Biology Practice Test 1

Biology Practice Test 1 is designed to help students strengthen their understanding of key biological concepts, theories, and processes for competitive entry tests like MDCAT, NUMS, AKU, UET, ECAT, NTS, as well as FSC Board Exams. This test covers topics from cell biology, genetics, physiology, ecology, evolution, and more, helping students improve accuracy and retention.

PLS Academy

Get Access to 20 thousands+ MCQs Including Topical MCQs, Practice Tests, Mock Tests, Solved Past Papers, Flashcards, Notes, FLPS, and Much More.

UNLOCK PREMIUM🔐

8083

Created by Ali Durrani

MDCAT Practice Tests

Biology Practice Test 1

This is the Free Access to Limited MCQs. Enroll to PLS Boost Premium Bundle to Get More MCQs HERE

1 / 100

Category: Biology

Q45 During birth which of following act as birth canal?

A. Oviduct

B. Ovary

C. Uterus

D. Vagina

2 / 100

Category: Biology Ch 1 Class 11

Which character differentiates living things from non-living organisms?

They live in the same ecosystem.

They are acted upon by the same environment

They are highly organized and complex made of one or more cells and contain genetic material

Both a and b

3 / 100

Category: Biology

The Porifera are pore – bearing animals, commonly called:

NUMS Mock 3
Biology
Kingdom Animalia

A) Corals

B) Sponges

C) Hydras

D) Anemones

4 / 100

Category: Biology Ch 6 Class 12

What will be the approximate length of a DNA strand having 500 nucleotides?

NUMS 2015
Biology
Chromosomes and DNA
Elimination Tool:

HIDE ELIMINATED OPTIONS

A) 100 nm

B) 130 nm

C) 170 nm

D) 150 nm

5 / 100

Category: Biology Ch 11 Class 12

Major regional ecological community of plants and animals forms

Biosphere

Biomass

Biomes

Bioecosystem

6 / 100

Category: Biology Ch 13 Class 11

The structural and functional unit of the lungs is:

PMC Practice 2
Biology
Gaseous Exchange
Elimination Tool:

A) Alveoli

B) Trachea

C) Bronchiole

D) Bronchus

7 / 100

Category: Biology Ch 12 Class 11

Which of the following is not the type of cells of gastric gland?

NUMS 2019 Cancelled
Biology
Nutrition
Elimination Tool:

A) Zymogenic

C) Sinusoidal

B) Parietal

D) Mucous neck

8 / 100

Category: Biology

Which of the following is NOT a difference that would allow one to distinguish between a prokaryotic and a eukaryotic cell?

Presence of absence of the nucleus
Presence or absence of the cell wall
Membrane bound versus no membrane bound organelles
NUMS Mock 3
Biology
Cell Structure and Function

A) I only

B) II only

C) III only

D) I and II only

9 / 100

Category: Biology

The causes of Cyanosis include:

NUMS Mock 2
Biology
Transport

A) Deficiency of vitamin C

B) Varicella-zoster virus

C) Degeneration of the cartilage of joints

D) Ventricular septum defect

10 / 100

Category: Biology

How many fatty acid molecules are normally present in a fat or oil molecule?

NUMS Mock 4
Biology
Biological Molecules

A) 1

B) 2

C) 3

D) 4

11 / 100

Category: Biology Ch 10 Class 12

Adaptation of traits to better fill a niche is known as which of the following?

PMC Sample 3
Biology
Evolution
Elimination Tool:

A) polymorphism

B) gene linkage

C) specialization

D) replication

12 / 100

Category: Biology Ch 5 Class 12

The disease that arises due to increasing age is:

NTS 2018
Biology
Growth and Development
Elimination Tool:

A) Alzheimer's

B) Hepatitis C

C) Cholera

D) Malaria

13 / 100

Category: Biology Ch 5 Class 11

Which of the following are composed of proteins only which contain the information that codes for their own replication?

NUMS 2019 Reconduct
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Virus

B) Virion

C) Prions

D) Capsule

14 / 100

Category: Biology

Q.54 Structures that were once functional in the past but no longer serve a purpose due to evolutionary adaptations and physiological changes are referred to as?

A Vestigial
B. Analogous structures
C. Homologous structures
D. None of these

A Vestigial

B. Analogous structures

C. Homologous structures

D. None of these

15 / 100

Category: Biology Ch 14 Class 11

Minerals salts enter a plant largely through its:

NTS 2015 SMBBMC
Biology
Transport
Elimination Tool:

A) Root hair

B) Stomata

C) Guard cells

D) Cell wall

16 / 100

Category: Biology

Proteins and lipids are converted into glycolipids and glycoproteins by adding carbohydrates by?

NUMS Mock 4
Biology
Cell Structure and Function

A) Ribosomes

B) Cytoplasm

C) Golgi apparatus

D) Endoplasmic reticulum

17 / 100

Category: Biology Ch 4 Class 11

Whone is not the function of endoplasmic reticulum?

Nerve impulse conduction

Transport of material

Mechanical support

Synthesis of conjugated molecules

18 / 100

Category: Biology Ch 8 Class 12

The gene which controls ABO group has how many alleles in an individual

One

Two

Three

Four

19 / 100

Category: Biology Ch 3 Class 11

Inhibitors which block the enzyme by forming weak bond are called

Competitive inhibitors.

Non-competitive inhibitors

Irreversible inhibitors.

Both a and b

20 / 100

Category: Biology Ch 3 Class 12

Which of the following is used in brewing industry to promote malting:

Gibberellins

Cytokinins

Auxins

Abscisic Acid

21 / 100

Category: Biology Ch 12 Class 12

Eutrophication is

Process of decreasing nutrients by human activities

Adequate nutrition accelerated by human activities

Changing the trophic levels of an ecosystem by human activities

Addition of more predators in an ecosystem

22 / 100

Category: Biology

Q.12 In enzymatic mechanism, the substrate bind to enzyme active site to produce?

A. Reactants

B. Enzyme

C. Products

D. all of these

23 / 100

Category: Biology

Q.3 Which statement about cell membrane is incorrect?

A. Proteins are embedded in lipid bilayer

B. Cholesterol molecules are present in hydrophobic core

C. Central core is hydrophobic

D. Carbohydrates are present on both inner and outer face of the membrane

24 / 100

Category: Biology Ch 4 Class 11

Which among the following sentence is not correct about the organelles?

NUMS 2019 Reconduct
Biology
Cell Structure and Function
Elimination Tool:

A) They are found in all Eukaryotic cells.

B) They are only found in multicellular organisms.

C) They coordinate to produce the cell.

D) They are small sized and mostly internal.

25 / 100

Category: Biology Ch 8 Class 11

Fungi whose growth is favored by fire is called:

NTS 2016 SMBBMC
Biology
Kingdom Fungi
Elimination Tool:

A) Pyrophilus

B) Prophilus

C) Philus

D) Prephylus

26 / 100

Category: Biology Ch 4 Class 11

Magnifying power of electron microscope as compared to eye is

500 X

250000X

500000X

250X

27 / 100

Category: Biology Ch 13 Class 11

As pH of blood decreases, H+ ions increases, which combine the proteins part of hemoglobin, to decrease its ability to bind with:

NUMS 2017
Biology
Gaseous Exchange
Elimination Tool:

A) O2

B) CO2

C) CO

D) H2

28 / 100

Category: Biology Ch 10 Class 12

Modification in the organization of the basic pentadactyl limb structure found in vertebrates provides good evidence for the principle of:

NUMS 2020
Biology
Evolution
Elimination Tool:

A) Adaptive radiation

B) Convergent evolution

C) Genetic drift

D) Inheritance of acquired characters

29 / 100

Category: Biology Ch 2 Class 11

he molecule used by most of the animals for long-term energy storage is:

NUMS 2016
Biology
Biological Molecules
Elimination Tool:

A) Glycogen

B) Starch

C) Fat

D) Cholesterol

30 / 100

Category: Biology Ch 3 Class 11

If the concentration of enzyme is kept constant and amount of substrate is increased a point is reached where increase in substrates concentration does not affect the reaction rate because of

Enzymes get denatured at higher substrate conc.

Rate of reaction is indirectly proportional to substrate concentration at this point.

All the active sites on enzyme molecule are occupied.

None of these.

31 / 100

Category: Biology

Q.61 Which of the following is a compensation point?

B. Photosynthesis and respiration occur at same rate. So there is not net exchange of gases between atmosphere and plants

C. Rate of photosynthesis increases, so do the O2 production, with a net release oxygen coupled with the uptake of CO2

D. Rate of respiration becomes more than rate of photosynthesis. 16 Net yield of H-O in Photosynthesis is

32 / 100

Category: Biology Ch 1 Class 12

Which organ is called the body thermostat?

NUMS 2020
Biology
Homeostasis
Elimination Tool:

A) Pituitary gland

B) Kidneys

C) Hypothalamus

D) Adrenal gland

33 / 100

Category: Biology Ch 7 Class 12

Meiosis occurs at the time of

Gamete formation in animals

Spore formattion in plants

Growth in animals

Both a and b

34 / 100

Category: Biology Ch 9 Class 11

The part of sporophyte which is called sporangium is

Capsule

Foot

Stalk

None of these

35 / 100

Category: Biology

5 different amino acids, numbered 1, 2, 3, 4, and 5, below from the following sequence in the path of a polypeptide chain:

1-2-3-4-2-5-3

Messenger RNA codon, which correspond to the amino acids, are:
amino acid 1 UGU

amino acid 2 GAU

amino acid 3 CAC

amino acid 4 UAG

amino acid 5 AAG

Which one of the following DNA bases sequences could provide the code for the given section of the polypeptide?

NUMS Mock 2
Biology
Biological Molecules

A) ACACTTGTGATGCTATTCGTG

B) ACACUAGUGAUGCUAUUCGUG

C) ACACTAGTGATGCTAAACGTG

D) ACACTAGTGATCCTATTCGTG

36 / 100

Category: Biology

The ability of an individual to pass on its phenotype to future generations is known as:

NUMS Mock 1
Biology
Variation and Genetics

A) Fitness

B) Heritability

C) Limited environmental resources

D) Overproduction of offspring

37 / 100

Category: Biology Ch 8 Class 11

The Kingdom of recyclers is known as kingdom

Algae

Bacteria

Fungi

Embryophata

38 / 100

Category: Biology Ch 2 Class 11

Which of the following processes is the reverse of condensation?

NTS 2016 SMBBMC
Biology
Biological Molecules
Elimination Tool:

A) Hydrolysis

B) Dehydration synthesis

C) Polymerization

D) Vapourization

39 / 100

Category: Biology Ch 8 Class 11

Foliose lichen are

Stem like

Branching

Leaf like

Crust like

40 / 100

Category: Biology Ch 1 Class 11

Sythetic insulin from pork was formed by which technique:

Parasitology

Social biological techniques

Both a and c

41 / 100

Category: Biology Ch 7 Class 11

Radiolarians belong to which of the following protozoal group?

Zooflagellates

Actinopods

Foraminifera

Apicomplexans

42 / 100

Category: Biology Ch 11 Class 12

Which statement is true?

Producers are heterotrophic organisms

Consumers are autotrophic organisms

Fungi and bacteria are decomposers

Consumers release chemical elements as ions

43 / 100

Category: Biology Ch 2 Class 12

Growth movement caused in response to gravitational stimulus is called:

NTS 2011
Biology
Support and Movement
Elimination Tool:

A) Nutation

B) Geotropism

C) Nastic movement

D) Tropic movement

44 / 100

Category: Biology Ch 6 Class 12

An individual has an additional sex chromosome. Which syndrome does he have?

NUMS 2014
Biology
Chromosomes and DNA
Elimination Tool:

A) Down's syndrome

B) Turner's syndrome

C) Jacob's syndrome

D) Klinefelter's syndrome

45 / 100

Category: Biology Ch 9 Class 11

Which of the following statement about alternation of generation in bryophytes is incorrect?

It involves alternation of morphologically different generations

Their gametophyte is independent while sporophyte depends upon gametophyte for nutrition.

Both the gametophyte and sporophytes are haploid generations thus can produce haploids gametes to continue the diploid number on fertilization

pore formation occurs through meiosis

46 / 100

Category: Biology Ch 7 Class 11

Which of the following statement is incorrect about algae?

Their zygote unlike plants is protected by parental tissue.

Their classification is based on pigment composition.

Most of them have different morphological forms in-different stages of their life cycle.

Almost all of them are aquatic.

47 / 100

Category: Biology Ch 10 Class 11

Which one of the following does not have intermediate host?

NUMS 2016
Biology
Kingdom Animalia
Elimination Tool:

A) Tapeworm

C) Liver fluke

B) Ascaris

D) Plasmodium

48 / 100

Category: Biology Ch 8 Class 11

Tetracycline and penicillins are:

NUMS 2018
Biology
Kingdom Fungi
Elimination Tool:

A) Disinfectants

B) Antibiotics

C) Antiseptics

D) Antigens

49 / 100

Category: Biology Ch 1 Class 12

Which of the following marine fishes are considered direct descendents of fresh water ancestors?

Hagfish

Jelly Fish

Star Fish

Bony fishes

50 / 100

Category: Biology Ch 1 Class 12

When the temperature of the surrounding environment rises, body responds by:

PMC 2020
Biology
Homeostasis
Elimination Tool:

A) Vasoconstriction

B) Vasodilation

C) Shivering

D) Raising body hairs

51 / 100

Category: Biology Ch 12 Class 12

Ecosystem of Shogran is

Coniferous alpine

Boreal

temperate deciduous

Grassland

52 / 100

Category: Biology Ch 1 Class 12

Most of the marine invertebrates are

Osmoconformers

Osmoregulators

Both depend upon the concentration of sea water

None of these

53 / 100

Category: Biology Ch 1 Class 11

Which one is a micromolecule?

Polysaccharide

Protein

Hemoglobin

ATP

54 / 100

Category: Biology Ch 9 Class 11

Of the following which one is most advanced ?

Anthoceropsida

Bryopsida

Hepaticopsida

None of these

55 / 100

Category: Biology

Phenylketonuria is

NUMS Mock 2
Biology
Chromosomes and DNA

A) Sex linked dominant trait

B) Sex linked recessive trait

C) Autosomal dominant trait

D) Autosomal recessive trait

56 / 100

Category: Biology Ch 7 Class 11

Stentor is a/an

Ciliate

Foraniniferan

Actinopods

Apicomplexan

57 / 100

Category: Biology Ch 5 Class 11

There are 3 stages of HIV infection, which sequence is correct

PMC Sample 1
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) AIDS, Chronic HIV, Acute HIV

B) Chronic HIV, AIDS, Acute HIV

C) Acute HIV, Chronic HIV, AIDS

D) all of them

58 / 100

Category: Biology Ch 2 Class 11

Lecithin is formed by combining phosphatidic acid with ______:

NUMS 2020
Biology
Biological Molecules
Elimination Tool:

A) Serine

B) Choline

C) Inositol

D) Ethanolamine

59 / 100

Category: Biology Ch 4 Class 11

Which of the following statement(s) is/are correct regarding a nucleus?

I.Stores wastes and other Substances

II.Contains genetic material

III.Helps in cellular transport system

IV.Control centre of the cell

NTS 2017
Biology
Cell Structure and Function
Elimination Tool:

A) I only

B) I&II

C) II & III

D) II & IV

60 / 100

Category: Biology

This theory says that “mitochondria and chloroplasts are, in effect, ancient bacteria which now live inside the larger cells”:

NUMS Mock 2
Biology
Evolution

A) Darwin’s theory of evolution

B) Lamarckism

C) Neo – darwinism

D) Endosymbiont theory

61 / 100

Category: Biology Ch 13 Class 11

The most important cause of many of the respiratory disorders is:

NUMS 2019 Cancelled
Biology
Gaseous Exchange
Elimination Tool:

A) Bacterial infection

B) Pollution

C) Smoking

D) Drinking

62 / 100

Category: Biology

Q.67 The animals which belong to division Radiata is/are?

A. Triploblastic

B. Diploblastic

C. Radio blast

D. All of these

63 / 100

Category: Biology Ch 9 Class 11

Which characteristic led to the evolution of seed?

NUMS 2020
Biology
Kingdom Plantae
Elimination Tool:

A) Heterogamous condition

B) Development of heterospory

C) Embryo formation

D) Protection of reproductive cells

64 / 100

Category: Biology Ch 6 Class 12

The length of okazaki fragments in eukayotes is

150–250 nucleotides long

200-300 nucleotides

1000-2000 nucleotde

100-200 nucleotides

65 / 100

Category: Biology

Q.2 Competitive inhibition can be overcome by using

A. Low concentration of substrate

B. High concentration of inhibitor

C. Moderate concentration of inhibitor

D. High concentration of substrate

66 / 100

Category: Biology Ch 1 Class 11

The concept that various organisms dominated this planet during various geological time period and thus placing organisms in a time squence came from the studies by

Environmental biologist

Paleontologist

Marine biologist

Social biologist

67 / 100

Category: Biology Ch 5 Class 11

Closely related species are grouped together into ______ .

NTS 2012
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) families

B) orders

C) phyla

E) genus

68 / 100

Category: Biology

How many ml of blood is pumped by each contraction of the heart?

NUMS Mock 1
Biology
Transport

A) 80 ml

B) 90 ml

C) 70 ml

D) 60 ml

69 / 100

Category: Biology Ch 8 Class 12

Red green colour blindness is a sex linked recessive trait. If a colour blind man marries a woman with normal vision whose father is colourblind and they have a daughter, what is the probability that she will be colourblind?

NTS 2015 SMBBMC
Biology
Variation and Genetics
Elimination Tool:

A) 0

B) 0.25

C) 0.50

D) 0.75

70 / 100

Category: Biology Ch 7 Class 12

Reverse of prophase is

Interphase

Metaphase

Anaphase

Telophase

71 / 100

Category: Biology Ch 7 Class 12

The term bivalent means:

NUMS 2014
Biology
Cell Cycle
Elimination Tool:

A) Two chromatids

B) Two chromosomes

C) Four chromatids

D) Four chromosomes

72 / 100

Category: Biology Ch 5 Class 12

The reason plants are considered totipotent is:

NUMS 2019 Cancelled
Biology
Growth and Development
Elimination Tool:

A) Each cell has full genetic potential of the organism

B) A single cell could become a complete plant

C) Because they have lesser potential for tissue culturing

D) Both each cell has full genetic potential of the organism and a single cell could become a complete plant

73 / 100

Category: Biology Ch 10 Class 12

Natural selection can amplify or diminish variations that are

Non heritable

Heritable

Both heritable and non heritable

Acquired

74 / 100

Category: Biology Ch 6 Class 12

Diameter of DNA double helix is:

NUMS 2015
Biology
Chromosomes and DNA
Elimination Tool:

A) 3.4 nm

B) 0.3 nm

D) 0.2 nm

C) 2 nm

75 / 100

Category: Biology Ch 5 Class 11

Solanum tuberosum is a scientific name of:

Onion

Amaltas

Potato

Tomato

76 / 100

Category: Biology Ch 12 Class 11

Which of the following have both internal and external digestion?

NUMS 2016
Biology
Nutrition
Elimination Tool:

A) Hydra

B) Jelly fish

C) Cockroach

D) All of these

77 / 100

Category: Biology Ch 6 Class 12

Which of the following can be blocked, if one wants to stop translation of mRNA?

NUMS 2019 Reconduct
Biology
Chromosomes and DNA
Elimination Tool:

A) RNA polymerase

B) Helicase

C) Elongation factor

D) Primase

78 / 100

Category: Biology Ch 1 Class 12

Which part of the brain regulates body temperature?

NTS 2016 SMBBMC
Biology
Homeostasis
Elimination Tool:

A) Cerebellum

B) Cerebrum

C) Hypothalamus

D) Medulla

79 / 100

Category: Biology Ch 7 Class 11

Identify the correctly matched pair relating to a term and its meaning/function/example:

NTS 2017
Biology
Kingdom Protista
Elimination Tool:

A) nitrogen cycle… Rhizopus

B) denitrifying bacteria..change protein to ammonia

C) biosphere.. where life exists

D) lithosphere…water,air and soil.on the surface of earth

80 / 100

Category: Biology Ch 6 Class 12

In Maxam – Gilbert method, DNA threads are:

NUMS 2015
Biology
Chromosomes and DNA
Elimination Tool:

A) Chemically synthesized

B) Synthesized from mRNA

C) Synthesized by using terminating nucleotides

D) Chemically cut into pieces

81 / 100

Category: Biology Ch 2 Class 11

Steroids consist of _____ 6 membered carbon rings and one 5 membered carbon ring.

NTS 2012
Biology
Biological Molecules
Elimination Tool:

A) Four

B) Three

C) Two

D) Five

82 / 100

Category: Biology Ch 10 Class 12

Analogous organs show:

NUMS 2020
Biology
Evolution
Elimination Tool:

A) Straight evolution

B) Convergent evolution

C) Zig-zag evolution

D) Divergent evolution

83 / 100

Category: Biology Ch 7 Class 12

Interphase is a phase of the cell cycle defined only by the absence of _______.

NTS 2019
Biology
Cell Cycle
Elimination Tool:

A) Enzymes

B) DNA

C) Replication

D) Cell division

84 / 100

Category: Biology Ch 6 Class 12

In a typical nucleotide, the nitrogenous base is attached to _______ carbon of pentose sugar.

NTS 2010
Biology
Chromosomes and DNA
Elimination Tool:

B) 5th

C) 4th

D) 3rd

E) 1st

85 / 100

Category: Biology Ch 7 Class 11

Which part of bacteria is most delicate and damage to it can kill the bacteria?

PMC 2021 Tested
Biology
Kingdom Protista
Elimination Tool:

A) Cell wall

B) Slime

C) Capsule

D) Cell membrane

86 / 100

Category: Biology Ch 12 Class 12

In which zone plant community is most diverse

Limnetic zone

Littoral zon

Profundal zone

All of these

87 / 100

Category: Biology Ch 7 Class 12

Which statement is not true about phragmoplast?

Formed from vesicle originating from Golgi apparatus

Present in plants only

Formed at the end of anaphase

Centre of dividing cell

88 / 100

Category: Biology Ch 1 Class 12

The mechanism of regulation, generally between organism and its environment, of solutes and the gain and the loss of water is called

Homeostasis

Hemostasis

Osmoregualtion

Thermoregulation

89 / 100

Category: Biology

What is the effect of enzyme DNA ligase?

NUMS Mock 2
Biology
Chromosomes and DNA

A) DNA is broken up at specific sites

B) DNA fragments are joined together

C) DNA replication occurs

D) DNA transcription occurs

90 / 100

Category: Biology Ch 3 Class 12

Normal resting membrane potential of a neuron is

50 mv

60 mv

70 mv

80 mv

91 / 100

Category: Biology Ch 7 Class 12

During the G2 phase:

UHS 2019
Biology
Cell Cycle
Elimination Tool:

A) Chromosome number is duplicated

B) The chromosomes are left with only one chromatid

C) Energy is stored for Chromosome movement and mitotic specific proteins(Tubulin) are produced

D) Specific enzymes are synthesized and DNA base units are accumulated

92 / 100

Category: Biology Ch 9 Class 11

The term which is not related to the process of evolution of leaf is:

NUMS 2020
Biology
Kingdom Plantae
Elimination Tool:

A) Overtopping

B) Planation

C) Heterospory

D) Fusion / webbing

93 / 100

Category: Biology Ch 5 Class 12

Human embryo remains enclosed in:

PMC Practice 1
Biology
Growth and Development
Elimination Tool:

A) Amniotic sac

B) Placenta

C) Chorion

D) Allantois

94 / 100

Category: Biology Ch 7 Class 11

Which of the following statements is correct?

NUMS 2017
Biology
Kingdom Protista
Elimination Tool:

A) Viruses have their own ribosomes for protein formation

B) New viral ribosomes are formed after viral DNA enters the cell

C) Viruses do not need ribosomes for protein formation

D) Viruses use the host ribosomes for their own requirements

95 / 100

Category: Biology Ch 6 Class 12

A fern has _____ pairs of chromosomes.

NTS 2012
Biology
Chromosomes and DNA
Elimination Tool:

A) 23

B) 40

C) 500

D) 13

96 / 100

Category: Biology Ch 8 Class 11

Those fungi which can grow only on their living host and cannot be grown on available defined growth culture medium e.g. various mildews and most rust species are called

Parasitic fungi

Obligate parasitic fungi

Facultative parasitic fungi

All of these

97 / 100

Category: Biology Ch 6 Class 12

DNA contains

Purines (A and G) pyrimidines (U and (c)

Purines (T and (c) pyrimidines (A and G)

Purines (A and (c) pyrimidines (U and G)

Purines (A and G) pyrimidines (T and (c)

98 / 100

Category: Biology Ch 2 Class 11

Peptide bonds are formed between:

NUMS 2014
Biology
Biological Molecules
Elimination Tool:

A) Hydrogen groups of adjacent amino acids

B) Non-functional groups of the amino acids

C) Carboxyl groups and amino groups

D) Functional groups and hydrogen groups of adjacent amino acids

99 / 100

Category: Biology Ch 7 Class 12

Diplotene is the sub-stage of:

NTS 2011
Biology
Cell Cycle
Elimination Tool:

A) Anaphase

B) Telephase I

C) Prophase I

D) Metaphase

100 / 100

Category: Biology Ch 13 Class 11

Nicotine in tobacco:

NUMS 2014
Biology
Gaseous Exchange
Elimination Tool:

A) Decreases the heart rate

B) Decreases the blood pressure

C) Block the transport or oxygen

D) Paralyzes cells

Your score is

The average score is 52%

Structured Practice for Best Entry Test Preparation

This topic-wise and chapter-wise practice test allows students to focus on individual biology concepts, including diagrams, processes, and conceptual questions. Regular practice enhances understanding, sharpens problem-solving skills, and builds confidence to tackle both board and competitive exam questions efficiently.

Free Resources for Best Entry Test Preparation

Students can access free Biology Practice Test 1 to systematically improve knowledge, recall, and problem-solving abilities. This test is suitable for FSC Board Exams as well as major entry tests, helping students perform better in the biology section. PLS Academy provides these resources to support students in their preparation.

JazakAllah

Comments

3 responses to “Biology Practice Test 1”

Anonymous

September 30, 2022

Hello sr thanks for your service
But there are some MCQ Wich are out of the PMC slabus in this test
But the test was very useful to me thanks
wajiha

October 5, 2022

Q:27 problem
Anonymous

October 13, 2022

AOA sir
Here in the test there are many mcqs that are not included in Nums r Pmc syllabus
Kindly check it out
Thanks
But it’s very helpful
Thanks