Biology Practice Test 1

Biology Practice Test 1 is designed to help students strengthen their understanding of key biological concepts, theories, and processes for competitive entry tests like MDCAT, NUMS, AKU, UET, ECAT, NTS, as well as FSC Board Exams. This test covers topics from cell biology, genetics, physiology, ecology, evolution, and more, helping students improve accuracy and retention.

PLS Academy

Get Access to 20 thousands+ MCQs Including Topical MCQs, Practice Tests, Mock Tests, Solved Past Papers, Flashcards, Notes, FLPS, and Much More.

UNLOCK PREMIUM🔐

8080

Created by Ali Durrani

MDCAT Practice Tests

Biology Practice Test 1

This is the Free Access to Limited MCQs. Enroll to PLS Boost Premium Bundle to Get More MCQs HERE

1 / 100

Category: Biology

Q.50 How does each photoexcited electron pass from PS1 to PS2?

A. ETC

B. chemiosmosis

C. photolysis

D. photosynthesis

2 / 100

Category: Biology Ch 3 Class 12

Chlorosis, i.e., yellowish hue on the leaves results from

Accumulation of toxic waste products in leaves.

Deficiency of chlorophyll.

Short supplies of mineral nutrients in the soil

All of these

3 / 100

Category: Biology

On receiving the news of the sudden demise of a close friend; which is the most probable hormone that is secreted at that time?

NUMS Mock 1
Biology
Coordination and Control

A) Prostaglandin

B) Growth inhibitors

C) Estrogen

D) Adrenaline

4 / 100

Category: Biology Ch 8 Class 12

Haemophilia occurs because of:

PMC 2020
Biology
Variation and Genetics
Elimination Tool:

A) Mutation in an autosome

B) Mutation of Y-chromosome

C) Mutation of X-chromosome

D) Deficiency of iron

5 / 100

Category: Biology Ch 11 Class 11

The inner membrane of mitochondrion has many infoldings into the inner chamber, these folding are called as:

NUMS 2019 Reconduct
Biology
Bioenergetics
Elimination Tool:

A) Cristae

B) Cisternae

C) Matrix

D) F1 particles

6 / 100

Category: Biology Ch 3 Class 11

A/An _______ is mostly a non-protein chemical compound that is required for the protein’s biological activity.

NTS 2019
Biology
Enzymes
Elimination Tool:

A) Active site

B) Substrate

C) Cofactor

D) Enzyme

7 / 100

Category: Biology Ch 11 Class 11

Many substances which are urgently required by the cell while cell absorbs them against the concentration gradient by utilizing energy in the form of:

NUMS 2019 Reconduct
Biology
Bioenergetics
Elimination Tool:

A) ATP

B) Heat

C) GTP

D) Light

8 / 100

Category: Biology Ch 13 Class 12

The position of an organism in a food chain of an ecosystem called:

NUMS 2018
Biology
Man and His Environment
Elimination Tool:

A) Level of ecosystem

B) Food chain

C) Food web

D) Trophic level

9 / 100

Category: Biology Ch 9 Class 12

The Plasmid pBR322 has antibiotic resistance genes for:

UHS 2019
Biology
Biotechnology
Elimination Tool:

A) Streptomycin

B) Ampicillin and Tetracycline

C) Tetracycline and mxycycline

D) Ampicillin

10 / 100

Category: Biology Ch 14 Class 11

Choose the correct pathway for the flow of blood:

NUMS 2020
Biology
Transport
Elimination Tool:

A) Arterioles → metarterioles → capillaries → thoroughfare channels

B) Arterioles → thoroughfare channel → metarterioles → capillaries

C) Thoroughfare channel → arterioles → capillaries → metarterioles

D) Metarterioles → arterioles → thoroughfare channels → capillaries

11 / 100

Category: Biology Ch 14 Class 11

Fibrinogen is necessary for:

NUMS 2014
Biology
Transport
Elimination Tool:

A) Metabolism

B) Respiration

C) Reproduction

D) Clotting

12 / 100

Category: Biology

When the concentration of the external medium is equal to the concentration of the internal medium of a cell, the situation is called:

NUMS Mock 1
Biology
Biological Molecules

A) Hypertonic

B) Hypotonic

C) Isotonic

D) Heterotonic

13 / 100

Category: Biology Ch 6 Class 12

Chromosomes are composed of

40% protein and 60% DNA

50% protein and 50% DNA

70% protein and 30% DNA

60% protein and 40% DNA

14 / 100

Category: Biology Ch 5 Class 11

Which of the following diseases is sexually transmitted?

PMC 2020
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Tuberculosis

B) AIDS

C) Dengue Fever

D) Cholera

15 / 100

Category: Biology Ch 7 Class 12

DNA is synthesized and chromosome number is doubled in

G1 phase

S phase

G2 phase

G0 phase

16 / 100

Category: Biology

Q.33 The presence of peptidoglycan in Gram positive bacteria is

A. 40% of dry weight

B. 50% of dry weight

C. 10% of dry weight

D. 80%% of dry weight

17 / 100

Category: Biology

Q.28 The enzyme which plays important role in HIV pathogenesis

A. RNA polymerase I

B. DNA polymerase II

C. Reverse Transcriptase I

D. Reverse Transcriptase

18 / 100

Category: Biology

Q.19 Of the following, which one is not included in protostomes:

A. Arthropods

B. Poriferans

C. Annelids

D. Coelenterates

19 / 100

Category: Biology Ch 1 Class 12

The site and principal mechanism for the passage of glucose into the bloodstream in the human kidney is the:

NTS 2014
Biology
Homeostasis
Elimination Tool:

A) collecting duct …. by active secretion

C) glomerulus …. by selective reabsorption

D) glomerulus …. by ultrafiltration

E) Proximal convoluted tubule …. By active reabsorption

20 / 100

Category: Biology

The Porifera are pore – bearing animals, commonly called:

NUMS Mock 3
Biology
Kingdom Animalia

A) Corals

B) Sponges

C) Hydras

D) Anemones

21 / 100

Category: Biology

Which of the following basic structural level of proteins is indicated by an association of two alpha and two beta chains in the haemoglobin molecule?

NUMS Mock 4
Biology
Biological Molecules

A) Primary structure

B) Secondary structure

C) Tertiary structure

D) Quatenary Structure

22 / 100

Category: Biology Ch 8 Class 11

Which of the following component is found in the cell wall of fungi?

UHS 2012
Biology
Kingdom Fungi
Elimination Tool:

A) Cellulose

B) Chitin

C) Proteins

D) Glycerol

23 / 100

Category: Biology

What do we call the cell surface membrane of a muscle fibre?

NUMS Mock 3
Biology
Support and Movement

A) Sarcolemma

B) Plasma membrane

C) Sarcoplasm

D) Myofibrils

24 / 100

Category: Biology Ch 2 Class 11

5 different amino acids, numbered 1, 2, 3, 4, and 5, below from the following sequence in the path of a polypeptide chain:

1-2-3-4-2-5-3

Messenger RNA codon, which correspond to the amino acids, are:
amino acid 1 UGU

amino acid 2 GAU

amino acid 3 CAC

amino acid 4 UAG

amino acid 5 AAG

Which one of the following DNA bases sequences could provide the code for the given section of the polypeptide?

NTS 2015 DUHS and JSMU
Biology
Biological Molecules
Elimination Tool:

A) ACACTTGTGATGCTATTCGTG

B) ACACUAGUGAUGCUAUUCGUG

C) ACACTAGTGATGCTAAACGTG

D) ACACTAGTGATCCTATTCGTG

25 / 100

Category: Biology Ch 11 Class 11

Dark reaction of photosynthesis takes place in _______ of chloroplast.

NUMS 2020
Biology
Bioenergetics
Elimination Tool:

A) Thylakoids

B) Grana

C) Intergrana

D) Stroma

26 / 100

Category: Biology Ch 7 Class 12

A special area of centromere with specific base arrangement and specific proteins where spindle fibers are attached is called

Chromatin

Aster

Kinetochore

Primary constriction

27 / 100

Category: Biology

Q.56 Which of the following movements are possible in pivot joint?

A. Flexion and extension

B. Adduction and abduction

C. Rotation

D. Extension flexion and rotation

28 / 100

Category: Biology Ch 5 Class 11

Viruses resemble living things because they:

NTS 2017
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Circulate

B) Move

C) Reproduce

D) Are crystalline

29 / 100

Category: Biology Ch 14 Class 11

The lymph vessels empty in:

NUMS 2015
Biology
Transport
Elimination Tool:

A) Arteries

B) Veins

C) Capillaries

D) None of the given options

30 / 100

Category: Biology Ch 10 Class 11

Archaeopteryx is a connecting link between:

NUMS 2014
Biology
Kingdom Animalia
Elimination Tool:

A) Amphibians and reptiles

B) Reptiles and birds

C) Birds and mammals

D) None of these

31 / 100

Category: Biology Ch 7 Class 11

Bacteria that live in intestine and produce vitamin K belong to?

PMC 2021 Tested
Biology
Kingdom Protista
Elimination Tool:

A) Vibrio

B) Cocci

C) Spirilla

D) Bacilli

32 / 100

Category: Biology Ch 3 Class 11

Restriction endonucleases

PMC Sample 2
Biology
Enzymes
Elimination Tool:

A) are bacterial enzyme

B) convert RNA to DNA

C) hydrolyze protein into amino acids

D) get mutated for DNA repair

33 / 100

Category: Biology Ch 5 Class 12

In multicellular plants cell division occur by

Binary fission

Conjugation

Meiosis

Mitosis

34 / 100

Category: Biology Ch 3 Class 12

Which brain portion is responsible for controlling body coordination?

NUMS 2020
Biology
Coordination and Control
Elimination Tool:

A) Medulla

B) Amygdala

C) Cerebellum

D) Pons

35 / 100

Category: Biology Ch 9 Class 11

Which characteristic led to the evolution of seed?

NUMS 2020
Biology
Kingdom Plantae
Elimination Tool:

A) Heterogamous condition

B) Development of heterospory

C) Embryo formation

D) Protection of reproductive cells

36 / 100

Category: Biology Ch 2 Class 12

Exoskeleton of a marine snail is composed of

CaPO4

CaCO3

CaSO4

SiO2

37 / 100

Category: Biology

In the human cell, ______ is responsible for producing hydrogen peroxide.

NUMS Mock 2
Biology
Cell Structure and Function

A) Lysosomes

B) Mitochondria

C) Peroxisomes

D) Glyoxysomes

38 / 100

Category: Biology Ch 10 Class 12

Which of the following scientists contributed a lot to “modern synthetic theory of organic evolution:

NUMS 2014
Biology
Evolution
Elimination Tool:

A) Theodosius Dobzhansky 1937

B) Fischer 1958

C) Wright 1968

D) All of above

39 / 100

Category: Biology

Which of the following enzymes is used to join DNA fragments?

NUMS Mock 4
Biology
Chromosomes and DNA

A) DNA polymerase

B) Ligase

C) Primase

D) Endonuclease

40 / 100

Category: Biology

Q.41 The period during which a girl sexually matures is called

A. Menstrual cycle

B. Puberty

C. Childhood

D. Teens

41 / 100

Category: Biology

The prolactin hormone, responsible for the activation of mammary glands to start producing milk, is a hormone of the:

NUMS Mock 3
Biology
Coordination and Control

A) Pituitary gland

B) Pancreas

C) Thyroid gland

D) Thymus gland

42 / 100

Category: Biology Ch 7 Class 11

_______ infection is caused by a viroid:

NUMS 2020
Biology
Kingdom Protista
Elimination Tool:

A) Hepatitis A

B) Hepatitis D

D) Mysterious brain infection

C) Mad Cow disease

43 / 100

Category: Biology Ch 3 Class 12

The phytohormones controlling the plant movements are?

NTS 2015 SMBBMC
Biology
Coordination and Control
Elimination Tool:

A) Auxins

B) Gibberellins

C) Abscisic acid

D) Cytokinins

E) All of the above

44 / 100

Category: Biology Ch 6 Class 11

Rod-shaped bacteria are known as:

NUMS 2017
Biology
Kingdom Prokaryote
Elimination Tool:

A) Cocci

B) Bacilli

C) Spirilla

D) None of these

45 / 100

Category: Biology Ch 13 Class 11

A disease caused by gradual breakdown of the thin walls of alveoli is;

UHS 2019
Biology
Gaseous Exchange
Elimination Tool:

A) Tuberculosis

B) Asthma

C) Emphysema

D) Bronchitis

46 / 100

Category: Biology Ch 10 Class 12

A group of populations that have the potential to interbreed in nature is

Genus

Family

Species

Community

47 / 100

Category: Biology Ch 12 Class 11

Certain types of whales are also ______ feeder.

Fluid

Macrophagous

Filter

None of these

48 / 100

Category: Biology Ch 4 Class 12

Which statement is incorrect?

Climacteric is burst of respiratory activity in fruit ripening

It is associated with ethane production C

It helps in fruit set

It helps in fruit ripening

49 / 100

Category: Biology Ch 4 Class 11

Percentage of proteins in cell membrane is

20-40%

40-50%

60-80%

80-100%

50 / 100

Category: Biology Ch 3 Class 11

A cofactor made of inorganic ion which is detachable is called

Prosthetic group

Coenzyme

Activator

Cofactor

51 / 100

Category: Biology Ch 6 Class 11

Which of the following bacteria are thick rigid and spiral?

Vibrio

Spirillum

Spirochete

Coccus

52 / 100

Category: Biology Ch 7 Class 12

Spread of tumor cells and establishment of secondary areas of growth is

Benign tumors

Cancer

Metastasis

Epistasis

53 / 100

Category: Biology Ch 12 Class 11

Carotenoids are related to:

NUMS 2015
Biology
Nutrition
Elimination Tool:

A) Vitamin A

B) Vitamin B

C) Vitamin C

D) Vitamin D

54 / 100

Category: Biology Ch 13 Class 11

During breathing air from Pharynx enters to:

UHS 2018
Biology
Gaseous Exchange
Elimination Tool:

A) Trachea

B) Bronchioles

C) Alveoli

D) Bronchi

55 / 100

Category: Biology

The structure of a fibrous protein comprises of polypeptide chains in the form of:

NUMS Mock 2
Biology
Biological Molecules

A) Cluster

B) Spherical or curried up ball

C) Long strands or fibrils

D) Flat uncoiled chains

56 / 100

Category: Biology Ch 13 Class 11

Lungs are covered with double layered thin membranous sac called

Disphragm

Pleura

Pericardium

Rib cage

57 / 100

Category: Biology Ch 5 Class 11

First infectious disease against which effective method of prevention developed was a _______:

NUMS 2020
Biology
Bio-diversity | Variety of Life
Elimination Tool:

A) Bacterial disease

B) Viral disease

C) Protozoan disease

D) Viroid disease

58 / 100

Category: Biology Ch 1 Class 12

Reabsorption of calcium is triggered by:

NUMS 2019 Reconduct
Biology
Homeostasis
Elimination Tool:

A) Aldosterone

B) Parathormone

C) Antidiuretic

D) Vasopressin

59 / 100

Category: Biology Ch 10 Class 12

Carolus Linnaeus was believer of

Special creation

Natural selection

Catastrophism

. Inheritance of acquired characters

60 / 100

Category: Biology Ch 1 Class 12

Purine and pyrimidine catabolism results in production of

Creatinine

Trimethyamine oxide

Xanthine

None of these

61 / 100

Category: Biology

The thickest chamber of the human heart is:

NUMS Mock 4
Biology
Transport

A) Left atrium

B) Right atrium

C) Right ventricle

D) Left ventricle

62 / 100

Category: Biology

Q3 Assymetrical body is a feature of phylum

A. Annelida

B. Arthropoda

C. Porifera

D. Cnidaria

63 / 100

Category: Biology Ch 10 Class 11

Which one of the following is a fish?

NTS 2012
Biology
Kingdom Animalia
Elimination Tool:

A) Flying fish

B) Salmon

C) Sea horse

D) All of the above

64 / 100

Category: Biology Ch 8 Class 12

Which of the following characters of pea plant is dominant?

Axial flowers

Yellow pods

White flowers

Wrinkled seeds

65 / 100

Category: Biology Ch 10 Class 12

Which statement is incorrect?

Homologous organs are functionally different but structurally alike

Analogous organs are functionally different but structurally alike

Examples of homologous structures are arms of man, forelimb of cat, flipper of whale

Examples of analogous structures are wings of bats, birds and insects

66 / 100

Category: Biology Ch 12 Class 11

Nodules on roots of leguminous plants have _____ bacteria

Anaerobic

Nitrogen fixing

Nitrifying

Ammonifying

67 / 100

Category: Biology Ch 4 Class 11

Which of the following is not a basic unit of the cell?

NUMS 2016
Biology
Cell Structure and Function
Elimination Tool:

A) Cell wall

B) Cell membrane

C) Nucleus

D) Ribosome

68 / 100

Category: Biology Ch 8 Class 12

Read the passage below to answer the question:

Hemophilia is a disorder in which blood fails to clot. Saad, a male hemophiliac, marries Sara, a normal woman and together they have four children, two boys (Ahmed and Ali) and two girls (Alia and Ayesha). None of the children display the symptoms of Hemophilia. Ahmed, Ali, Ayesha, and Ali all marry normal individuals and have children. None of Ahmeds or Ali’s children, male or female, display symptoms of hemophilia, but the sons of Alia and Ayesha display symptoms of hemophilia while the daughters of Alia and Ayesha do not.

Which of the following individuals are heterozygous for hemophilia:

NTS 2010
Biology
Variation and Genetics
Elimination Tool:

A) Saad, Ahmed, and Ali

B) Ahmed, Ali, Alia, and Ayesha

C) Saad and Sara

D) Alia and Ayesha

69 / 100

Category: Biology Ch 2 Class 11

Which bond provides stability to complex carbohydrate molecules?

C-H

C-O

C-C

C-N

70 / 100

Category: Biology Ch 4 Class 12

Which statement is correct?

In heteromorphic generations are vegetatively dissimilar

. In isomorphic generations are vegetatively dissimilar

In isomorphic generations are vegetatively similar

Both a and c

71 / 100

Category: Biology Ch 10 Class 12

The process that has transformed life on earth from its earliest forms to vast diversity is?

PMC Sample 3
Biology
Evolution
Elimination Tool:

A) mutation

B) evolution

C) migration

D) genetic drift

72 / 100

Category: Biology

Q.44 When calcium gates of the smooth endoplasmic reticulum are open, then calcium is released into:

A. Cytosol

B. Organelle lumen

C. Nucleoplasm

D. Directly taken up by myofilament

73 / 100

Category: Biology Ch 5 Class 12

Higher plants grow through

Growing points

Whole plant body is capable of growing

Only roots grow

None of these

74 / 100

Category: Biology

In which of the following growth phases, the number of bacteria increases the most rapidly?

NUMS Mock 4
Biology
Kingdom Protista

A) Lag phase

B) Log phase

C) Stationary phase

D) Death / Decline phase

75 / 100

Category: Biology Ch 3 Class 12

The prolactin hormone, responsible for the activation of mammary glands to start producing milk, is a hormone of the:

NTS 2010
Biology
Coordination and Control
Elimination Tool:

A) Pituitary gland

B) Pancreas

C) Thyroid gland

D) Thymus gland

76 / 100

Category: Biology

Q.46 The path of electrons through the two photosystems is called?

A. S scheme

B.X scheme

C.Z Scheme

D. Y scheme

77 / 100

Category: Biology Ch 2 Class 12

Movement of the Hip joint is which type of synovial joints?

NUMS 2018
Biology
Support and Movement
Elimination Tool:

A) Gliding joint

B) Ball and socket joint

D) Hinge joint

C) Pivot joints

78 / 100

Category: Biology Ch 5 Class 12

The most abundant organic molecule on the planet earth is:

NUMS 2016
Biology
Growth and Development
Elimination Tool:

A) Starch

B) Glycogen

C) Glucose

D) Cellulose

79 / 100

Category: Biology

Q3 These animals show radial symmetry.

A. Chordates

B. Annelids

C. Cnidarian

D Round worms

80 / 100

Category: Biology Ch 9 Class 11

Of the following which one is most advanced ?

Anthoceropsida

Bryopsida

Hepaticopsida

None of these

81 / 100

Category: Biology Ch 6 Class 11

A Dutch scientist firstly observed very small creatures in

PMC Practice 6
Biology
Kingdom Prokaryote
Elimination Tool:

A) Vinegar

B) Saliva

C) Rain water

D) All of Above

82 / 100

Category: Biology Ch 7 Class 11

Which of the following statement is incorrect about algae?

Their zygote unlike plants is protected by parental tissue.

Their classification is based on pigment composition.

Most of them have different morphological forms in-different stages of their life cycle.

Almost all of them are aquatic.

83 / 100

Category: Biology

Q.64 According to the induced fit model. What happens when an enzyme-substrate omplex is formed?

A. The contact between the substrate and the enzyme causes a change in the shape of the active site

B. The shape of the substrate and the shape of the active site are complementary to each other.

C. The substrate fits into active site and forms bonds with the amino acids at the active site.

D. All of the above.

84 / 100

Category: Biology Ch 6 Class 12

Mutations can occur in:

NUMS 2016
Biology
Chromosomes and DNA
Elimination Tool:

A) DNA

B) Protein

C) RNA

D) A and C

85 / 100

Category: Biology Ch 10 Class 11

Of the following which one is non-cellular in most cases in animals?

Mesenchyme

Sclerenchyma

Chlorenchyma

Mesoderm

86 / 100

Category: Biology

Which of the following will not undergo aldol condensation?

NUMS Mock 2
Chemistry
Aldehydes and Ketones

A) Acetaldehyde

B) Propanaldehyde

C) Benzaldehyde

D) Trideuteroacetaldehyde

87 / 100

Category: Biology Ch 2 Class 12

Pick the mismatched pair for birds:

NUMS 2015
Biology
Support and Movement
Elimination Tool:

A) Air spaces – lighter body

B) Pectoral muscles – strong pull of wings

C) Urinary bladder – producing semisolid urine

D) Keel – attachment of muscles

88 / 100

Category: Biology Ch 8 Class 11

In rhizopus, zygote forms temporary, dormant, thick-walled resistant structure called:

UHS 2015
Biology
Kingdom Fungi
Elimination Tool:

A) Zygospore

B) Spore

D) Hydra

C) Sporangia

89 / 100

Category: Biology

Q.25 For respiratory metabolism, bacterial cell membrane contains

A. Proteins

B. Lipids

C.Enzymes

D. Chemicals

90 / 100

Category: Biology Ch 10 Class 11

Which of the following phylum and its examples is NOT correct?

NUMS 2017
Biology
Kingdom Animalia
Elimination Tool:

A) Nematoda… Ascaris and hookworm

B) Annelid … Nereis and leech

C) Echinodermata … sea star and brittle star

E) Cnidaria … Euplectell and bath sponge

91 / 100

Category: Biology Ch 9 Class 11

The scientific name of potato is Solanum tuberosum and that of brinjal is Solanum melongena. This indicates that both potato and brinjal are members of the

NTS 2014
Biology
Kingdom Plantae
Elimination Tool:

A) Same species but different genera

B) Same genus but different classes

C) Same species but different classes

D) Same genus but different species

92 / 100

Category: Biology Ch 12 Class 12

Weather refers to

Short-term fluctuations in temperature, cloud cover, wind and precipitation

It prevails over periods of hrs or days

Overall patterns of weather that prevail from year to year

. Both a and b

93 / 100

Category: Biology Ch 7 Class 11

Plasmodium belongs to

Ciliates

Apicomplexans

Actinopods

Foraminferans

94 / 100

Category: Biology Ch 3 Class 11

Antibodies can be digested by using which of the following types of enzymes?

PMC Sample 3
Biology
Enzymes
Elimination Tool:

A) Lipase

B) Protease

C) Amylase

D) Polymerase

95 / 100

Category: Biology

It is the smallest eukaryote:

NUMS Mock 2
Biology
Kingdom Protista

A) Virus

B) Bacteria

C) Plasmodium

D) Sponge

96 / 100

Category: Biology Ch 4 Class 12

Which characteristic is not of identical twins

. Produced by separation of two blastomeres

Have different genetic makeup

Produced asexually

Produced when embryo is at two cell stage

97 / 100

Category: Biology

Q.38 The cell organelles involved, in some cases, with extra-cellular digestion

A. Golgi complex

B. Lysosomes

C. Peroxisomes

D. Glyoxysomes

98 / 100

Category: Biology

Process ensuring the survival of species over long periods of time, even though individual members of the species die.

NUMS Mock 2
Biology
Man and His Environment

A) Reproduction

B) Adaptability

C) Mitosis

D) Respiration

99 / 100

Category: Biology Ch 10 Class 12

Which condition can be explained by Lamarckism?

PMC Sample 1
Biology
Evolution
Elimination Tool:

A) How giraffes got their long neck

B) How humans lost their tail

C) How humans became bipedal

D) all of these

100 / 100

Category: Biology Ch 9 Class 12

Passive immunity is used against:

UHS 2015
Biology
Biotechnology
Elimination Tool:

A) Malaria

B) Typhoid

C) Dengue

D) Tetanus

Your score is

The average score is 52%

Structured Practice for Best Entry Test Preparation

This topic-wise and chapter-wise practice test allows students to focus on individual biology concepts, including diagrams, processes, and conceptual questions. Regular practice enhances understanding, sharpens problem-solving skills, and builds confidence to tackle both board and competitive exam questions efficiently.

Free Resources for Best Entry Test Preparation

Students can access free Biology Practice Test 1 to systematically improve knowledge, recall, and problem-solving abilities. This test is suitable for FSC Board Exams as well as major entry tests, helping students perform better in the biology section. PLS Academy provides these resources to support students in their preparation.

JazakAllah

Comments

3 responses to “Biology Practice Test 1”

Anonymous

September 30, 2022

Hello sr thanks for your service
But there are some MCQ Wich are out of the PMC slabus in this test
But the test was very useful to me thanks
wajiha

October 5, 2022

Q:27 problem
Anonymous

October 13, 2022

AOA sir
Here in the test there are many mcqs that are not included in Nums r Pmc syllabus
Kindly check it out
Thanks
But it’s very helpful
Thanks