool:

A) Coccygeal vertebrae

B) Cervical vertebrae

C) Sacral vertebrae

D) Lumbar vertebrae

90 / 100

Category: Biology Ch 12 Class 11

Carotenoids are related to:

NUMS 2015
Biology
Nutrition
Elimination Tool:

A) Vitamin A

B) Vitamin B

C) Vitamin C

D) Vitamin D

91 / 100

Category: Biology Ch 6 Class 12

The total of all the alleles in a population is called a:

NUMS 2014
Biology
Chromosomes and DNA
Elimination Tool:

A) Genetic drift

B) Genotype

C) Gene pool

D) Gene mutation

92 / 100

Category: Biology Ch 4 Class 12

During birth, central nervous system of infants can be damaged by

PMC Sample 3
Biology
Reproduction
Elimination Tool:

A) syphilis

B) genital herpes

C) gonorrhoa

D) HPV

93 / 100

Category: Biology Ch 13 Class 11

The passageways of the respiratory system mucous secreting cells called:

NTS 2019
Biology
Gaseous Exchange
Elimination Tool:

A) Tracheal cells

B) Goblet cells

C) Surfactant cells

D) Pleural cells

94 / 100

Category: Biology

Q.12 An enzyme without its cofactor is called.

A. Coenzyme

B. Apoenzyme

C. Holoenzyme

D. Proenzyme

95 / 100

Category: Biology Ch 7 Class 12

Gametes in animals are produced by:

PMC 2021 Tested
Biology
Cell Cycle
Elimination Tool:

A) Meiosis

B) Fission

C) Mitosis

D) All three

96 / 100

Category: Biology Ch 3 Class 12

On land, frogs are:

NUMS 2014
Biology
Coordination and Control
Elimination Tool:

A) Hypermetric

B) Cerebral cortex

C) Normal sighted

D) None of these

97 / 100

Category: Biology Ch 12 Class 12

One of the most important cause of desertification is

Floods

Wind blowing

Raining

Deforestation

98 / 100

Category: Biology

The photosynthetic pigments of plants are arranged as clusters in thylakoid membranes. The reaction centers of these clusters consist of _____ molecules.

NUMS Mock 3
Biology
Bioenergetics

A) Chlorophyll

B) ATP

C) Carotenoids

D) Glucose

99 / 100

Category: Biology Ch 2 Class 12

Gibberellins is an example of

Growth inhibitor

Growth stimulator

Growth hormone

None of these

100 / 100

Category: Biology Ch 11 Class 11

Of the following which one is not an energy releasing process?

Glycolysis

Respiration

Photosynthesis

Kreb's cycle

Your score is

The average score is 59%

0%

PLS Academy – LearnoSpot

PLS Boost Bundle