Biology Practice Test 1

Biology Practice Test 1 is designed to help students strengthen their understanding of key biological concepts, theories, and processes for competitive entry tests like MDCAT, NUMS, AKU, UET, ECAT, NTS, as well as FSC Board Exams. This test covers topics from cell biology, genetics, physiology, ecology, evolution, and more, helping students improve accuracy and retention.

PLS Academy

Get Access to 20 thousands+ MCQs Including Topical MCQs, Practice Tests, Mock Tests, Solved Past Papers, Flashcards, Notes, FLPS, and Much More.

UNLOCK PREMIUM🔐

8113

Created by Ali Durrani

MDCAT Practice Tests

Biology Practice Test 1

This is the Free Access to Limited MCQs. Enroll to PLS Boost Premium Bundle to Get More MCQs HERE

1 / 100

Category: Biology Ch 6 Class 12

Which of the following is NOT the part of RNA?

NTS 2018
Biology
Chromosomes and DNA
Elimination Tool:

A) Nitrogenous bases

B) Ribose Sugars

C) Deoxyribose Sugars

D) Phosphate groups

2 / 100

Category: Biology Ch 1 Class 12

Purine and pyrimidine catabolism results in production of

Creatinine

Trimethyamine oxide

Xanthine

None of these

3 / 100

Category: Biology Ch 6 Class 11

Select a method which causes the oxidation of chemical constituent of a bacterial cell:

PMC 2020
Biology
Kingdom Prokaryote
Elimination Tool:

A) Steam

B) Dry heat

C) Filtration

D) Radiation

4 / 100

Category: Biology

Which of the following animals can survive without drinking water?

NUMS Mock 4
Biology
Nutrition

A) Kangaroo rat

B) Pig

C) Kangaroo

D) Camel

5 / 100

Category: Biology

Q.39 The fertilization of ovum takes place at:

A. Distal part of the oviduct

B. Proximal part of the oviduct

C. Middle part of the oviduct

D. Anywhere in the oviduct

6 / 100

Category: Biology Ch 6 Class 11

Which of the following organelles are present in all the bacteria?

NTS 2014
Biology
Kingdom Prokaryote
Elimination Tool:

A) Mesosome

B) Golgi bodies

C) Mitochondria

D) Chloroplast

7 / 100

Category: Biology Ch 1 Class 11

In animals coordination is achieved by means of

Respiratory system

Nervous system

Endocrine system

Both b and c

8 / 100

Category: Biology Ch 2 Class 11

A complex substance which on hydrolysis yields polyhydroxy aldehyde or ketone subunits is called:

Lipid

Carbohydrate

Protein

Carotein

9 / 100

Category: Biology Ch 2 Class 12

Pectoral fins are enlarged in:

NUMS 2015
Biology
Support and Movement
Elimination Tool:

A) Whales

B) Sharks

C) Skates

D) Plaice

10 / 100

Category: Biology Ch 12 Class 11

Plants absorb it in the form of soluble phosphates. It is present abundantly in the growing and storage organs of plants. What is it?

NTS 2012
Biology
Nutrition
Elimination Tool:

A) H2O

B) CO2

C) K

D) P

11 / 100

Category: Biology Ch 7 Class 12

Meiosis occurs at the time of

Gamete formation in animals

Spore formattion in plants

Growth in animals

Both a and b

12 / 100

Category: Biology Ch 6 Class 12

What will be the approximate length of a DNA strand having 500 nucleotides?

NUMS 2015
Biology
Chromosomes and DNA
Elimination Tool:

HIDE ELIMINATED OPTIONS

A) 100 nm

B) 130 nm

C) 170 nm

D) 150 nm

13 / 100

Category: Biology Ch 9 Class 11

The most successful land adapting plants are:

NUMS 2020
Biology
Kingdom Plantae
Elimination Tool:

A) Mosses

B) Ferns

C) Gymnosperms

D) Angiosperms

14 / 100

Category: Biology

Q.40 Which statement is incorrect:

A. Syphilis is caused by Treponema pallidum

B. Genital herpes produces genital soreness and ulcers

C. Syphilis affects bones, eyes and CNS

D. Gonorrhea is a viral infection

15 / 100

Category: Biology Ch 10 Class 11

Of the following which one is not the characteristic of triploblasts.

All of them have blood vascular system

They may be coelomate pseudocoelomate or acoelomate

They are included in grade bilateria

All of them have digestive system

16 / 100

Category: Biology

Q.60 Which of the following statements correctly describes how the host cell membrane is changed by viral replication?

A. Pores develop.

B. Glycocalyx layer is formed.

C. Membrane is resynthesized

D. Viral proteins are acquired

17 / 100

Category: Biology Ch 6 Class 11

Which of the following bacteria possesses a spherical shape?

PMC Practice 4
Biology
Kingdom Prokaryote
Elimination Tool:

A) Bacillus anthracis

B) Escherichia coli

C) Spirillum minus

D) Staphylococcus aureus

18 / 100

Category: Biology Ch 12 Class 11

Nodules on roots of leguminous plants have _____ bacteria

Anaerobic

Nitrogen fixing

Nitrifying

Ammonifying

19 / 100

Category: Biology Ch 5 Class 11

The shape of the tobacco mosaic virus is:

NUMS 2016
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Spring shape

B) Rod shape

C) Comma shape

D) Spherical shape

20 / 100

Category: Biology Ch 4 Class 11

Cellulose is the major component of

Primary wall

Secondary wall

Middle lamella

all of the above

21 / 100

Category: Biology

Q.5 Which statement is incorrect?

A. In short day plants red light prevents flowering

B. In long day plants for red light promotes flowering

C. Leaf unrolling occurs in grasses

D. Henbane is a short-day plant

22 / 100

Category: Biology Ch 4 Class 12

Fallopian tube in humans is important for:

NUMS 2018
Biology
Reproduction
Elimination Tool:

A) Ovulation

B) Primary oocyte

D) Ova

C) Secondary oocyte

23 / 100

Category: Biology

When a fetus is in the uterus, what carries oxygen away from the placenta?

NUMS Mock 1
Biology
Reproduction

A) The amniotic fluid

B) The amniotic sac

C) The lining of the uterus

D) The umbilical cord

24 / 100

Category: Biology Ch 14 Class 11

Identify the incorrect statement from the following:

NTS 2010
Biology
Transport
Elimination Tool:

A) Apical growth increases the length of stems and roots.

B) Xylem is situated on the outer side of the cambium ring and the phloem on the inner side.

C) Secondary growth increases the diameter of stems and roots.

D) The cells in the elongation phase don't divide.

25 / 100

Category: Biology

Genetic information in the DNA is encoded as:

NUMS Mock 1
Biology
Chromosomes and DNA

A) Deoxyribose sugar

B) Ribose sugar

C) Phosphate group

D) Sequence of nitrogenous bases

26 / 100

Category: Biology Ch 12 Class 11

Earthworm is an example of ______ feeder

Detritus

Fluid

Macrophageus

Filter

27 / 100

Category: Biology

Population growth is checked by which of the following?

NUMS Mock 3
Biology
Evolution

A) No competition

B) No polymorphism

C) Polymorphism

D) Competiton

28 / 100

Category: Biology

Q.54 First cardiac sound is associated with:

A. Closure of tricuspid and bicuspid valves

B. Closure of semilunar valves

C. Opening of tricuspid valves

D. Opening of semilunar valves

29 / 100

Category: Biology

Q.32 Lymphocytes are found in:

A. Lymph capillary

B. Lymph vessel

C. Lymph trunk

D. lymph node

30 / 100

Category: Biology

Which of these is not a reflex action?

NUMS Mock 3
Biology
Coordination and Control

A) Secretion of sweat.

B) Salivation.

C) Flexion due to needle prick.

D) Blinking of eyes due to strong light.

31 / 100

Category: Biology

Q.22 What are T Cells and their rolelin IHV infection?

A. A type lymphocytes

B. Present in blood and work as detence systein

C.They kill the ioreign invader

D. All of these

32 / 100

Category: Biology

Q43 Which cells produce oogonia in ovary?

A. Stromal cells

B. Epithelial cells

C. Germ cells

D. Theca cells

33 / 100

Category: Biology Ch 9 Class 11

The scientific name of thorn Apple is?

NTS 2015 DUHS and JSMU
Biology
Kingdom Plantae
Elimination Tool:

A) Sycopodium phlogmaria

B) Anthocoros fusiform

C) Ginkgo biloba

D) Datura alba

34 / 100

Category: Biology Ch 13 Class 12

Endangered species are

Dangerous for the life of humans

Reduced in number

Already extinct

All of these

35 / 100

Category: Biology Ch 7 Class 11

Trypanosoma belongs to class:

NTS 2011
Biology
Kingdom Protista
Elimination Tool:

A) Sarcodina

B) Flagellata

C) Ciliata

D) Suctoria

36 / 100

Category: Biology

Which trait is not sex-linked recessive:

NUMS Mock 2
Biology
Variation and Genetics

A) Haemophilia

B) Colour blindness

C) Hypophosphatemia

D) TFM syndrome

37 / 100

Category: Biology

Which artery supplies blood to the liver?

NUMS Mock 1
Biology
Transport

A) Pulmonary artery

B) Hepatic artery

C) Celiac artery

D) Thoracic artery

38 / 100

Category: Biology Ch 3 Class 11

Inactive enzyme precursors such as pepsinogen for pepsin are called as:

PMC Practice 1
Biology
Enzymes
Elimination Tool:

A) Holoenzymes

B) Actinases

C) Zymogens

D) Mucopolysaccharides

39 / 100

Category: Biology Ch 9 Class 12

Human genome is ______ times larger than any other genome sequenced so far

40 / 100

Category: Biology Ch 4 Class 12

During birth, central nervous system of infants can be damaged by

PMC Sample 3
Biology
Reproduction
Elimination Tool:

A) syphilis

B) genital herpes

C) gonorrhoa

D) HPV

41 / 100

Category: Biology Ch 3 Class 11

Excessive increase in temperature of medium causes the enzyme molecule to

Activate

Unaffected

Denatured

None of these.

42 / 100

Category: Biology Ch 9 Class 12

Choose the term from the following which is NOT a part of gene therapy?

NTS 2019
Biology
Biotechnology
Elimination Tool:

A) Bone marrow transplant

B) Retrovirus

C) DNA Fingerprinting

D) Somatic cells

43 / 100

Category: Biology Ch 7 Class 12

In which stage of meiotic division centromere divides?

NUMS 2017
Biology
Cell Cycle
Elimination Tool:

A) Anaphase I

B) Anaphase II

C) Metaphase II

D) Both A and B

44 / 100

Category: Biology Ch 4 Class 12

What is the commercial method of producing millions of seedlings in limited time?

NUMS 2016
Biology
Reproduction
Elimination Tool:

A) Parthenogenesis

B) Parthenocarpy

C) Cutting

D) Grafting

45 / 100

Category: Biology Ch 7 Class 12

Reduction division is:

NUMS 2015
Biology
Cell Cycle
Elimination Tool:

A) Amitosis

B) Mitosis

C) Meiosis I

D) Meiosis II

46 / 100

Category: Biology Ch 1 Class 12

Capillaries present around the loop of Henle:

NUMS 2018
Biology
Homeostasis
Elimination Tool:

A) Vasa recta

B) Peritubular

C) Lacteals

D) Glomerulus

47 / 100

Category: Biology

Q.6 The uterus of the female reproductive system opens into the?

A. placenta

B. birth canal

C. cervix

D. all of these

48 / 100

Category: Biology Ch 13 Class 12

Study of human population and things that affect them is

Ecology

Demography

Demology

Environment

49 / 100

Category: Biology Ch 2 Class 12

Scapula is the bone of the:

NUMS 2014
Biology
Support and Movement
Elimination Tool:

A) Skull

B) Pelvic girdle

D) Vertebral column

C) Pectoral girdle

50 / 100

Category: Biology

In a marine environment, the ion secreted by the kidney is:

NUMS Mock 1
Biology

A) Na+

B) K+

C) Mg2+

D) Cl-

51 / 100

Category: Biology

Q.46 The path of electrons through the two photosystems is called?

A. S scheme

B.X scheme

C.Z Scheme

D. Y scheme

52 / 100

Category: Biology Ch 9 Class 12

The cells are held together by a Ca-pectate layer are called as:

NUMS 2016
Biology
Biotechnology
Elimination Tool:

A) Primary cell wall

B) Secondary cell wall

C) Middle lamella

D) Tertiary cell wall

53 / 100

Category: Biology Ch 13 Class 11

Vocal cords, which help in voice production are two thin edged fibrous bands, present in:

NUMS 2019 Cancelled
Biology
Gaseous Exchange
Elimination Tool:

A) Glottis

B) Bronchus

C) Larynx

D) Trachea

54 / 100

Category: Biology Ch 5 Class 12

Speed of growth is

Rapid throughout

Slow throughout

First slow then rapid then slow again

First rapid then slow

55 / 100

Category: Biology

How are new mitochondria formed by the pre-existing ones?

Mitosis

Fission

Conjugation

Budding

56 / 100

Category: Biology Ch 2 Class 11

Which of the following is the constituent of RNA molecule?

NUMS 2019 Cancelled
Biology
Biological Molecules
Elimination Tool:

A) Fatty acids

B) Ribulose

C) Ascorbic acid

E) Ribonucleic acid

57 / 100

Category: Biology Ch 7 Class 11

Photosynthesis is absent in which of the following:

PMC 2021 Tested
Biology
Kingdom Protista
Elimination Tool:

A) Bacteria

B) None of these

C) Seaweeds

D) Mushrooms

58 / 100

Category: Biology Ch 10 Class 12

Adaptations that an organism acquires by its own actions are

Heritable

Not heritable

Can be made heritable through some modifications

Both heritable and not heritable

59 / 100

Category: Biology Ch 7 Class 12

Mitosis occurs in

Diploid cells only

Haploid cells only

Both diploid and haploid cells

Monoploid cells

60 / 100

Category: Biology Ch 1 Class 12

In a marine environment, the ion secreted by the kidney is:

NUMS 2020
Biology
Homeostasis
Elimination Tool:

A) Na+

B) K+

C) Mg2+

D) Cl-

61 / 100

Category: Biology Ch 4 Class 11

Whone is not the function of endoplasmic reticulum?

Nerve impulse conduction

Transport of material

Mechanical support

Synthesis of conjugated molecules

62 / 100

Category: Biology Ch 2 Class 11

NAD is an example of:

PMC 2020
Biology
Biological Molecules
Elimination Tool:

A) Mononucleotide

B) Dinucleotide

C) Trinucleotide

D) Tetranucleotide

63 / 100

Category: Biology Ch 6 Class 12

The biochemical analysis of a sample of DNA shows that 32% of the nitrogenous bases are cytosine. What is the total % of adenine and uracil in RNA transcribed from this DNA?

NTS 2015 SMBBMC
Biology
Chromosomes and DNA
Elimination Tool:

A) 16%

B) 18%

D) 36%

C) 32%

64 / 100

Category: Biology Ch 7 Class 11

Golden algae are also known as

Chrysophyta

Phaeophyta

Pyrrophyta

Rhodophyta

65 / 100

Category: Biology Ch 4 Class 12

What is critical in photoperiodism?

Length of light period

Length of dark period

Both a and b

None of these

66 / 100

Category: Biology Ch 5 Class 11

Numerous opportunist diseases might attack people suffering from the following diseases?

PMC 2020
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Measles

B) Influenza

C) Hepatitis A

D) AIDS

67 / 100

Category: Biology Ch 8 Class 11

All of the following are characteristics of kingdom fungi except:

NUMS 2017
Biology
Kingdom Fungi
Elimination Tool:

A) Heterotrophy

B) Sessil

C) Cell wall

D) None of the above

68 / 100

Category: Biology Ch 12 Class 12

Desert ecosystem of Mianwali is

Thar

Thal

Cholistan

None

69 / 100

Category: Biology Ch 8 Class 11

Fungi which get their food directly from dead organic matter are called?

Parasitic fungi

Predators

Mutualists

Decomposers

70 / 100

Category: Biology

Q.10 Mating between relatives is called which of the following?

A. Ex breeding

B. Breeding

C. Inbreeding

D. Outbreeding

71 / 100

Category: Biology Ch 8 Class 12

A pure breeding tall pea plant was crossed to dwarf plant what will be the frequency of dwarf plants in F1

0.25

0.5

0.75

72 / 100

Category: Biology Ch 9 Class 11

A sponge of Antarctica which is more than a meter tall is known as?

PMC Sample 3
Biology
Kingdom Plantae
Elimination Tool:

A) Euplectella

B) Spongilla

C) Leucosolenia

D) Scolymastra joubini

73 / 100

Category: Biology Ch 7 Class 12

Mitotic apparatus in animals is formed by

Aster and spindle

Polar and kinetochore microtubules

Spindle and RNA

Spindle only

74 / 100

Category: Biology

Q.22 Which of the following is false about conjugation?

A. It forms a bridge between two bacterial cells

B. It involves transport of genetic material via vectors

C. It is a form of sexual reproduction

D. Both A and B

75 / 100

Category: Biology

Antheridia and archegonia are _____ organs in bryophytes.

NUMS Mock 1
Biology
Kingdom Plantae

A) Reproductive

B) digestive

C) respiratory

D) none of the above

76 / 100

Category: Biology Ch 5 Class 11

The size of smallest virus is:

10 nm

20 nm

30 nm

40 nm

77 / 100

Category: Biology Ch 5 Class 12

Turner’s syndrome is characterized by having:

UHS 2015
Biology
Growth and Development
Elimination Tool:

A) Trisomy 21

B) 44 + XXY

C) Trisomy

D) 44 + XO

78 / 100

Category: Biology Ch 6 Class 11

In many bacteria, the cell wall is enclosed within a slime capsule made up of:

NUMS 2017
Biology
Kingdom Prokaryote
Elimination Tool:

A) Polysaccharides

B) Cellulose

C) Amino acids

D) Proteins

79 / 100

Category: Biology Ch 3 Class 11

Which of the following statements about enzymes is false?

PMC Sample 1
Biology
Enzymes
Elimination Tool:

A) The Keq of a reaction remains unchanged in the presence of an enzyme

B) Enzymes speed up the rate of reaction in DNA synthesis

C) Harsh, acidic conditions can completely denature an enzyme

D) An enzyme is completely converted to product during metabolism

80 / 100

Category: Biology Ch 4 Class 11

Which of the following offers an active barrier between the cell content and their environment by allowing only selective substances to pass through it?

NUMS 2019 Reconduct
Biology
Cell Structure and Function
Elimination Tool:

A) Cell wall

B) Plasma membrane

C) Nuclear membrane

D) Vacuole

81 / 100

Category: Biology Ch 8 Class 11

How many species of fungi are known till now

10000

100000

10000000

1000

82 / 100

Category: Biology Ch 7 Class 12

During which stage of meiosis do centromeres divide?

NTS 2016 DUHS & JSMU
Biology
Cell Cycle
Elimination Tool:

A) Prophase I

B) Metaphase I

C) Prophase II

D) Metaphase II

83 / 100

Category: Biology Ch 11 Class 11

Pyruvic acid is the end product of:

NTS 2017
Biology
Bioenergetics
Elimination Tool:

A) Glycolysis

B) Krebs cycle

C) Oxidation

D) Electron transport system

84 / 100

Category: Biology Ch 9 Class 12

Natural extrachromosomal circular DNA molecules earrying genes for antibiotic resistance and fertility

Recombinant DNA

Chimaeric DNA C

Lambda phage

Plasmids

85 / 100

Category: Biology

Which of the following blood transfusions can be made safely?

NUMS Mock 2
Biology
Variation and Genetics

A) Group A to group B

B) Group B to group AB

C) Group AB to group O

D) Group A to group O

86 / 100

Category: Biology Ch 5 Class 11

Genetically modified plants contain:

PMC Sample 2
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) No gene

B) No gene in transposition

C) Widely used in gene transfer

D) All of these options are correct

87 / 100

Category: Biology Ch 13 Class 11

Number of spiracles present in the thorax of cockroach is

88 / 100

Category: Biology Ch 12 Class 11

Midgut in cockroach is a short narrow tube called

Hepatic caeca

Gizzard

Stomach

Rectum

89 / 100

Category: Biology Ch 7 Class 12

Exchange of segments between homologous chromosomes is called:

UHS 2012
Biology
Cell Cycle
Elimination Tool:

A) Segregation

B) Independent assortment

C) Crossing over

D) Mutation

90 / 100

Category: Biology Ch 2 Class 11

5 different amino acids, numbered 1, 2, 3, 4, and 5, below from the following sequence in the path of a polypeptide chain:

1-2-3-4-2-5-3

Messenger RNA codon, which correspond to the amino acids, are:
amino acid 1 UGU

amino acid 2 GAU

amino acid 3 CAC

amino acid 4 UAG

amino acid 5 AAG

Which one of the following DNA bases sequences could provide the code for the given section of the polypeptide?

NTS 2015 DUHS and JSMU
Biology
Biological Molecules
Elimination Tool:

A) ACACTTGTGATGCTATTCGTG

B) ACACUAGUGAUGCUAUUCGUG

C) ACACTAGTGATGCTAAACGTG

D) ACACTAGTGATCCTATTCGTG

91 / 100

Category: Biology Ch 14 Class 11

The favourite host cells of the HIV-Virus are:

NUMS 2014
Biology
Transport
Elimination Tool:

A) Lymphocytes

B) RBCs

C) T-cells

D) B-cells

92 / 100

Category: Biology Ch 9 Class 12

Lambda phage is

Virus

Bacterium

Plasmid

Host cell

93 / 100

Category: Biology Ch 3 Class 11

What is not true about the induced fit model:

NUMS 2018
Biology
Enzymes
Elimination Tool:

A) Explains mechanism of enzyme action

B) Enzyme is specific in nature

C) Enzyme is a flexible structure

D) Enzyme doesn’t show change during reaction

94 / 100

Category: Biology

Proteins and lipids are converted into glycolipids and glycoproteins by adding carbohydrates by?

NUMS Mock 4
Biology
Cell Structure and Function

A) Ribosomes

B) Cytoplasm

C) Golgi apparatus

D) Endoplasmic reticulum

95 / 100

Category: Biology Ch 7 Class 12

At what phase the DNA content of a cell is doubled?

PMC 2020
Biology
Cell Cycle
Elimination Tool:

A) Prophase

B) Interphase

C) Anaphase

D) Telophase

96 / 100

Category: Biology Ch 13 Class 11

The voice box leads to the trachea which is also called

PMC Practice 1
Biology
Gaseous Exchange
Elimination Tool:

A) Bronchi

B) Bronchioles

C) Windpipe

D) Alveolar duct

97 / 100

Category: Biology Ch 3 Class 11

Optimal temperature of enzymes present in human body is

27?C

37?C

47?C

30?C

98 / 100

Category: Biology Ch 4 Class 11

The following are all features of eukaryotic cells:

I. chloroplast

II. peroxisome

III. lysosome

IV. mitochondrion

v. nucleus

Which of these have a double membrane?

NTS 2014
Biology
Cell Structure and Function
Elimination Tool:

A) I, II and IV

B) I, III and V

C) I, IV and V

D) II, III and V

99 / 100

Category: Biology Ch 7 Class 12

Smooth endoplasmic reticulum is responsible for the metabolism of:

UHS 2019
Biology
Cell Cycle
Elimination Tool:

A) Nucleic acids

B) Proteins

C) Carbohydrates

D) Lipids

100 / 100

Category: Biology Ch 8 Class 12

Pick the correct option about Drosophila.

NUMS 2015
Biology
Variation and Genetics
Elimination Tool:

A) The Male is larger with a pointed abdomen

B) The female has sex combs on its front legs

C) It has a generation time of just eight weeks

D) Salivary gland cells have giant chromosomes in their nuclei

Your score is

The average score is 52%

Structured Practice for Best Entry Test Preparation

This topic-wise and chapter-wise practice test allows students to focus on individual biology concepts, including diagrams, processes, and conceptual questions. Regular practice enhances understanding, sharpens problem-solving skills, and builds confidence to tackle both board and competitive exam questions efficiently.

Free Resources for Best Entry Test Preparation

Students can access free Biology Practice Test 1 to systematically improve knowledge, recall, and problem-solving abilities. This test is suitable for FSC Board Exams as well as major entry tests, helping students perform better in the biology section. PLS Academy provides these resources to support students in their preparation.

JazakAllah

Comments

3 responses to “Biology Practice Test 1”

Anonymous

September 30, 2022

Hello sr thanks for your service
But there are some MCQ Wich are out of the PMC slabus in this test
But the test was very useful to me thanks
wajiha

October 5, 2022

Q:27 problem
Anonymous

October 13, 2022

AOA sir
Here in the test there are many mcqs that are not included in Nums r Pmc syllabus
Kindly check it out
Thanks
But it’s very helpful
Thanks