Biology Practice Test 1

Biology Practice Test 1 is designed to help students strengthen their understanding of key biological concepts, theories, and processes for competitive entry tests like MDCAT, NUMS, AKU, UET, ECAT, NTS, as well as FSC Board Exams. This test covers topics from cell biology, genetics, physiology, ecology, evolution, and more, helping students improve accuracy and retention.

PLS Academy

Get Access to 20 thousands+ MCQs Including Topical MCQs, Practice Tests, Mock Tests, Solved Past Papers, Flashcards, Notes, FLPS, and Much More.

UNLOCK PREMIUM🔐

8081

Created by Ali Durrani

MDCAT Practice Tests

Biology Practice Test 1

This is the Free Access to Limited MCQs. Enroll to PLS Boost Premium Bundle to Get More MCQs HERE

1 / 100

Category: Biology Ch 6 Class 12

Mutations can occur in:

NUMS 2016
Biology
Chromosomes and DNA
Elimination Tool:

A) DNA

B) Protein

C) RNA

D) A and C

2 / 100

Category: Biology Ch 10 Class 12

Consider the following statements about biological communities.

I. Their members share a common gene pool

II. The community remains stable even though some physical aspect of the environment may undergo a change

III. It consists of all the populations living in a particular area.

IV. A community interacts with a non-living environment and both function together to form an ecosystem

Which two of the above statements are true?

NTS 2014
Biology
Evolution
Elimination Tool:

A) 1 and 2

B) 1 and 3

D) 2 and 3

E) 3 and 4

3 / 100

Category: Biology Ch 6 Class 11

Rod-shaped bacteria are known as _______

UHS 2018
Biology
Kingdom Prokaryote
Elimination Tool:

A) Spirilla

B) Bacilli

C) Spirochete

D) Cocci

4 / 100

Category: Biology Ch 5 Class 12

Growth of multicellular plants occur in

Two phases

Three phases

Five phase

Four phases

5 / 100

Category: Biology Ch 3 Class 11

A cofactor made of inorganic ion which is detachable is called

Prosthetic group

Coenzyme

Activator

Cofactor

6 / 100

Category: Biology Ch 7 Class 11

Brown algae are also known as

Phaeophyta

Rhodophyta

Pyrrophyta

Chrysophyta

7 / 100

Category: Biology Ch 2 Class 11

5 different amino acids, numbered 1, 2, 3, 4, and 5, below from the following sequence in the path of a polypeptide chain:

1-2-3-4-2-5-3

Messenger RNA codon, which correspond to the amino acids, are:
amino acid 1 UGU

amino acid 2 GAU

amino acid 3 CAC

amino acid 4 UAG

amino acid 5 AAG

Which one of the following DNA bases sequences could provide the code for the given section of the polypeptide?

NTS 2015 DUHS and JSMU
Biology
Biological Molecules
Elimination Tool:

A) ACACTTGTGATGCTATTCGTG

B) ACACUAGUGAUGCUAUUCGUG

C) ACACTAGTGATGCTAAACGTG

D) ACACTAGTGATCCTATTCGTG

8 / 100

Category: Biology Ch 11 Class 11

RuBP + O2 —Rubisco—> PGA + _______

NTS 2016 DUHS & JSMU
Biology
Bioenergetics
Elimination Tool:

A) Phosphoglycerate

B) Phosphoglycolate

C) Glycerate

D) Glycolate

9 / 100

Category: Biology Ch 3 Class 11

If the concentration of enzyme is kept constant and amount of substrate is increased a point is reached where increase in substrates concentration does not affect the reaction rate because of

Enzymes get denatured at higher substrate conc.

Rate of reaction is indirectly proportional to substrate concentration at this point.

All the active sites on enzyme molecule are occupied.

None of these.

10 / 100

Category: Biology

Q.13 The frequency of allele if it is evolutionary successful is?

A. increased

B. Enzymes

C. no change

D. All of these

11 / 100

Category: Biology Ch 10 Class 12

Archaebacteria can survive at

150?C

300?C

120?C

200?C

12 / 100

Category: Biology Ch 10 Class 12

There existed two varieties of female freshwater Mollusks in which some were streamlined and some had a high bulge. Over the generations, male freshwater Mollusks learned that high bulge favors more production of offspring. So they started preferring to mate with females having high bulge as compared to streamlined. Will this affect Hardy Weinberg Equilibrium in the population?

NTS 2019
Biology
Evolution
Elimination Tool:

A) No, it will not affect the Hardy Weinberg equilibrium

B) Yes, it will affect the Hardy Weinberg equilibrium

C) It will help to balance equilibrium

D) The Hardy Weinberg equilibrium doesn't apply here

13 / 100

Category: Biology Ch 5 Class 12

Plasticity of cell wall increases during

Cell maturation

Cell elongation

Cell differentiation

Cell division

14 / 100

Category: Biology Ch 7 Class 12

A special area of centromere with specific base arrangement and specific proteins where spindle fibers are attached is called

Chromatin

Aster

Kinetochore

Primary constriction

15 / 100

Category: Biology Ch 7 Class 12

Crossing over occur between ____________ of homologous chromosomes:

PMC Sample 1
Biology
Cell Cycle
Elimination Tool:

A) Sister pair of chromatid

B) Sister chromatids of homologous

C) Non-sister chromatin

D) All of them

16 / 100

Category: Biology Ch 4 Class 11

Lysosomes function in:

NTS 2011
Biology
Cell Structure and Function
Elimination Tool:

A) Protein synthesis

B) Processing

C) Intracellular digestion

D) Lipid synthesis

17 / 100

Category: Biology Ch 9 Class 12

Human genome is ______ times larger than any other genome sequenced so far

18 / 100

Category: Biology Ch 2 Class 12

Bones of the skull are joined by:

NTS 2011
Biology
Support and Movement
Elimination Tool:

A) Fixed joints

B) Sliding joints

C) Pivot joints

D) Hinge joints

19 / 100

Category: Biology

Q.47 The chemical nature of oxytocin is:

A. Protein

B. Amino acid derivative

C. Polypeptide

D. Steroid Incorrect

20 / 100

Category: Biology Ch 4 Class 11

Percentage of proteins in cell membrane is

20-40%

40-50%

60-80%

80-100%

21 / 100

Category: Biology Ch 13 Class 12

In air nitrogen is

57%

20%

79%

30%

22 / 100

Category: Biology

Hemoglobin carries more oxygen than plasma by:

NUMS Mock 1
Biology
Gaseous Exchange

A) 50 times

B) 20 times

C) 70 times

D) 100 times

23 / 100

Category: Biology Ch 3 Class 11

Extreme change in pH results in:

Change in ionization of amino acids at the active site of the enzyme.

Change in the ionization of the substrate.

Denaturation of the enzyme

IncreaseIncrease in the reaction rate. in the reaction rate.

24 / 100

Category: Biology

In a marine environment, the ion secreted by the kidney is:

NUMS Mock 1
Biology

A) Na+

B) K+

C) Mg2+

D) Cl-

25 / 100

Category: Biology

Q.16 Which of the following changes length during sarcomere contraction?

A. Thick filaments

B. Thin filaments

C.H zone

D. all of these Inco

26 / 100

Category: Biology Ch 11 Class 11

Stroma of chloroplast carries the fixation of:

NUMS 2014
Biology
Bioenergetics
Elimination Tool:

A) Nitrogen

B) Oxygen

C) Carbon monoxide

D) Carbon dioxide

27 / 100

Category: Biology Ch 2 Class 11

Which of the following amino acids has single codon?

NUMS 2014
Biology
Biological Molecules
Elimination Tool:

A) Isoleucine

B) Tryptophan

C) Valine

D) Arginine

28 / 100

Category: Biology Ch 5 Class 11

The shape of the tobacco mosaic virus is:

NUMS 2016
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Spring shape

B) Rod shape

C) Comma shape

D) Spherical shape

29 / 100

Category: Biology Ch 3 Class 11

Restriction endonucleases

PMC Sample 2
Biology
Enzymes
Elimination Tool:

A) are bacterial enzyme

B) convert RNA to DNA

C) hydrolyze protein into amino acids

D) get mutated for DNA repair

30 / 100

Category: Biology Ch 9 Class 11

Which of the following is true in angiosperm life cycle?

NTS 2014
Biology
Kingdom Plantae
Elimination Tool:

A) Gametophyte are photosynthetic and partially independent than sporophyte

B) Sporophytes are totally dependent on gametophytes

C) Gametophytes are totally dependent on sporophytes

D) Both gametophytes and sporophytes are totally dependent on each other

31 / 100

Category: Biology Ch 3 Class 11

A three dimensional dcavity bearing a specific charge by which the enzyme reacts with its substrate is called

Active site

Binding site

Catalytic site

Allosteric site

32 / 100

Category: Biology Ch 1 Class 12

Thick, waxy & leathery cuticle around leaves is present in

Hydrophytes

Mesophytes

Xerophytes

Halophytes

33 / 100

Category: Biology Ch 12 Class 11

Useful bacteria at the large intestine of humans produce:

NUMS 2015
Biology
Nutrition
Elimination Tool:

A) Vitamin K

B) Vitamin E

C) Vitamin D

D) Vitamin C

34 / 100

Category: Biology Ch 12 Class 11

Carotenoids are related to:

NUMS 2015
Biology
Nutrition
Elimination Tool:

A) Vitamin A

B) Vitamin B

C) Vitamin C

D) Vitamin D

35 / 100

Category: Biology Ch 3 Class 11

The enzyme in breast milk that causes the coagulation of milk or forms precipitates of milk is:

NUMS 2016
Biology
Enzymes
Elimination Tool:

A) Renin

B) Trypsin

C) Amylase

D) Lipase

36 / 100

Category: Biology Ch 6 Class 12

Which statement is correct?

Leading strand elongates away from the replication fork

Lagging strand elongates towards the replication fork

Lagging strand is constructed discontinuously.

Both a and b

37 / 100

Category: Biology Ch 5 Class 11

Amoeba belongs to which kingdom:

Prokaryotae

Plantae

Monera

Protista

38 / 100

Category: Biology Ch 13 Class 11

Water is _____ times viscous than air

1000

5000

8000

39 / 100

Category: Biology Ch 6 Class 12

Transcription is the process in which an RNA copy of the DNA sequence and coding the gene is produced with the help of an enzyme called:

PMC 2020
Biology
Chromosomes and DNA
Elimination Tool:

A) DNA polymerase

B) RNA polymerase

C) DNA transcriptase

D) RNA transcriptase

40 / 100

Category: Biology Ch 14 Class 11

T-Lymphocytes are matured in thymus glands and they are produced in:

NUMS 2016
Biology
Transport
Elimination Tool:

A) Thymus glands

B) Bone marrow

D) Heart

C) Pancreas

41 / 100

Category: Biology Ch 6 Class 12

Bacteria were grown in a medium containing heavy isotope of nitrogen (N15) for many generations and all their DNA contained many heavy nitrogen only. A bacterium of this type was transferred to normal medium and allowed to duplicate. After two divisions of heavy DNA is likely to be that:

NTS 2012
Biology
Chromosomes and DNA
Elimination Tool:

A) Only one daughter cell will have heavy DNA

B) Two daughter cells have normal DNA and other two have heavy DNA

C) All daughter cells have heavy DNA

D) Half daughter cells have heavy DNA and other half have normal DNA

42 / 100

Category: Biology

Which of the following is not an infection of the lungs/respiratory tract?

NUMS Mock 2
Biology
Gaseous Exchange

A) Histoplasmosis

B) Tuberculosis

C) Cystic fibrosis

D) None of the given options

43 / 100

Category: Biology

The autonomic nervous system controls all of the following activities except:

NUMS Mock 1
Biology
Coordination and Control

A) Digestion of food

B) Heart beat

C) Contraction of pupil of eye

D) Thought

44 / 100

Category: Biology Ch 7 Class 12

In which stage of meiotic division centromere divides?

NUMS 2017
Biology
Cell Cycle
Elimination Tool:

A) Anaphase I

B) Anaphase II

C) Metaphase II

D) Both A and B

45 / 100

Category: Biology Ch 6 Class 12

In DNA A.

A forms two bonds with T

G forms three bonds with C

A forms three bonds with T

Both a and b

46 / 100

Category: Biology Ch 12 Class 11

Certain types of whales are also ______ feeder.

Fluid

Macrophagous

Filter

None of these

47 / 100

Category: Biology Ch 6 Class 12

“Law of independent assortment” states:

PMC 2020
Biology
Chromosomes and DNA
Elimination Tool:

A) That each pair of alleles assort independently of other pairs of alleles during gamete formation

B) That alleles of each pair of contrasting trait have unequal probability to assort with the alleles of other pair

C) That the two coexisting alleles for each trait segregate (separate) from each other at meiosis so that each gamete receives only one of the two alleles

D) That pertain to inheritance of single trait (monohybrid cross)

48 / 100

Category: Biology Ch 6 Class 12

A tortion of chromatin that is condensed only during cell division is

Euchromatin

Heterochromatin

Biochromatin

Nucleochromatin

49 / 100

Category: Biology

Q.25 For respiratory metabolism, bacterial cell membrane contains

A. Proteins

B. Lipids

C.Enzymes

D. Chemicals

50 / 100

Category: Biology

Q.9 The linkage formed when one molecule of glucose combines with one molecule of fructose is:

A. 1, 2-glycosidic linkage

B. 1, 6-glycosidic linkage

C. 1, 4-glycosidic linkage

D. 1,3-glycosidic linkage

51 / 100

Category: Biology Ch 5 Class 11

Where can viruses replicate?

PMC Sample 1
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Animals

B) Plants

C) Bacteria

D) All of these options are correct

52 / 100

Category: Biology Ch 1 Class 12

Higher turgor pressure in a plant cell is maintained by:

Large number of vacoules in a plant cell.

Higher ionic concentration inside vacuoles resulting from active pumping of ions at their tonoplastic membrane

Higher osmotic pressure of the cell vacuole

both b and c

53 / 100

Category: Biology Ch 3 Class 12

Neurons are cells adapted for the rapid transmission of electrical impulses. To do this, they have long thin processes called:

PMC 2020
Biology
Coordination and Control
Elimination Tool:

A) Axons

B) Dendrites

D) Schwann cell

C) Myelin sheath

54 / 100

Category: Biology Ch 1 Class 12

Sperms of liverworts, mosses, ferns move towards archegonia, in response to uncleic acid released by the ovum. This is an example of:

Chemotropic movement

Chemotactic movement.

Chemosastic movement

. Haptonastic movement.

55 / 100

Category: Biology Ch 11 Class 11

What is the function of Ribulose?

PMC 2020
Biology
Bioenergetics
Elimination Tool:

A) Intermediates in photosynthesis

B) Respiratory fuel

C) Intermediates in cellular respiration

D) Component of DNA and RNA

56 / 100

Category: Biology

Optimum pH for action of pepsin and salivary amylase is

NUMS Mock 2
Biology
Nutrition

A) 3.5 and 7.7 respectively

B) 1.8 and 6.8 respectively

C) 6.8 and 7.4 respectively

D) 1.8 and 7.4 respectively

57 / 100

Category: Biology Ch 12 Class 11

Nitrogen-fixing bacteria in root nodules fix nitrogen in soil air into:

NUMS 2015
Biology
Nutrition
Elimination Tool:

A) Ammonia

B) Nitrite

C) Nitrate

D) Amino acid

58 / 100

Category: Biology Ch 5 Class 11

These viruses usually occur in two structural forms:

PMC Sample 2
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) HIV

B) HCV

C) Bacteriophage

D) COVID-19

59 / 100

Category: Biology Ch 8 Class 12

In cats, the genes controlling coat-color are co-dominant (incompletely dominant) and are carried on the X chromosomes. When a black female was mated with a ginger male the resulting litter consisted of black male and tortoise-shell female kittens. What phenotypic ratio would be expected in the F2 generation?

NTS 2012
Biology
Variation and Genetics
Elimination Tool:

A) 1 black male : 1 ginger male : 2 tortoise – shell females

B) 1 black male : 1 ginger male : 1 tortoise – shell female : 1 black female

C) 2 black males : 1 tortoise – shell female : 1 ginger female

D) 1 black male : 1 tortoise – shell female : 1 ginger female : 1 black female

60 / 100

Category: Biology Ch 9 Class 11

Which of the following statement about alternation of generation in bryophytes is incorrect?

It involves alternation of morphologically different generations

Their gametophyte is independent while sporophyte depends upon gametophyte for nutrition.

Both the gametophyte and sporophytes are haploid generations thus can produce haploids gametes to continue the diploid number on fertilization

pore formation occurs through meiosis

61 / 100

Category: Biology

The type of plastids found in roots of plants are _____.

NUMS Mock 4
Biology
Cell Structure and Function

A) Chloroplasts

B) Chromoplasts

C) Leucoplasts

D) All of these options are correct

62 / 100

Category: Biology Ch 3 Class 11

During feedback inhibition, which of the following structural part of enzyme is involved?

NUMS 2020
Biology
Enzymes
Elimination Tool:

A) Active site

B) Binding site

C) Catalytic site

D) Allosteric site

63 / 100

Category: Biology Ch 5 Class 12

Growth process is

Irreversible

Reversible

Sometimes reversible sometimes irreversible

Temporary

64 / 100

Category: Biology Ch 4 Class 12

Which disorder among the following CANNOT be detected by amniocentesis?..

NTS 2019
Biology
Reproduction
Elimination Tool:

A) Haemophilia

B) Heart defects

D) Cystic fibrosis

C) Tay-Sachs disease

65 / 100

Category: Biology

Steroids consist of _____ 6 membered carbon rings and one 5 membered carbon ring.

NUMS Mock 4
Biology
Biological Molecules

A) Four

B) Three

C) Two

D) Five

66 / 100

Category: Biology Ch 14 Class 11

Arteriosclerosis is:

NUMS 2016
Biology
Transport
Elimination Tool:

A) A metabolic disorder

B) A degenerative disorder

C) An infectious disorder

D) A nutritional deficiency disorder

67 / 100

Category: Biology Ch 11 Class 11

During the first three steps of glycolysis, glucose is converted to Fructose 1, 6-diphosphate by the rearrangement of the molecule and addition of two phosphate groups. The phosphate comes from?

NTS 2015 SMBBMC
Biology
Bioenergetics
Elimination Tool:

A) Phospholipids of the membrane

B) ADP

C) inorganic phosphates

D) ATP

68 / 100

Category: Biology

Germ layers are formed in which stage of development?

NUMS Mock 2
Biology
Growth and Development

A) Morulation

B) Blastulation

C) Gastrulation

D) Organogenesis

69 / 100

Category: Biology

Q.46 Which part of the brain connects the cerebrum with the spinal cord?

A. Forebrain

B. Cerebrum

C. Cerebellum

D. Brainstem

70 / 100

Category: Biology Ch 8 Class 12

If a heterozygous individual shows the complete effect of both alleles, the type of inheritance would be

Complete dominance

Non dominance

Incomplete dominance

Co-Dominance

71 / 100

Category: Biology

Q.7 A neuron located in the cential hervous system that projects its axon outside the CNS is called:

A. Motor nerve

B. Sensory nerve

C. Both A and B

D. Mixed nerve

72 / 100

Category: Biology Ch 7 Class 11

Which type of chlorophyll is found in all types of algae?

NUMS 2015
Biology
Kingdom Protista
Elimination Tool:

A) Chlorophyll a

B) Chlorophyll b

C) Chlorophyll c

D) Chlorophyll d

73 / 100

Category: Biology Ch 9 Class 11

Dark purple or black spore cases of Claviceps purpurea are called:

NUMS 2015
Biology
Kingdom Plantae
Elimination Tool:

A) Smuts

B) Rusts

C) Ergots

D) Aspergins

74 / 100

Category: Biology Ch 6 Class 12

Haploid and monoploid numbers of chromosomes of hexaploid wheat are:

NTS 2014
Biology
Chromosomes and DNA
Elimination Tool:

A) 21 and 42

B) 7 and 21

C) 21 and 7

D) 42 and 21

75 / 100

Category: Biology Ch 1 Class 12

Which organ is called the body thermostat?

NUMS 2020
Biology
Homeostasis
Elimination Tool:

A) Pituitary gland

B) Kidneys

C) Hypothalamus

D) Adrenal gland

76 / 100

Category: Biology Ch 12 Class 11

Amylase is not produced by the following type(s) of salivary gland:

NUMS 2015
Biology
Nutrition
Elimination Tool:

A) Parotid

B) Submandibular

C) Sublingual

D) None of the given options are correct

77 / 100

Category: Biology

Q.33 Food in plants is transported in the form of:

A. Monosaccharide

B. Polysaccharide

C. Disaccharide

D. Oligosaccharide

78 / 100

Category: Biology Ch 13 Class 12

An area previously supporting life is made barren, the subsequent recolonization is called ______.

UHS 2018
Biology
Man and His Environment
Elimination Tool:

A) Climax community

B) Pioneer succession

C) Primary succession

D) Secondary succession

79 / 100

Category: Biology Ch 7 Class 12

Which statement is not true about phragmoplast?

Formed from vesicle originating from Golgi apparatus

Present in plants only

Formed at the end of anaphase

Centre of dividing cell

80 / 100

Category: Biology Ch 6 Class 12

The length of okazaki fragments in eukayotes is

150–250 nucleotides long

200-300 nucleotides

1000-2000 nucleotde

100-200 nucleotides

81 / 100

Category: Biology Ch 8 Class 12

Two animals are mated. One is homozygous dominant for one character and homozygous recessive for another. The other animal Is heterozygous for both characters. How many phenotypes are expected in the offspring of this cross?

NTS 2016 DUHS & JSMU
Biology
Variation and Genetics
Elimination Tool:

A) 1

B) 2

C) 3

D) 4

82 / 100

Category: Biology Ch 10 Class 11

The radial symmetry is found in the animals of

Protozoa

Porifera

Cnidaria

All of these

83 / 100

Category: Biology Ch 8 Class 11

Coenocytic hyphae are also known as

Septate

. Perforated hyphae

Aseptate

Uninucleate hyphae

84 / 100

Category: Biology Ch 8 Class 12

In nature, Garden pea is

Self-fertilized

Cross fertilized

Cross pollinated

None of these

85 / 100

Category: Biology Ch 9 Class 12

A method of DNA sequencing in which DNA threads are chemically cut into pieces of different sizes is

Sanger's method

Maxam-Gilbert method

Hamilton's method

Vortex method A

86 / 100

Category: Biology Ch 14 Class 11

The chemical nature of an antibody is:

NUMS 2016
Biology
Transport
Elimination Tool:

A) Glycoprotein

B) Glycolipids

C) Lipoproteins

D) Polysaccharides

87 / 100

Category: Biology Ch 11 Class 11

In the Calvin cycle, the reducing power from NADPH is used during:

NUMS 2019 Reconduct
Biology
Bioenergetics
Elimination Tool:

A) Formation of 1, 3- Bisphosphoglycerate

B) Conversion of 1, 3- Bisphosphoglycerate to Glyceraldehyde 3- phosphate

C) Formation of fructose 1, 6- bisphosphate from 1, 3- bisphosphoglycerate

D) Formation of glucose from fructose bisphosphate

88 / 100

Category: Biology Ch 8 Class 11

Saccharomyces cerevisiae is the scientific name of a:

NUMS 2017
Biology
Kingdom Fungi
Elimination Tool:

A) Fungus

B) Smut

C) Bacterium

D) Yeast

89 / 100

Category: Biology Ch 5 Class 11

Five kingdom classification was proposed by :

Carlous Linnaeus

E-Chatton

Robert Whittaker

Lynn Margulis and Karlene Schwartz

90 / 100

Category: Biology

Q.22 What are T Cells and their rolelin IHV infection?

A. A type lymphocytes

B. Present in blood and work as detence systein

C.They kill the ioreign invader

D. All of these

91 / 100

Category: Biology Ch 8 Class 11

Constricting ring around nematode is formed by

Arthrobotrys

Pleurotus ostreatus

Mildews

All of these

92 / 100

Category: Biology Ch 2 Class 12

Roots of a plant show

Positive phototropism and negative geotropism.

Negative phototropism and positive geotropism.

Negative tactic movement and positive tropic movement.

Positive geotropism of stem and roots

93 / 100

Category: Biology Ch 9 Class 12

Chimaeric DNA is also known as

Recombinant DNA

Complementary DNA

Vector

Plasmid

94 / 100

Category: Biology

Q.51 The heavy and light chains of an antibody molecule is held together by:

A. H-bonds

B. Disulphide bridges

C. Ionic interactions

D. Hydrophobic interactions

95 / 100

Category: Biology Ch 5 Class 11

Solanum tuberosum is a scientific name of:

Onion

Amaltas

Potato

Tomato

96 / 100

Category: Biology

Amylase is not produced by the following type(s) of salivary gland:

NUMS Mock 1
Biology
Nutrition

A) Parotid

B) Submandibular

C) Sublingual

D) None of the given options are correct

97 / 100

Category: Biology Ch 3 Class 11

The Induced fit model was introduced by Koshland in which of the following year?

PMC Sample 1
Biology
Enzymes
Elimination Tool:

A) 1960

B) 1961

C) 1959

D) 1966

98 / 100

Category: Biology Ch 11 Class 11

NAD is an example of ______:

NUMS 2020
Biology
Bioenergetics
Elimination Tool:

A) Mononucleotide

B) Dinucleotide

C) Tri nucleotide

D) Tetra nucleotide

99 / 100

Category: Biology Ch 13 Class 12

Flow of energy in an ecosystem is:

NUMS 2014
Biology
Man and His Environment
Elimination Tool:

A) Unidirectional

B) Tridirectional

C) Multidirectional

D) Bidirectional

100 / 100

Category: Biology

On receiving the news of the sudden demise of a close friend; which is the most probable hormone that is secreted at that time?

NUMS Mock 1
Biology
Coordination and Control

A) Prostaglandin

B) Growth inhibitors

C) Estrogen

D) Adrenaline

Your score is

The average score is 52%

Structured Practice for Best Entry Test Preparation

This topic-wise and chapter-wise practice test allows students to focus on individual biology concepts, including diagrams, processes, and conceptual questions. Regular practice enhances understanding, sharpens problem-solving skills, and builds confidence to tackle both board and competitive exam questions efficiently.

Free Resources for Best Entry Test Preparation

Students can access free Biology Practice Test 1 to systematically improve knowledge, recall, and problem-solving abilities. This test is suitable for FSC Board Exams as well as major entry tests, helping students perform better in the biology section. PLS Academy provides these resources to support students in their preparation.

JazakAllah

Comments

3 responses to “Biology Practice Test 1”

Anonymous

September 30, 2022

Hello sr thanks for your service
But there are some MCQ Wich are out of the PMC slabus in this test
But the test was very useful to me thanks
wajiha

October 5, 2022

Q:27 problem
Anonymous

October 13, 2022

AOA sir
Here in the test there are many mcqs that are not included in Nums r Pmc syllabus
Kindly check it out
Thanks
But it’s very helpful
Thanks