Biology Practice Test 1

Biology Practice Test 1 is designed to help students strengthen their understanding of key biological concepts, theories, and processes for competitive entry tests like MDCAT, NUMS, AKU, UET, ECAT, NTS, as well as FSC Board Exams. This test covers topics from cell biology, genetics, physiology, ecology, evolution, and more, helping students improve accuracy and retention.

PLS Academy

Get Access to 20 thousands+ MCQs Including Topical MCQs, Practice Tests, Mock Tests, Solved Past Papers, Flashcards, Notes, FLPS, and Much More.

UNLOCK PREMIUM🔐

8080

Created by Ali Durrani

MDCAT Practice Tests

Biology Practice Test 1

This is the Free Access to Limited MCQs. Enroll to PLS Boost Premium Bundle to Get More MCQs HERE

1 / 100

Category: Biology Ch 5 Class 12

Higher plants grow through

Growing points

Whole plant body is capable of growing

Only roots grow

None of these

2 / 100

Category: Biology Ch 6 Class 11

The DNA of the bacterium is present in a distinct region called:

NUMS 2017
Biology
Kingdom Prokaryote
Elimination Tool:

A) Nucleolus

B) Centrosome

C) Nucleoid

D) Nucleus

3 / 100

Category: Biology Ch 6 Class 12

Locus is defined as:

NUMS 2019 Reconduct
Biology
Chromosomes and DNA
Elimination Tool:

A) Position of a gene on the chromosome

B) Appearance of a trait in an individual

C) Partner of a gene pair

D) Gene in an individual for a trait

4 / 100

Category: Biology Ch 7 Class 12

Synaptonemal complex helps in:

NUMS 2014
Biology
Cell Cycle
Elimination Tool:

Bac

A) Gamete formation

B) Recombination during cell division

C) Production of enzymes during cell division

D) Chromosomal movement towards pole

5 / 100

Category: Biology Ch 9 Class 11

Which one of the following types of cell are found in secondary xylem of angiosperms?

NTS 2015 DUHS and JSMU
Biology
Kingdom Plantae
Elimination Tool:

A) Tracheids parenchyma fibres collenchyma but no vessels

B) Vessels tracheids parenchyma collenchyma but no fibres

C) Vessels tracheids fibres collenchyma but no parenchyma

D) Vessels tracheids fibres parenchyma but no collenchyma

6 / 100

Category: Biology

Q.49 In reproduction, semen refers to which of the following?

A. fluid and sperms

B. Blood and water

C. Blood and sperms

D. Blood and fluid

7 / 100

Category: Biology Ch 9 Class 12

Chimaeric DNA is also known as

Recombinant DNA

Complementary DNA

Vector

Plasmid

8 / 100

Category: Biology

Q.25 The substrate of the trypsin is:

A. Proteins

B. Dipeptides

C. Polypeptides

D. Amino acids

9 / 100

Category: Biology Ch 13 Class 11

The blood enters the _____ side of heart

Posterior

Lateral

All possibl

10 / 100

Category: Biology Ch 5 Class 12

Apical meristems are located at

Tips of leaves

Tips of flowers

Tips of roots and stems

Tips of roots only

11 / 100

Category: Biology

Which of the following blood transfusions can be made safely?

NUMS Mock 2
Biology
Variation and Genetics

A) Group A to group B

B) Group B to group AB

C) Group AB to group O

D) Group A to group O

12 / 100

Category: Biology

The hormone which controls the uptake of Sodium ions in kidney and its maintenance in blood plasma is:

NUMS Mock 2
Biology
Coordination and Control

A) Somatotrophic Hormone

B) Aldosterone Hormone

C) Gonadotrophic Hormone

D) Thyroxine Hormone

13 / 100

Category: Biology

Q4 The branch that deals with the study of viruses fs known as?

A.. Entomology

B. Bacteriology

Virology

D. Epidemiology

14 / 100

Category: Biology Ch 9 Class 11

Which characteristic led to the evolution of seed?

NUMS 2020
Biology
Kingdom Plantae
Elimination Tool:

A) Heterogamous condition

B) Development of heterospory

C) Embryo formation

D) Protection of reproductive cells

15 / 100

Category: Biology

5 different amino acids, numbered 1, 2, 3, 4, and 5, below from the following sequence in the path of a polypeptide chain:

1-2-3-4-2-5-3

Messenger RNA codon, which correspond to the amino acids, are:
amino acid 1 UGU

amino acid 2 GAU

amino acid 3 CAC

amino acid 4 UAG

amino acid 5 AAG

Which one of the following DNA bases sequences could provide the code for the given section of the polypeptide?

NUMS Mock 2
Biology
Biological Molecules

A) ACACTTGTGATGCTATTCGTG

B) ACACUAGUGAUGCUAUUCGUG

C) ACACTAGTGATGCTAAACGTG

D) ACACTAGTGATCCTATTCGTG

16 / 100

Category: Biology Ch 9 Class 12

Which one of the following options is NOT an example of genetic engineering?

NTS 2019
Biology
Biotechnology
Elimination Tool:

A) Insulin-producing bacteria

B) Oil eating bacteria

C) Photosynthetic bacteria

D) Metal extracting bacteria

17 / 100

Category: Biology Ch 8 Class 12

Filial is a Latin word. It means

Spring

Issue

Progeny

Descendent

18 / 100

Category: Biology Ch 1 Class 11

A structure formed by groups of similar cells organized into loose sheetsor bundles performing similar functions is called as:

An organ

An organism

A Tissue

A Cell

19 / 100

Category: Biology Ch 4 Class 11

During digesting the phagocytosed food particles vesicles formed from fusion of phagocytic vacuole with the enzymes secreted by Golgi apparantus are called

Lysosomes

Primary lysosomes

Secondary lysosomes

Food vacuole

20 / 100

Category: Biology

Q.51 The water splitting step of photosynthesis is called?

A Hydrolysis

B. Chemiosmosis

C. Photolysis

D. Photosynthesis

21 / 100

Category: Biology Ch 9 Class 12

The deficiency of which of the following cause severe combined immunodeficiency

PMC Sample 3
Biology
Biotechnology
Elimination Tool:

A) hypoxanthine-guanine transferase

B) xanthine oxidase

C) PRPP synthatase

D) adeninosine deaminase

22 / 100

Category: Biology Ch 2 Class 12

When a physician elicits the knee-jerk reflex by tapping deep tendons in the knee, the normal response is for the lower leg to swing forward. When this happens:

NTS 2013
Biology
Support and Movement
Elimination Tool:

A) Muscles in the front of the thigh are contracting and muscles in the back of the thigh are relaxing

B) Muscles in the front of the lower leg are contracting and muscles in the back of the lower leg are relaxing

C) Muscles in the back of the thigh are contracting and muscles in the front of the thigh are relaxing

D) Muscles in the back of the lower leg are contracting and muscles in the front of the lower leg are relaxing

23 / 100

Category: Biology Ch 13 Class 11

In which of the following are book lungs found?

NUMS 2014
Biology
Gaseous Exchange
Elimination Tool:

A) Clam warm

B) Spider

C) Silverfish

D) Leech

24 / 100

Category: Biology Ch 9 Class 11

Red algae do not contribute towards:

PMC 2020
Biology
Kingdom Plantae
Elimination Tool:

A) Making coral reefs

B) Forming limestone deposits

C) Making fertilizers

D) Forming chalk deposits

25 / 100

Category: Biology

Q.57 Electron transport chain pumps protons across the membrane from __________ to ____________.

A. Thylakoid space, stroma

B. Inter-membrane space, stroma

C. Stroma, inter-membrane space

D. Stroma, thylakoid space

26 / 100

Category: Biology Ch 6 Class 11

The first bacterium isolated was

Coccus

Bacillus

Vibrio

Spirochete

27 / 100

Category: Biology Ch 12 Class 11

Undigested food in cockroach is stored in:

NUMS 2015
Biology
Nutrition
Elimination Tool:

A) Crop

B) Rectum

C) Gizzard

D) Crop & Rectum

28 / 100

Category: Biology

At what point are two populations descending from the same ancestral stock considered separate species?

NUMS Mock 4
Biology
Evolution

A) When they can no longer produce viable, fertile offspring

B) When they look significantly different from each other

C) When they can interbreed successfully and produce offspring

D) When their habitats are separated by a significantly large distance so that they cannot meet

29 / 100

Category: Biology Ch 13 Class 12

Driving force for all the cycles in ecosystem is

Water

Soil

Sun

Air

30 / 100

Category: Biology Ch 5 Class 11

Those organisms which can prepare their own food from simple inorganic material and can store energy are called

Autotrophs

Heterotrophs

Procariotique

Eu-cariotique

31 / 100

Category: Biology Ch 5 Class 12

Meristems are group of cells that

Allow the surrounding region to divide

Provide nutrition

. Help in movement

Retain the potential to divide

32 / 100

Category: Biology

Q.38 Which of the following best describes a coenzyme?

A. Covalently bonded non-protein part of an enzyme

B. Cofactor consists of metal ions

C. Loosely bonded non-protein part of an enzyme

D. Both A and B

33 / 100

Category: Biology Ch 10 Class 12

Carolus Linnaeus was believer of which of the following?

PMC Sample 1
Biology
Evolution
Elimination Tool:

A) special creation

B) natural selection

C) catastrophism

D) Inheritance of acquired characters

34 / 100

Category: Biology

Q.39 If a cross section of a sarcomere is seen, each myosin is surrounded by how many actin molecules?

A.5

B.6

C.7

D. 8

35 / 100

Category: Biology Ch 7 Class 12

In meiosis II, ______ differentiate into sperms.

NUMS 2019 Reconduct
Biology
Cell Cycle
Elimination Tool:

A) Spermatocytes

B) Spermatids

C) Sertoli cells

D) Polar bodies

36 / 100

Category: Biology Ch 3 Class 11

Non-protein but inorganic, detachable co-factors are called ______:

NUMS 2020
Biology
Enzymes
Elimination Tool:

A) Activators

B) Prosthetic groups

C) Coenzymes

D) Apo-enzymes

37 / 100

Category: Biology Ch 3 Class 11

Lock and Key Model for enzyme action propose by Emil Fischer suggests that:

PMC 2020
Biology
Enzymes
Elimination Tool:

A) Enzymes are unbiased for the substrate

B) Enzymes can modify their active sites

C) Enzymes are restricted to one reaction type

D) An enzyme can catalyze variety of reactions

38 / 100

Category: Biology Ch 4 Class 12

Only one ovary is functional at a time in:

NUMS 2015
Biology
Reproduction
Elimination Tool:

A) Human

B) Eagle

C) Chicken

D) Pigeon and human

39 / 100

Category: Biology

Q.1 At which times there is no net gaseous exchange between leaves and the atmosphere?

A. Day

B. Night

C. Dawn and Dusk

D. Midnight

40 / 100

Category: Biology Ch 11 Class 11

In the Calvin cycle, the reducing power from NADPH is used during:

NUMS 2019 Reconduct
Biology
Bioenergetics
Elimination Tool:

A) Formation of 1, 3- Bisphosphoglycerate

B) Conversion of 1, 3- Bisphosphoglycerate to Glyceraldehyde 3- phosphate

C) Formation of fructose 1, 6- bisphosphate from 1, 3- bisphosphoglycerate

D) Formation of glucose from fructose bisphosphate

41 / 100

Category: Biology

Consider the following statements regarding blood pressure:

1. It is the pressure exerted by the blood on the walls of any vessel.

2. It decreases in the arteries as the distance from the heart increases.

3. It is lower in the capillaries than in the arteries.

4. It is usually lower in women than in men.

Choose the correct statements.

NUMS Mock 3
Biology
Transport

A) 1, 2 and 3 are correct.

B) 2, 3 and 4 are correct.

C) 1 and 4 are correct.

D) 1, 2, 3 and 4 are correct.

42 / 100

Category: Biology Ch 8 Class 11

The most common example of members of the kingdom fungi is/are:

NUMS 2015
Biology
Kingdom Fungi
Elimination Tool:

A) Star fish

B) Mushrooms

C) Algae

D) Human

43 / 100

Category: Biology Ch 9 Class 12

Golden rice is a promising transgenic crop. When released for cultivation, it will help in

PMC Practice 11
Biology
Biotechnology
Elimination Tool:

A) Producing a petrollike fuel from rice

B) Alleviation of vitamin A deficiency

C) Pest resistance

D) Herbicide tolerance

44 / 100

Category: Biology Ch 8 Class 11

Those fungi which can grow only on their living host and cannot be grown on available defined growth culture medium e.g. various mildews and most rust species are called?

PMC Sample 2
Biology
Kingdom Fungi
Elimination Tool:

A) Parasitic fungi

B) Facultative parasitic fungi

C) Obligate parasitic fungi

D) all of these

45 / 100

Category: Biology

The diagram represents two liquids, separated by a membrane through which osmosis can occur.

What movement of molecules will occur?

NUMS Mock 3
Biology
Transport

A) Molecules of dissolved substance move from left to right.

B) Molecules of dissolved substance move from right to left.

C) Overall, water molecules move from left to right.

D) Overall, water molecules move from right to left.

46 / 100

Category: Biology Ch 11 Class 11

Which part of the cell does glycolysis occur in?

NTS 2018
Biology
Bioenergetics
Elimination Tool:

A) Mitochondrion

B) Chloroplast

C) Cytoplasm

D) Nucleus

47 / 100

Category: Biology Ch 6 Class 12

Which statement correctly describes the transcription of DNA?

PMC 2020
Biology
Chromosomes and DNA
Elimination Tool:

A) It produces amino acids

B) It produces messenger RNA

C) It results in increased DNA synthesis

D) It is a semi conservative process

48 / 100

Category: Biology Ch 11 Class 12

Mosses are

Dermatocarpon

Permellia

Tortula

Both b and c

49 / 100

Category: Biology Ch 3 Class 11

The rate of reaction is directly proportional to the concentration of an enzyme which statement is incorrect in this respect:

Increase in enzyme molecule increases the available active sites.

This relation is for unlimited time period with unlimited enzyme concentration

If the concentration is doubled the rate will become two fold.

None of these.

50 / 100

Category: Biology Ch 11 Class 11

Immediate source of energy for cellular respiration is:

NUMS 2016
Biology
Bioenergetics
Elimination Tool:

A) Lipids

B) ATP

C) Proteins

D) Carbohydrates

51 / 100

Category: Biology

Q.65 Which of the following statements about the systemic affect of bacterial cells are true?

A. Gram-negative bacteria are more likely to cause systemic effects because their lack of an outer membrane means they can more quickly infect host cells.

B. Gram-negative bacteria are more likely to cause Systemic effects because the outer membrane protects them from antibiotics

C. Both A and B

D. None of these

52 / 100

Category: Biology Ch 12 Class 11

The structure which prevents the entry of food particles into the respiratory passage is:

NUMS 2019 Cancelled
Biology
Nutrition
Elimination Tool:

A) Hard palate

B) Epiglottis

C) Soft palate

D) Larynx

53 / 100

Category: Biology Ch 10 Class 11

Despite the structural diversities, ____ are characterized by having a soft body protected by a calcareous shell developing from the mantle layer.

NUMS 2014
Biology
Kingdom Animalia
Elimination Tool:

A) Corals

B) Foraminiferos

C) Molluscs

D) None of these

54 / 100

Category: Biology Ch 6 Class 12

In semi-conservative replication

. Sequence of original duplex is conserved after one round of replication

Gererate DNA copies of entirely new molecules

Parental DNA become completely dispersed

Each strand of daughter molecules will be a mixture of old and new

55 / 100

Category: Biology Ch 11 Class 11

C6H12O6 + 6O2 ? 6CO2 + 6H20 + ENERGY represents:

Photosynthesis

Aerobic respiration

Anaerobic respiration

Respiration

56 / 100

Category: Biology Ch 6 Class 11

E. coli and example of entrobacteriace is important for causing diarrheal diseases its size is:

0.1-600 um

100-200 nm

1.1-1.5 um (width) 2.0-6.0 um (length)

0.75-1.25 um

57 / 100

Category: Biology Ch 9 Class 11

“Vascular System absent; gametophyte dominant, sporophyte attached to gametophyte; homosporous” are distinguishing characters of

UHS 2010
Biology
Kingdom Plantae
Elimination Tool:

A) Psilopsida

B) Pteropsida

C) Angiosperms

D) Bryophyta

58 / 100

Category: Biology Ch 14 Class 11

The valve between right atrium and right ventricle is called:

NUMS 2014
Biology
Transport
Elimination Tool:

A) Bicuspid valve

B) Tricuspid valve

C) Pulmonary valve

D) Semi lunar valve

59 / 100

Category: Biology

The structure of an enzyme is altered by which of the following inhibitors?

NUMS Mock 3
Biology
Enzymes

A) Reversible inhibitor.

B) Competitive inhibitor.

C) Non-competitive inhibitor.

D) Irreversible inhibitor.

60 / 100

Category: Biology Ch 12 Class 11

Chlorosis refers to the lack of:

NUMS 2016
Biology
Nutrition
Elimination Tool:

A) Growth

B) Chlorophyll

C) Yellowing of leaf margin

D) Width of leaf

61 / 100

Category: Biology Ch 2 Class 12

Endoskeleton is secreted by:

Ectoderm

Endoderm

Mesoderm

All of these

62 / 100

Category: Biology

Q.10 Mating between relatives is called which of the following?

A. Ex breeding

B. Breeding

C. Inbreeding

D. Outbreeding

63 / 100

Category: Biology

The branch of science dealing with the fossil record is called:

NUMS Mock 2
Biology
Biology and its Major Fields of Specialization

A) Genetics

B) Taxonomy

C) Archeology

D) Palentology

64 / 100

Category: Biology

Q.56 During cyclic photophosphorylation, electrons are diverted back to:

A. Plastoquinone

B. Cytochrome complex

C. Plastocyanin

D. Ferredoxin

65 / 100

Category: Biology

Q.51 The heavy and light chains of an antibody molecule is held together by:

A. H-bonds

B. Disulphide bridges

C. Ionic interactions

D. Hydrophobic interactions

66 / 100

Category: Biology Ch 8 Class 12

What is the risk of color blind baby boy in a family when mother is color blind but father is normal?

NUMS 2019 Cancelled
Biology
Variation and Genetics
Elimination Tool:

A) 25%

B) 50%

C) 75%

D) 100%

67 / 100

Category: Biology Ch 3 Class 12

_________ is sometimes given by injection as an emergency treatment in cardiac arrest:

NUMS 2020
Biology
Coordination and Control
Elimination Tool:

A) Acetylcholine

B) Dopamine

C) Serotonin

D) Epinephrine

68 / 100

Category: Biology Ch 10 Class 11

Which vertebrate groups have scaly skin?

NTS 2013
Biology
Kingdom Animalia
Elimination Tool:

A) amphibians and fish

B) amphibians and mammals

C) fish and mammals

D) fish and reptiles

69 / 100

Category: Biology

Q.36 Parkinson’s disease is caused by cell death, which produces ____________.

A. Acetylcholine

B. Serotonin

C. Dopamine

D. Adrenaline

70 / 100

Category: Biology Ch 5 Class 11

Five kingdom classification was proposed by :

Carlous Linnaeus

E-Chatton

Robert Whittaker

Lynn Margulis and Karlene Schwartz

71 / 100

Category: Biology Ch 5 Class 12

Intercalary meristems are of

Permanent nature

Temporary nature

Some are permanent some temporary

None of these

72 / 100

Category: Biology Ch 4 Class 12

What is critical in photoperiodism?

Length of light period

Length of dark period

Both a and b

None of these

73 / 100

Category: Biology Ch 11 Class 11

During the first three steps of glycolysis, glucose is converted to Fructose 1, 6-diphosphate by the rearrangement of the molecule and addition of two phosphate groups. The phosphate comes from?

NTS 2015 SMBBMC
Biology
Bioenergetics
Elimination Tool:

A) Phospholipids of the membrane

B) ADP

C) inorganic phosphates

D) ATP

74 / 100

Category: Biology Ch 5 Class 12

Vegetative roots and shoots grow by

Determinate growth

Primary growth only

Indeterminate growth

None of these

75 / 100

Category: Biology Ch 13 Class 12

Balance in the nutrient cycle can be upset when

Too much food is consumed

Not enough food is produced

Decayed nutrients are not returned to the ground

All of these

76 / 100

Category: Biology Ch 12 Class 11

Amylase is not produced by the following type(s) of salivary gland:

NUMS 2015
Biology
Nutrition
Elimination Tool:

A) Parotid

B) Submandibular

C) Sublingual

D) None of the given options are correct

77 / 100

Category: Biology Ch 3 Class 11

An activated enzyme consisting of polypeptide chain and a cofactor is called:

Apoenzyme

Holoenzyme

Activated enzyme

Both b and c

78 / 100

Category: Biology

Egg-Laying mammals are called:

NUMS Mock 3
Biology
Reproduction

B) Protozoa

C) Chordata

D) Monotremes

E) Both A and D

79 / 100

Category: Biology Ch 13 Class 11

Oxygen contents per liter of air is

10 ml

100 ml

200 ml

100ml

80 / 100

Category: Biology Ch 6 Class 11

A bacterial cell envelope of mollicutes does not include?

PMC Sample 1
Biology
Kingdom Prokaryote
Elimination Tool:

A) Slime

B) Capsule

C) Cell wall

D) Cell membrane

81 / 100

Category: Biology Ch 8 Class 11

Fungi do not contain:

NTS 2010
Biology
Kingdom Fungi
Elimination Tool:

A) Cell wall

C) Chlorophyll

B) Hyphae

D) Mycelium

82 / 100

Category: Biology Ch 8 Class 12

Read the passage below to answer the question:

Hemophilia is a disorder in which blood fails to clot. Saad, a male hemophiliac, marries Sara, a normal woman and together they have four children, two boys (Ahmed and Ali) and two girls (Alia and Ayesha). None of the children display the symptoms of Hemophilia. Ahmed, Ali, Ayesha, and Ali all marry normal individuals and have children. None of Ahmeds or Ali’s children, male or female, display symptoms of hemophilia, but the sons of Alia and Ayesha display symptoms of hemophilia while the daughters of Alia and Ayesha do not.

If one of Ali’s daughters marries a normal man,what is the probability that one of their children will display symptoms of hemophilia:

NTS 2010
Biology
Variation and Genetics
Elimination Tool:

A) 0%

B) 25%

C) 50%

D) 75%

83 / 100

Category: Biology

Which one of the following is common to all neurons?

NUMS Mock 3
Biology
Coordination and Control

A) A cell body which contains a nucleus

B) A thick myelin sheath

C) Presence of node of Ranvier

D) Presence of Schwann cells

84 / 100

Category: Biology Ch 10 Class 12

Analogous organs show:

NUMS 2020
Biology
Evolution
Elimination Tool:

A) Straight evolution

B) Convergent evolution

C) Zig-zag evolution

D) Divergent evolution

85 / 100

Category: Biology Ch 7 Class 12

During which stage of meiosis do centromeres divide?

NTS 2016 DUHS & JSMU
Biology
Cell Cycle
Elimination Tool:

A) Prophase I

B) Metaphase I

C) Prophase II

D) Metaphase II

86 / 100

Category: Biology Ch 12 Class 11

Milk drinking babies have an additional enzyme called:

NUMS 2016
Biology
Nutrition
Elimination Tool:

A) Rennin

B) Amylase

C) Lipase

D) None of these options are correct

87 / 100

Category: Biology Ch 1 Class 12

Negative feedback mechanism is the characteristic of which class?

NUMS 2020
Biology
Homeostasis
Elimination Tool:

A) Class Fish

B) Class Amphibia

C) Class Reptilia

D) Class Mammalia

88 / 100

Category: Biology

Golgi complex is responsible for the formation of secretory granules in _____ cell.

NUMS Mock 4
Biology
Cell Structure and Function

A) Stomach

B) Liver

C) Pancreatic

D) Muscle

89 / 100

Category: Biology Ch 11 Class 11

Molecular formula of chlorophyll ‘a’ molecule is:

C55H72O5N4Mg

C55H70O6N4Mg

C50H72O6N4Mg

C55H70O5N4Mg

90 / 100

Category: Biology Ch 10 Class 12

A group of interbreeding individuals belonging to a particular species and sharing a common geopraphic area is called?

PMC Sample 1
Biology
Evolution
Elimination Tool:

A) community

B) family

C) race

D) population

91 / 100

Category: Biology Ch 4 Class 11

_______ organelles are involved in the synthesis of the plant cell wall.

NUMS 2020
Biology
Cell Structure and Function
Elimination Tool:

A) Endoplasmic reticulum

B) Golgi complex

C) Lysosomes

D) Peroxisomes

92 / 100

Category: Biology Ch 7 Class 12

Meiosis occurs at the time of

Gamete formation in animals

Spore formattion in plants

Growth in animals

Both a and b

93 / 100

Category: Biology Ch 14 Class 11

The function of papillary muscles is to:

NUMS 2020
Biology
Transport
Elimination Tool:

A) Move blood from semilunar valve into pulmonary vein

B) Prevent the backward flow of blood from the ventricle

C) Push the blood from right atrium to left atrium

D) Push the blood from left atrium to aorta

94 / 100

Category: Biology Ch 7 Class 11

Most of the photosynthesis on earth is carried by

Kelps

Gymnosperms

Angiosperms

Algae

95 / 100

Category: Biology Ch 12 Class 12

In which zone plant community is most diverse

Limnetic zone

Littoral zon

Profundal zone

All of these

96 / 100

Category: Biology

Q.62 Which of the following is not a sterilization method for the control of bacteria?

A. Radiation

B. Filtration

C. High temperature

D. Antiseptics

97 / 100

Category: Biology Ch 9 Class 11

Sporophyte is

Monoploid

Haploid

Diploid

Polyploidy

98 / 100

Category: Biology Ch 10 Class 11

In some cases the blastomere can produce complete embryo the cleavage will be

Spiral and determinate

Radial and indeterminate

Spiral and indeterminate

Radial and determinate

99 / 100

Category: Biology Ch 8 Class 12

Which of the following condition is hybrid A. TT B. Tt C. tt D. All of these

All of these

100 / 100

Category: Biology Ch 1 Class 11

Which one is a micromolecule?

Polysaccharide

Protein

Hemoglobin

ATP

Your score is

The average score is 52%

Structured Practice for Best Entry Test Preparation

This topic-wise and chapter-wise practice test allows students to focus on individual biology concepts, including diagrams, processes, and conceptual questions. Regular practice enhances understanding, sharpens problem-solving skills, and builds confidence to tackle both board and competitive exam questions efficiently.

Free Resources for Best Entry Test Preparation

Students can access free Biology Practice Test 1 to systematically improve knowledge, recall, and problem-solving abilities. This test is suitable for FSC Board Exams as well as major entry tests, helping students perform better in the biology section. PLS Academy provides these resources to support students in their preparation.

JazakAllah

Comments

3 responses to “Biology Practice Test 1”

Anonymous

September 30, 2022

Hello sr thanks for your service
But there are some MCQ Wich are out of the PMC slabus in this test
But the test was very useful to me thanks
wajiha

October 5, 2022

Q:27 problem
Anonymous

October 13, 2022

AOA sir
Here in the test there are many mcqs that are not included in Nums r Pmc syllabus
Kindly check it out
Thanks
But it’s very helpful
Thanks