Biology Practice Test 2

Created by Ali Durrani

MDCAT Practice Tests

Biology Practice Test 2

This is the Free Access to Limited MCQs. Enroll to PLS Boost Premium Bundle to Get More MCQs HERE

1 / 100

Category: Biology

5 different amino acids, numbered 1, 2, 3, 4, and 5, below from the following sequence in the path of a polypeptide chain:

1-2-3-4-2-5-3

Messenger RNA codon, which correspond to the amino acids, are:
amino acid 1 UGU

amino acid 2 GAU

amino acid 3 CAC

amino acid 4 UAG

amino acid 5 AAG

Which one of the following DNA bases sequences could provide the code for the given section of the polypeptide?

NUMS Mock 2
Biology
Biological Molecules

A) ACACTTGTGATGCTATTCGTG

B) ACACUAGUGAUGCUAUUCGUG

C) ACACTAGTGATGCTAAACGTG

D) ACACTAGTGATCCTATTCGTG

2 / 100

Category: Biology Ch 2 Class 11

Which type of protein structure contains the three dimensional structure?

NTS 2013
Biology
Biological Molecules
Elimination Tool:

A) Primary

B) Secondary

C) Tertiary

D) Quaternary

3 / 100

Category: Biology

The idea that opposed the idea of abiogenesis was proposed by?

NUMS Mock 4
Biology
Cell Structure and Function

A) Robert Hooke

B) Robert Brown

C) Rudolph Virchow

D) Lorenz Oken

4 / 100

Category: Biology

Q48 Which statement is incorrect about Lock and Key Model?

A. Specific enzyme can transform only a specific substrate

B. Active site of an enzyme is a non-flexible structure

C. Active site does not change before during or even after the reaction

D. It explains the mechanism of every chemical reaction

5 / 100

Category: Biology

Q.45 Muscle fatigue is characterized by all except:

A. Accumulation of lactic acid

B. pH drops

C. Cross bridges are unable to detach

D. Increased ATP concentration

6 / 100

Category: Biology Ch 12 Class 11

A hormone called _______ controls the secretion of gastric juice.

NUMS 2018
Biology
Nutrition
Elimination Tool:

A) Gastrin

B) Secretin

C) Thyroxine

D) Iodothyronine

7 / 100

Category: Biology

The wings of the birds and forelegs of a horse are ______ structures.

NUMS Mock 3
Biology
Evolution

A) Analogous

B) Homologous

C) Vestigial

D) Evolutionary convergent

8 / 100

Category: Biology

Q47 The T-lymphocytes and B-lymphocytes are the major cells of the:

A. Thymus

B. Lymph nodes

C. Adrenal glands

D. Lymphatic vessels

9 / 100

Category: Biology Ch 13 Class 12

Water constitutes –% of body weight?

A. 25-30%

70-90%

10-30%

30-50%

10 / 100

Category: Biology Ch 5 Class 12

Apical meristems are located at

Tips of leaves

Tips of flowers

Tips of roots and stems

Tips of roots only

11 / 100

Category: Biology Ch 9 Class 11

Antherozoids the male gamete in bryophytes are attracted towards Archegonium i.e. female sex organ by

Phototactic phenomenon

Chemotactic phenomenon

. Geotropic phenomenon

Chemotropic movement

12 / 100

Category: Biology Ch 3 Class 12

The _____ may be a cell, neuron ending or an organ that receives the stimulus.

NUMS 2019 Reconduct
Biology
Coordination and Control
Elimination Tool:

A) Effector

B) Receptor

C) Adopter

D) Stimuli

13 / 100

Category: Biology Ch 13 Class 11

The voice box leads to the trachea which is also called

PMC Practice 1
Biology
Gaseous Exchange
Elimination Tool:

A) Bronchi

B) Bronchioles

C) Windpipe

D) Alveolar duct

14 / 100

Category: Biology Ch 12 Class 11

The disease night blindness is caused by deficiency of vitamin:

NTS 2016 SMBBMC
Biology
Nutrition
Elimination Tool:

A) A

B) B

C) C

D) D

15 / 100

Category: Biology Ch 7 Class 11

Which of the following statement is incorrect about algae?

Their zygote unlike plants is protected by parental tissue.

Their classification is based on pigment composition.

Most of them have different morphological forms in-different stages of their life cycle.

Almost all of them are aquatic.

16 / 100

Category: Biology

Q.56 During cyclic photophosphorylation, electrons are diverted back to:

A. Plastoquinone

B. Cytochrome complex

C. Plastocyanin

D. Ferredoxin

17 / 100

Category: Biology Ch 2 Class 12

Dermal and denticle scales of fishes are called:

NUMS 2015
Biology
Support and Movement
Elimination Tool:

A) Placoid scales

B) Ganoid scales

C) Ctenoid scales

D) Cycloid scales

18 / 100

Category: Biology Ch 3 Class 11

A/An _______ is mostly a non-protein chemical compound that is required for the protein’s biological activity.

NTS 2019
Biology
Enzymes
Elimination Tool:

A) Active site

B) Substrate

C) Cofactor

D) Enzyme

19 / 100

Category: Biology Ch 7 Class 12

Which statement is not true about phragmoplast?

Formed from vesicle originating from Golgi apparatus

Present in plants only

Formed at the end of anaphase

Centre of dividing cell

20 / 100

Category: Biology Ch 3 Class 12

Chemically auxins are

Indole propionic acid.

Indole carboxylic acid.

Indole acetaldehyde

Indole acetic acid

21 / 100

Category: Biology Ch 3 Class 12

Chlorosis, i.e., yellowish hue on the leaves results from

Accumulation of toxic waste products in leaves.

Deficiency of chlorophyll.

Short supplies of mineral nutrients in the soil

All of these

22 / 100

Category: Biology Ch 10 Class 11

Among invertebrates, which possesses the greatest power of regeneration?

NUMS 2015
Biology
Kingdom Animalia
Elimination Tool:

A) Sponges

B) Platyhelminthes

C) Annelids

D) Echinoderms

23 / 100

Category: Biology Ch 9 Class 11

What is the name of the structure of the leaf that attaches the leaf to the stem?

PMC Sample 2
Biology
Kingdom Plantae
Elimination Tool:

A) Phloem

B) Mesophyll

C) Xylem

D) Petiole

24 / 100

Category: Biology Ch 4 Class 11

What is the role of cholesterol in the cell membrane?

NUMS 2020
Biology
Cell Structure and Function
Elimination Tool:

A) it functions in joining adjacent cells together.

B) It functions in recognizing foreign cells.

C) It increases the rate of transport of ions across the membrane.

D) It stabilizes the cell membrane.

25 / 100

Category: Biology

When the concentration of the external medium is equal to the concentration of the internal medium of a cell, the situation is called:

NUMS Mock 1
Biology
Biological Molecules

A) Hypertonic

B) Hypotonic

C) Isotonic

D) Heterotonic

26 / 100

Category: Biology Ch 2 Class 12

Tendon is made up of:

NUMS 2014
Biology
Support and Movement
Elimination Tool:

A) Yellow fibrous connective tissue

B) Modified white fibrous tissue

C) Areolar tissue

D) Adipose tissue

27 / 100

Category: Biology Ch 12 Class 12

Zone of lake water which is of open water near the surface is

Littoral

Limnetic

Profundal

Benthic

28 / 100

Category: Biology Ch 13 Class 11

During breathing air from Pharynx enters to:

UHS 2018
Biology
Gaseous Exchange
Elimination Tool:

A) Trachea

B) Bronchioles

C) Alveoli

D) Bronchi

29 / 100

Category: Biology Ch 9 Class 11

The part of sporophyte which is called sporangium is

Capsule

Foot

Stalk

None of these

30 / 100

Category: Biology Ch 10 Class 11

Leptocardii is a group of:

NUMS 2015
Biology
Kingdom Animalia
Elimination Tool:

A) Urochordata

B) Cephalochordata

C) Vertebrata

D) Mollusca

31 / 100

Category: Biology Ch 3 Class 12

How many meninges cover the human brain?

NTS 2014
Biology
Coordination and Control
Elimination Tool:

A) 5

B) 4

C) 3

D) 2

32 / 100

Category: Biology Ch 4 Class 11

In cell fractionation various components of cells including its organelles can be isolated in different layers depending upon:

Their physical properties like size & weight.

Physical properties of the medium like its density.

Their electrical properties like their charges

Both a and b

33 / 100

Category: Biology

Q.2 The set of all genes in any population is termed as?

A. population pool

B. species pool

C. gene pool

D. all of these

34 / 100

Category: Biology Ch 10 Class 11

Of the following which one is non-cellular in most cases in animals?

Mesenchyme

Sclerenchyma

Chlorenchyma

Mesoderm

35 / 100

Category: Biology

Q.20 Cytochromes are electron transport intermediates containing?

A. myoglobin

B. heam

C. globulin

D. fibrin

36 / 100

Category: Biology Ch 2 Class 11

Ribose sugar that is the main part of RNA is a type of _____ sugar.

NUMS 2019 Reconduct
Biology
Biological Molecules
Elimination Tool:

A) Triose

B) Tetrose

C) Pentose

D) Hexose

37 / 100

Category: Biology

Q.39 If a cross section of a sarcomere is seen, each myosin is surrounded by how many actin molecules?

A.5

B.6

C.7

D. 8

38 / 100

Category: Biology Ch 11 Class 11

Which of the following processes does NOT need Pyruvic Acid as a substrate?

PMC 2020
Biology
Bioenergetics
Elimination Tool:

A) Alcoholic fermentation

B) Calvin cycle

C) Aerobic respiration

D) Lactic Acid fermentation

39 / 100

Category: Biology

DNA made by joining pieces from two or more different sources:

NUMS Mock 3
Biology
Biotechnology

A) Probes

B) Restriction endonuclease

C) Mutated DNA

D) Recombinant DNA

40 / 100

Category: Biology Ch 2 Class 11

Which of the following processes is the reverse of condensation?

NTS 2016 SMBBMC
Biology
Biological Molecules
Elimination Tool:

A) Hydrolysis

B) Dehydration synthesis

C) Polymerization

D) Vapourization

41 / 100

Category: Biology Ch 8 Class 11

In an ecosystem mycorrhizae are an example of:

UHS 2013
Biology
Kingdom Fungi
Elimination Tool:

A) Predation

B) Symbiosis

C) Mutualism

D) Parasitism

42 / 100

Category: Biology Ch 12 Class 11

Nitrogen

Magnesium

Iron

Both A and B

43 / 100

Category: Biology Ch 9 Class 12

Enzyme used by the Bacteria to cut the DNA of the invading Virus for its protection is:

UHS 2018
Biology
Biotechnology
Elimination Tool:

A) Restriction Exonuclease

B) Restriction Ligase

C) Restriction Endonuclease

D) DNA polymerase

44 / 100

Category: Biology Ch 6 Class 12

The genotype of a normal male in humans is ______ chromosomes.

NTS 2012
Biology
Chromosomes and DNA
Elimination Tool:

A) 44 + XX

B) 44 + XY

C) 44 + XXY

D) 44 + XO

45 / 100

Category: Biology Ch 5 Class 11

The viruses are:

NTS 2011
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Cellular

B) Prokaryotes

C) Non-cellular

D) Eukaryotes

46 / 100

Category: Biology

While working in a laboratory, before studying a sample under the microscope, it was immersed in a dye solution to obtain ______.

NUMS Mock 1
Biology
Biology and its Major Fields of Specialization

A) Magnification

B) Image

C) Match

D) Contrast

47 / 100

Category: Biology Ch 1 Class 12

Which of the following fish drink large amount of sea water and excrete concentrated urine resulting in maximum salt excretion and minimal water loss?

Hagfish

Fresh water fishes

Bony fishes

None of these

48 / 100

Category: Biology Ch 4 Class 11

A group of cells performing same function are known as:

NUMS 2016
Biology
Cell Structure and Function
Elimination Tool:

A) Organelles

B) Tissues

C) A system

D) Both A and B

49 / 100

Category: Biology Ch 3 Class 11

If more substrate to already occurring enzymatic reaction is added more enzyme activity is seen because:

There is probably more substrate present than there is enzyme.

There is probably more enzayme available than there is substrate.

There is probably more product present than there is either substrate or enzyme.

The enzyme substrate complex is probably failing to form during the reaction.

50 / 100

Category: Biology Ch 8 Class 12

Continuous variations in a population were first observed by:

NUMS 2015
Biology
Variation and Genetics
Elimination Tool:

A) Mendel

B) Correns

C) Nilsson

D) Darwin

51 / 100

Category: Biology Ch 10 Class 11

In some cases the blastomere can produce complete embryo the cleavage will be

Spiral and determinate

Radial and indeterminate

Spiral and indeterminate

Radial and determinate

52 / 100

Category: Biology

Q.20 Which of the following bacteria possesses a sphericatshape?

A. Bacillus anthracis

B. Escherichia coli

C. Spirillum minus

D. Staphylococeus aureus

53 / 100

Category: Biology Ch 9 Class 12

Natural extrachromosomal circular DNA molecules earrying genes for antibiotic resistance and fertility

Recombinant DNA

Chimaeric DNA C

Lambda phage

Plasmids

54 / 100

Category: Biology Ch 7 Class 11

In which of the following growth phases, the number of bacteria increases the most rapidly?

NTS 2018
Biology
Kingdom Protista
Elimination Tool:

A) Lag phase

B) Log phase

C) Stationary phase

D) Death / Decline phase

55 / 100

Category: Biology

Q.36 The retinal is important for___________ of human

A. Vision

B. Metabolism

C. Muscle contraction

D. Muscle twitch

56 / 100

Category: Biology Ch 5 Class 12

Thymus is found in the human body in _____.

PMC Practice 2
Biology
Growth and Development
Elimination Tool:

A) The medulla oblongata

B) The mediastinum of the upper thorax

C) Both Options A and B are correct

D) None of these options is correct

57 / 100

Category: Biology Ch 13 Class 11

Chest cavity is bounded by ribs and muscles on the sides, while the floor of chest cavity is called:

NUMS 2015
Biology
Gaseous Exchange
Elimination Tool:

A) Pleura

B) Alveoli

C) Chest cage

D) Diaphragm

58 / 100

Category: Biology Ch 4 Class 11

Strengthening material of prokaryotic cell wall is

Cellulose

Chitin

Inorganic salts silica waxes and ligin

Peptidoglycan or Murein.

59 / 100

Category: Biology Ch 1 Class 12

Most of the marine invertebrates are

Osmoconformers

Osmoregulators

Both depend upon the concentration of sea water

None of these

60 / 100

Category: Biology Ch 2 Class 11

The melting point of unsaturated fatty acids:

NUMS 2019 Reconduct
Biology
Biological Molecules
Elimination Tool:

A) Increases with increase in double bonds

B) Decreases with increase in double bonds

C) Rises in some and falls in others

D) There is no relationship between unsaturation and melting point

61 / 100

Category: Biology Ch 1 Class 12

Among the followings which is the most longest supportive cell?

Tracheids

Sclereids

Trachea

Collenchyma cells

62 / 100

Category: Biology

Q.19 Of the following, which one is not included in protostomes:

A. Arthropods

B. Poriferans

C. Annelids

D. Coelenterates

63 / 100

Category: Biology Ch 10 Class 11

Which one of the following animals possesses an open circulatory system:

NUMS 2014
Biology
Kingdom Animalia
Elimination Tool:

A) Amoeba

B) Earthworm

C) Grasshopper

D) Man

64 / 100

Category: Biology Ch 10 Class 11

In most triploblasts after embryonic development the three layers are represented as

Separate layers of cells

Structures formed from them

Structures associated with them

Their functions in body

65 / 100

Category: Biology Ch 4 Class 12

In which organism males are haploid

Aphids

Honey bee

Mosquito

Butterfly

66 / 100

Category: Biology Ch 12 Class 11

Carotenoids are related to:

NUMS 2015
Biology
Nutrition
Elimination Tool:

A) Vitamin A

B) Vitamin B

C) Vitamin C

D) Vitamin D

67 / 100

Category: Biology Ch 7 Class 11

Which of the following bacteria are able to release oxygen into the environment?

NTS 2018
Biology
Kingdom Protista
Elimination Tool:

A) Saprotrophic bacteria

B) Parasitic bacteria

C) Cyanobacteria

D) Pathogenic bacteria

68 / 100

Category: Biology Ch 6 Class 11

The cell membrane of a bacterial cell often invaginates to produce membranous structures referred to as:

NUMS 2017
Biology
Kingdom Prokaryote
Elimination Tool:

A) Centrosomes

B) Mesosomes

C) Dictyosomes

D) Polysomes

69 / 100

Category: Biology Ch 3 Class 11

Which type of bonds are never formed when a substrate fits into the active site of an enzyme?

PMC Practice 1
Biology
Enzymes
Elimination Tool:

A) Hydrogen bonds

B) Ionic interactions

C) Hydrophobic interactions

D) Covalent linkages

70 / 100

Category: Biology Ch 1 Class 12

In a marine environment, the ion secreted by the kidney is:

NUMS 2020
Biology
Homeostasis
Elimination Tool:

A) Na+

B) K+

C) Mg2+

D) Cl-

71 / 100

Category: Biology Ch 1 Class 12

Which of the following statement about Homeostasis is incorrect

There is a definite control system that regulates the homeostatic activities

Homeostatic mechanisms keep the internal environment fixed despite of wide changes in external environment

Because of this the fluctuations of internal environment are of extremely narrow range as compared to that of external environment

All are correct

72 / 100

Category: Biology Ch 7 Class 12

Chance of a cross over between two loci is directly proportional to their

UHS 2018
Biology
Cell Cycle
Elimination Tool:

A) Thickens

B) Width

C) Length

D) Distance

73 / 100

Category: Biology Ch 6 Class 12

Within the chromosomes, each chromatid contains ______ DNA molecule:

NUMS 2020
Biology
Chromosomes and DNA
Elimination Tool:

A) One

B) Two

C) Three

D) Half

74 / 100

Category: Biology Ch 3 Class 11

An activated enzyme consisting of polypeptide chain and a cofactor is called:

Apoenzyme

Holoenzyme

Activated enzyme

Both b and c

75 / 100

Category: Biology Ch 12 Class 11

Autotrophic organisms can exist in an exclusively ______ environment.

Organic

Inorganic

Wet

Terrestrial

76 / 100

Category: Biology

Germ layers are formed in which stage of development?

NUMS Mock 2
Biology
Growth and Development

A) Morulation

B) Blastulation

C) Gastrulation

D) Organogenesis

77 / 100

Category: Biology

The uterus of the female reproductive system opens into the _____.

NUMS Mock 4
Biology
Reproduction

A) Placenta

B) Birth canal

C) Cervix

D) All of these options are correct

78 / 100

Category: Biology

Four events in the transmission of nerve impulses across synapses are:

I. depolarisation of the presynaptic membrane

II. propagation of postsynaptic action potential

III. reabsorption of the transmitter substance

IV. release of transmitter substance into the synaptic cleft

In which sequence do these events occur?

FIRST -> LAST

NUMS Mock 3
Biology
Coordination and Control

A) I, III, II, and IV

B) I, IV, II and III

C) IV, I, III and II

D) IV, III, I and II

79 / 100

Category: Biology Ch 8 Class 12

In cats, the genes controlling coat-color are co-dominant (incompletely dominant) and are carried on the X chromosomes. When a black female was mated with a ginger male the resulting litter consisted of black male and tortoise-shell female kittens. What phenotypic ratio would be expected in the F2 generation?

NTS 2012
Biology
Variation and Genetics
Elimination Tool:

A) 1 black male : 1 ginger male : 2 tortoise – shell females

B) 1 black male : 1 ginger male : 1 tortoise – shell female : 1 black female

C) 2 black males : 1 tortoise – shell female : 1 ginger female

D) 1 black male : 1 tortoise – shell female : 1 ginger female : 1 black female

80 / 100

Category: Biology Ch 9 Class 12

Cloning is the production of genetically identical copies of organisms/cells by:

NUMS 2015
Biology
Biotechnology
Elimination Tool:

A) Sexual reproduction

B) Asexual reproduction

C) Both sexual and asexual

D) None of the given options

81 / 100

Category: Biology Ch 4 Class 12

A pollen tube serves to:

NTS 2015 SMBBMC
Biology
Reproduction
Elimination Tool:

A) Produce sperms

B) Store food for the developing embryo

C) Transfer sperms from the stigma to the ovary

D) Produce female gametophytes

82 / 100

Category: Biology Ch 11 Class 11

In the Calvin cycle, the reducing power from NADPH is used during:

NUMS 2019 Reconduct
Biology
Bioenergetics
Elimination Tool:

A) Formation of 1, 3- Bisphosphoglycerate

B) Conversion of 1, 3- Bisphosphoglycerate to Glyceraldehyde 3- phosphate

C) Formation of fructose 1, 6- bisphosphate from 1, 3- bisphosphoglycerate

D) Formation of glucose from fructose bisphosphate

83 / 100

Category: Biology Ch 6 Class 11

Cyanobacteria help in nitrogen fixation because they have:

PMC 2021 Tested
Biology
Kingdom Prokaryote
Elimination Tool:

A) Sodium channels

B) Heterocysts

C) Harmogonia

D) Nitrogenase

84 / 100

Category: Biology Ch 14 Class 11

All of the following protect the body against the entrance of germs except:

NTS 2017
Biology
Transport
Elimination Tool:

A) Tears

B) Mucous membranes

C) Ciliated cells

E) Red blood cells,

85 / 100

Category: Biology Ch 6 Class 11

Rod-shaped bacteria are known as:

NUMS 2017
Biology
Kingdom Prokaryote
Elimination Tool:

A) Cocci

B) Bacilli

C) Spirilla

D) None of these

86 / 100

Category: Biology Ch 2 Class 12

The significant flight muscle in birds is the:

NUMS 2014
Biology
Support and Movement
Elimination Tool:

A) Pectoral

B) Tensor

C) Appendicular

D) All of these

87 / 100

Category: Biology Ch 2 Class 12

Type of sclerenchyma cells found in seed coats are:

NUMS 2015
Biology
Support and Movement
Elimination Tool:

A) Fibers

B) Tracheids

C) Sclereids

D) Vessels

88 / 100

Category: Biology Ch 14 Class 11

Which of the following is NOT a part of the immune system?

NTS 2018
Biology
Transport
Elimination Tool:

A) Phagocytes

B) Complement Proteins

C) Cytokines

D) Atherosclerosis

89 / 100

Category: Biology Ch 4 Class 11

The second most abundant bio element in the human body is:

NUMS 2020
Biology
Cell Structure and Function
Elimination Tool:

A) Oxygen

B) Carbon

C) Hydrogen

D) Nitrogen

90 / 100

Category: Biology Ch 13 Class 11

Thick, waxy & leathery cuticle around leaves is present in which of the following?

PMC Sample 2
Biology
Gaseous Exchange
Elimination Tool:

A) Hydrophytes

C) Halophytes

B) Mesophytes

D) Xerophytes

91 / 100

Category: Biology Ch 2 Class 12

The movement of plants in response to touch stimulus is called:

NTS 2012
Biology
Support and Movement
Elimination Tool:

A) Hydrotropism

B) Chemotropism

C) Geotropism

D) Thigmotropism

92 / 100

Category: Biology

Q.22 Pick the one which releases anticoagulant in human intestine to prevent clotting:

A. Ascaris lumbricoides

B. Ancylostoma duodenale

C. Enterobius vermicularis

D. Hirudo medicinalis

93 / 100

Category: Biology Ch 12 Class 11

Deficiency of K+ causes:

Stunted growth & strong chlorosis

No electron transport chains

Premature death of leaves.

Stunted growth of roots.

94 / 100

Category: Biology

In the human cell, ______ is responsible for producing hydrogen peroxide.

NUMS Mock 2
Biology
Cell Structure and Function

A) Lysosomes

B) Mitochondria

C) Peroxisomes

D) Glyoxysomes

95 / 100

Category: Biology Ch 4 Class 11

The most abundant organic compounds in a mammalian cell are:

NUMS 2020
Biology
Cell Structure and Function
Elimination Tool:

A) Water

B) Lipids

C) Carbohydrates

D) Proteins

96 / 100

Category: Biology

Q.10 Which of the following bond is more resistant to temperature when protein gets denatured?

Peptide Bond

B. Disulphide bond

Ionic Interactions

D. Hydrophobic interactions

97 / 100

Category: Biology

Q.29 Fluid secreted by Sertoli cells provides sperms with which of the following ?

A. Liquid medium

B. Protection

C. Nourishment

D. All of these

98 / 100

Category: Biology Ch 8 Class 11

The Fungal Cell wall contains:

NUMS 2018
Biology
Kingdom Fungi
Elimination Tool:

A) Peptidoglycan

B) Chitin

C) Suberin

D) Cutin

99 / 100

Category: Biology

The gene which controls the ABO group has how many alleles in an individual?

NUMS Mock 3
Biology
Variation and Genetics

A) 1.

B) 2.

C) 3.

D) 4.

100 / 100

Category: Biology

The function of respiratory passage, Cilia is to keep the airways clear of:

NUMS Mock 4
Biology
Gaseous Exchange

A) Carbon dioxide

B) Oxygen

C) Dust

D) Carbon Monoxide

Your score is

The average score is 57%

0%

PLS Academy – LearnoSpot

PLS Boost Bundle