Sindh DUHS MDCAT Past Paper 2015

Sindh DUHS NTS MDCAT Past Papers 2015

Sindh MDCAT Past Papers Solved (IBA Sukkur) with Answer Key

Sindh MDCAT past papers solved for IBA Sukkur with answer key are an essential tool for students preparing for medical and dental entrance exams in Sindh. These solved papers provide complete answers to past MDCAT questions, helping students understand the exam structure, question patterns, and subject-wise distribution according to the official MDCAT syllabus. Practicing these papers allows aspirants to assess their preparation, identify weak areas, and improve performance in core subjects such as Biology, Chemistry, Physics, and English.

Related: Download Solved Past Papers

Why Solved Past Papers Matter

Solving Sindh MDCAT past papers with answer key allows students to instantly verify their answers and learn the most effective techniques for tackling multiple-choice questions. The step-by-step solutions clarify difficult concepts, reduce errors, and strengthen analytical and problem-solving skills. This practice builds confidence and prepares students for real exam conditions.




This MDCAT paper consists of a total of 200 Questions

  • 20 English
  • 80 Biology
  • 60 Chemistry
  • 40 Physics

The time allotted for this paper was 210 minutes, however, You are free to leave at any point and resume or start over. Each question has only one correct answer.

PLS Boost Bundle

Get Access to 20 thousands+ MCQs Including Topical MCQs, Practice Tests, Mock Tests, Solved Past Papers, Flashcards, Notes, FLPS, and Much More.

/100
187
Created by Ali Durrani

Sindh MDCAT 2015 Past Paper

Free Access to Limited MCQs. Enroll to PLS Boost Premium Bundle to Get More MCQs HERE

1 / 100

During the formation of an ovum nondisjunction of the sex chromosomes occurred, the ovum was then fertilized by a normal Y-bearing sperm cell. Which one of the following shows the sex chromosome complement of the resulting zygote?

NTS 2015 DUHS and JSMU
Biology
Cell Cycle
Meiotic Errors
Elimination Tool:

A) XO
B) XXY
C) XXXY
D) XXYY

2 / 100

Antheridia and archegonia are _____ organs in bryophytes.

NTS 2015 DUHS and JSMU
Biology
Kingdom Plantae
Division Bryophyta
Elimination Tool:

A) reproductive
B) digestive
C) respiratory
D) none of the above

3 / 100

Which one of the following types of cell are found in secondary xylem of angiosperms?

NTS 2015 DUHS and JSMU
Biology
Support and Movement
Elimination Tool:

A) Tracheids parenchyma fibres collenchyma but no vessels
B) Vessels tracheids parenchyma collenchyma but no fibres
C) Vessels tracheids fibres collenchyma but no parenchyma
D) Vessels tracheids fibres parenchyma but no collenchyma
E) None of these

4 / 100

Which of the following statements is true about Savannah?

NTS 2015 DUHS and JSMU
Biology
Man and His Environment
Elimination Tool:

A) Dry season is very long and the temperature ranges more than 18 C throughout the year
B) Its plants do not shed off their leaves
C) The subsoil is permanently frozen
D) Rainfall is up to 200 cm per year
E) Evaporation exceeds rainfall

5 / 100

The diagram shows a cell at anaphase 1 of meiosis.

Which diagram shows a normal gamete that could be produced from this cell?

NTS 2015 DUHS and JSMU
Biology
Cell Cycle
Meiosis
Elimination Tool:

A) Option A
B) Option B
C) Option C
D) Option D

6 / 100

Which one of the following combinations of statements is true of saccharides in living organisms?

NTS 2015 DUHS and JSMU
Biology
Biological Molecules
Carbohydrates
Elimination Tool:

A) Option A
B) Option B
C) Option C
D) Option D
E) Option E

7 / 100

The diagram shows a section through the human brain.

NTS 2015 DUHS and JSMU
Biology
Coordination and Control
Central Nervous System
Elimination Tool:

A) Option A
B) Option B
C) Option C
D) Option D
E) Option E

8 / 100

The following observations refer to evolution:

Inherited variations that are favoured in a particular environment are passed on.
There is a struggle for existence.
Across time, inherited variations may accumulate, causing gradual changes in the organism.
Although populations tend to overproduce, they remain more or less constant in numbers from generation to generation.
In what sequence should the statement be placed to support the Darwin theory of evolution?

NTS 2015 DUHS and JSMU
Biology
Evolution
Elimination Tool:

A) I, II, III, IV
B) II, I, III, IV
C) III, I, IV, II
D) IV, I, II, III
E) IV, II, I, III

9 / 100

A short piece of DNA 30 base pairs long was analyzed to find the number of nucleotide bases in each of the polynucleotide strands. Some of the results are shown below.

How many nucleotides containing guanine were present in strand 1?

NTS 2015 DUHS and JSMU
Biology
Chromosomes and DNA
The Chemical Nature of DNA
Elimination Tool:

A) 2
B) 3
C) 4
D) 6

10 / 100

Identify the bones in which the connecting joints are freely movable joints?

NTS 2015 DUHS and JSMU
Biology
Support and Movement
Types of Joints
Elimination Tool:

A) Ankle
B) Wrist
C) Vertebrae
D) Elbow
E) All of the above

11 / 100

Consider the following statements regarding blood pressure:

1. It is the pressure exerted by the blood on the walls of any vessel.

2. It decreases in the arteries as the distance from the heart increases.

3. It is lower in the capillaries than in the arteries.

4. It is usually lower in women than in men.

Choose the correct statements.

NTS 2015 DUHS and JSMU
Biology
Transport
Elimination Tool:

A) 1, 2 and 3 are correct.
B) 2, 3 and 4 are correct.
C) 1 and 4 are correct.
D) 1, 2, 3 and 4 are correct.

12 / 100

Dietary fibre passes through to several structures after leaving the stomach. In which order does the dietary fibre pass through the structures?

NTS 2015 DUHS and JSMU
Biology
Nutrition
Digestion and Absorption
Elimination Tool:

A) duodenum -> jejunum -> ileum -> rectum -> colon
B) ileum -> duodenum -> colon -> jejunum -> rectum
C) ileum -> duodenum -> jejunum -> rectum -> colon
D) colon -> duodenum -> ileum -> rectum -> jejunum
E) duodenum -> jejunum -> ileum -> colon -> rectum

13 / 100

Four words are shown below:

Facultative obligate saprophytes parasites

These words can be used in the basis of P Q R and S to complete the sentence below.

Organisms that depend on living plants and animals for the nutritional requirements are known as…. P… Parasites, which depend on the nutrition entirely on other living organisms, are known as…Q… or total parasites and those which depend for these requirements partially on other living organisms are called…R…or partial parasite on the other hand the plants which depend on dead or rotten organic remains of plants and animals are called…S…

NTS 2015 DUHS and JSMU
Biology
Man and His Environment
Elimination Tool:

A) Option A
B) Option B
C) Option C
D) Option D

14 / 100

The diagram shows some of the muscles and bones of the human arm.

NTS 2015 DUHS and JSMU
Biology
Support and Movement
Ultrastructure & Mechanism of Skeletal Muscle Contraction
Elimination Tool:

A) Option A
B) Option B
C) Option C
D) Option D

15 / 100

The egg of a chick is laid at which of the following stages?

NTS 2015 DUHS and JSMU
Biology
Growth and Development
Growth and Development in Animals
Elimination Tool:

A) gastrula
B) blastula
C) cleavage
D) morula
E) neurulation

16 / 100

Which diagram illustrates the process of active transport?

NTS 2015 DUHS and JSMU
Biology
Transport
Elimination Tool:

A) Option A
B) Option B
C) Option C
D) Option D

17 / 100

Which of the following is correct for the given structure?

NTS 2015 DUHS and JSMU
Biology
Cell Structure and Function
Cytoplasm and Organelles
Elimination Tool:

A) These are small structures which work like oars
B) It is covered with plasma membrane
C) It’s core is called axoneme
D) All of the above

18 / 100

The following statements are about enzymes:

1. They are globular proteins

2. They can be inhibited by competitive inhibitors

3. They are formed in the smooth endoplasmic reticulum

4. There are only found attached to Plasma membranes in the cell

Which statements are correct for all enzymes?

NTS 2015 DUHS and JSMU
Biology
Enzymes
Elimination Tool:

A) 1 and 4
B) 2 and 4
C) 1 and 2
D) 1,2,3 and 4

19 / 100

The floral formula of family caesalpiniaceae or casia family is:

NTS 2015 DUHS and JSMU
Biology
Kingdom Plantae
Evolution of Seed Habit
Elimination Tool:

A) Option A
B) Option B
C) Option C
D) Option D
E) Option E

20 / 100

The diagram shows a molecule.

Which substance might include the above molecule?

NTS 2015 DUHS and JSMU
Biology
Biological Molecules
Proteins
Elimination Tool:

A) Cellulose
B) Serine
C) Glucose
D) Alanine

21 / 100

5 different amino acids, numbered 1, 2, 3, 4, and 5, below from the following sequence in the path of a polypeptide chain:

1-2-3-4-2-5-3

Messenger RNA codon, which correspond to the amino acids, are:
amino acid 1 UGU

amino acid 2 GAU

amino acid 3 CAC

amino acid 4 UAG

amino acid 5 AAG

Which one of the following DNA bases sequences could provide the code for the given section of the polypeptide?

NTS 2015 DUHS and JSMU
Biology
Biological Molecules
Nucleic Acids
Elimination Tool:

A) ACACTTGTGATGCTATTCGTG
B) ACACUAGUGAUGCUAUUCGUG
C) ACACTAGTGATGCTAAACGTG
D) ACACTAGTGATCCTATTCGTG

22 / 100

The diagram shows a simplified nitrogen cycle. During which stage does decomposition start?

NTS 2015 DUHS and JSMU
Biology
Man and His Environment
Biogeochemical Cycle
Elimination Tool:

A) A
B) B
C) C
D) D

23 / 100

The diagram shows some similarities between golgi apparatus, mitochondria and suicide sacs.

NTS 2015 DUHS and JSMU
Biology
Cell Structure and Function
Cytoplasm and Organelles
Elimination Tool:

A) Option A
B) Option B
C) Option C
D) Option D

24 / 100

The scientific name of Thorn Apple is :

NTS 2015 DUHS and JSMU
Biology
Kingdom Plantae
Evolution of Seed Habit
Elimination Tool:

A) Sycopodium phlogmaria
B) Anthocoros fusiform
C) Ginkgo biloba
D) Datura alba
E) Agaricus bisporus

25 / 100

An example of passive acquired immunity is?

NTS 2015 DUHS and JSMU
Biology
Transport
Elimination Tool:

A) Vaccination against smallpox
B) Use of polio vaccine
C) Passing of certain antibodies to the foetus by the pregnant women
D) Inoculation of antitoxin in the case of puncture wound
E) Both C and D

26 / 100

The diagram shows part of a flower after it has been pollinated.

NTS 2015 DUHS and JSMU
Biology
Reproduction
Reproduction in Plants
Elimination Tool:

A) Option A
B) Option B
C) Option C
D) Option D

27 / 100

Class Elasmobranchi have an outer covering of?

NTS 2015 DUHS and JSMU
Biology
Kingdom Animalia
Phylums – porifera to chordata
Elimination Tool:

A) Placoid scale
B) Cycloid
C) Ctenoid scales
D) Epidermal scales

28 / 100

The diagram shows the inheritance of haemophilia in a family.

What is the genotype of person 7?

NTS 2015 DUHS and JSMU
Biology
Variation and Genetics
Inherited Diseases
Elimination Tool:

A) XHXH
B) XHY
C) XHXh
D) XhXh
E) XhY

29 / 100

What happens to the volume of the thorax and the air pressure in the lungs during breathing in?

NTS 2015 DUHS and JSMU
Biology
Gaseous Exchange
Respiratory System of Man
Elimination Tool:

A) Option A
B) Option B
C) Option C
D) Option D
E) Option E

30 / 100

The following sequence of events occurs at the neuromuscular junction. nerve impulse -> release of V -> end plate potential -> W produced in muscle fibre -> X release from sarcoplasmic reticulum -> Formation of Y -> muscle contraction.Which one of the following shows the correct sequence from V -> Y?

NTS 2015 DUHS and JSMU
Biology
Coordination and Control
Steps Involved in Nervous Coordination
Elimination Tool:

A) Option A
B) Option B
C) Option C
D) Option D
E) Option E

31 / 100

A bottle of cold drink contains 200 ml liquid in which CO2 is 0.1 molar . Suppose carbon dioxide behaves like an ideal gas the volume of dissolved carbon dioxide at STP is?

NTS 2015 DUHS and JSMU
Chemistry
Stoichiometry
Theoretical Yield, Actual Yield and Percentage Yield
Elimination Tool:

A) 0.224 L
B) 0.448 L
C) 22.4 L
D) 2.24 L
E) 25.5

32 / 100

Atomic number of C is 6 and H is 1. How many electrons are present In 1.6 grams of methane?

NTS 2015 DUHS and JSMU
Chemistry
Stoichiometry
Mole
Elimination Tool:

A) 6.02 x 10²³
B) 1.204 x 10²³
C) 1.806 x 10²³
D) 2.408 x 10²³
E) 3.01 x 10²³

33 / 100

Magnesium oxide is used in:

NTS 2015 DUHS and JSMU
Chemistry
s and p Block Elements
Introduction to s and p Block Elements
Elimination Tool:

A) as antacid
B) as refractory material
C) vulcanisation of rubber
D) all of the above

34 / 100

Bond energy between nitrogen atoms in N2 molecule is:

NTS 2015 DUHS and JSMU
Chemistry
Chemical Bonding
Bond Energy and Bond Length
Elimination Tool:

A) 242 kJ mol-1
B) 820 kJ mol-1
C) 498 kJ mol-1
D) 347 kJ mol-1
E) 946 kJ mol-1

35 / 100

Oxygen does not react with:

NTS 2015 DUHS and JSMU
Chemistry
s and p Block Elements
General Behaviour of Alkali and Alkaline Earth Metals
Elimination Tool:

A) P
B) Na
C) S
D) Cl

36 / 100

Which of the molecules shown below are aromatic?

NTS 2015 DUHS and JSMU
Chemistry
Hydrocarbons
Introduction to Hydrocarbons
Elimination Tool:

A) I only
B) II and III only
C) I and III only
D) I, Il and III

37 / 100

Ethyl alcohol when treated with excess concentrated H2SO4 may give:

NTS 2015 DUHS and JSMU
Chemistry
Alcohol, Phenols, and Ethers
Elimination Tool:

A) Only diethyl sulphate
B) Only diethyl ether
C) Ethene
D) All of the above

38 / 100

What are the major products of the reaction shown below?

NTS 2015 DUHS and JSMU
Chemistry
Alkyl Halides and Amines
Reactivity and Reactions of Alkyl Halides
Elimination Tool:

A) Phenol and bromopropane
B) Bromobenzene and propanol
C) Bromobenzene and propane
D) Benzene and propane

39 / 100

Surface tension in a liquid is caused by?

NTS 2015 DUHS and JSMU
Chemistry
Chemical Bonding
Intermolecular Forces
Elimination Tool:

A) lack of horizontal intermolecular forces
B) greater rate of evaporation at the surface than from the interior
C) reduced rate of intermolecular collisions at the surface
D) greater fluidity

40 / 100

If uncertainty in the position of an electron is zero, the uncertainty in it’s momentum is?

NTS 2015 DUHS and JSMU
Chemistry
Atomic Structure
Heisenberg’s Uncertainty Principle
Elimination Tool:

A) 1
B) 0
C) 2 x π x r
D) >h/4π
E) Infinite

41 / 100

What is the major product of the nitration reaction below?

NTS 2015 DUHS and JSMU
Chemistry
Hydrocarbons
Reactions of Benzene
Elimination Tool:

A) Option A
B) Option B
C) Option C
D) Option D

42 / 100

Which of the following best describes the emission spectrum of atomic hydrogen?

NTS 2015 DUHS and JSMU
Chemistry
Atomic Structure
Atomic Spectrum
Elimination Tool:

A) a discrete series of lines of equal intensity and equally spaced with respect to wavelength equally
B) a series of only four lines
C) a continuous emission of radiation of all frequencies
D) several discrete series of lines with both intensity and spacings between lines decreasing as the wavenumber increases with each series.

43 / 100

The Unit cell with crystallographic dimensions a=b≠c , α = β = γ = 90 degrees is:

NTS 2015 DUHS and JSMU
Chemistry
States of Matter – Gases, Liquids and Solids
Crystal Lattice and Lattice Energy
Elimination Tool:

A) Cubic
B) Tetragonal
C) Monoclinic
D) Hexagonal

44 / 100

NH3 (amine) is an example of:

NTS 2015 DUHS and JSMU
Chemistry
Alkyl Halides and Amines
Introduction to Alkyl Halides and Amines
Elimination Tool:

A) Negative ligand
B) Anionic ligand
C) Neutral ligand
D) Organic ligand
E) Both Options A and B are correct.

45 / 100

The solubility product for BaSO4 , at 18-25°C is:

NTS 2015 DUHS and JSMU
Chemistry
Solution and Colloids
Solubility and Solubility Curves
Elimination Tool:

A) 1.0 x 10-10mol2dm-6
B) 8.7 x 10-36mol2dm-6
C) 1.8 x 10-21mol2dm-6
D) 8.4 x 10-28mol2dm-6
E) 3.5 x 10-52mol2dm-6

46 / 100

When methylbenzene is treated with bromine in the presence of a catalyst, a mixture of two monobromo isomers is formed. What are the structures of these two isomers?

NTS 2015 DUHS and JSMU
Chemistry
Hydrocarbons
Benzene and its Preparation
Elimination Tool:

A) Option A
B) Option B
C) Option C
D) Option D
E) Option E

47 / 100

Which is most basic in character?

NTS 2015 DUHS and JSMU
Chemistry
s and p Block Elements
Introduction to s and p Block Elements
Elimination Tool:

A) RbOH
B) KOH
C) LiOH
D) NaOH

48 / 100

The table shown below gives the bond dissociation energies of single covalent bonds of carbon atoms with elements A, B, C, and D.
Which of the following has the smallest atom?

NTS 2015 DUHS and JSMU
Chemistry
Chemical Bonding
Covalent Bond
Elimination Tool:

A) A
B) B
C) C
D) D

49 / 100

Strontium lies between calcium and barium in Group II A in the Periodic Table. Which of the properties could be predicted for strontium?

NTS 2015 DUHS and JSMU
Chemistry
s and p Block Elements
General Behaviour of Alkali and Alkaline Earth Metals
Elimination Tool:

A) It forms a water-soluble carbonate that does not decompose on heating.
B) It forms a sparingly soluble sulfate.
C) It forms a nitrate which decomposes on heating to form strontium nitrite and oxygen.
D) It is reduced by cold water, liberating hydrogen.

50 / 100

The dipole moments of the given molecules (BF3, NF3, NH3) are such that:

NTS 2015 DUHS and JSMU
Chemistry
Chemical Bonding
VSEPR Theory
Elimination Tool:

A) BF3 > NF3>NH3
B) NF3 > BF3> NH3
C) NH3 > NF3 > BF3
D) NH3 >BF3 > NF3
E) NH3 = BF3 = NF3

51 / 100

The compound in which carbon uses only its sp3 – hybrid orbitals for bond formation is?

NTS 2015 DUHS and JSMU
Chemistry
Chemical Bonding
VSEPR Theory
Elimination Tool:

A) HCOOH
B) (CH3)3COH
C) NH2CONH2
D) (CH3)3C – CHO

52 / 100

How many electrons can have the values n=2, l=1, and s=+½ in the configuration 1s2, 2s2, 2p3?

NTS 2015 DUHS and JSMU
Chemistry
Atomic Structure
Sub Atomic Particles and Their Discoveries
Elimination Tool:

A) 1
B) 3
C) 5
D) 7
E) 9

53 / 100

H2O has a higher boiling point than HF because:

NTS 2015 DUHS and JSMU
Chemistry
Chemical Bonding
Hydrogen Bonding
Elimination Tool:

A) H2O is more polar than HF
B) H2O can form more hydrogen bonds
C) H2O has higher molecular weight
D) H2O has more atoms
E) H2O does not have a higher boiling point than HF

54 / 100

Commercial hydrogen is obtained from:

NTS 2015 DUHS and JSMU
Chemistry
s and p Block Elements
Introduction to s and p Block Elements
Elimination Tool:

A) coal gas
B) oil gas
C) marsh gas
D) producer gas

55 / 100

How will the equilibrium of the following reaction be affected if additional nitrogen is added?

N2(g) + 3H2(g)⇌ 2NH3(g)

NTS 2015 DUHS and JSMU
Chemistry
Chemical Equilibrium
Factors Affecting Equilibria
Elimination Tool:

A) It will be shifted to the right.
B) It will be shifted to the left.
C) It will be unaffected.
D) The effect on the equilibrium can not be determined without more information.
E) More NH3will be produced.

56 / 100

The IUPAC name for the structure below ends with what suffix?

NTS 2015 DUHS and JSMU
Chemistry
Fundamental Principles of Organic Chemistry
Introduction to Fundamental Principles of Organic Chemistry
Functional Groups
Elimination Tool:

A) -ol
B) -ide
C) -oic acid
D) -yne

57 / 100

The Balmer series lies in which region of the electromagnetic spectrum?

NTS 2015 DUHS and JSMU
Chemistry
Atomic Structure
Atomic Spectrum
Elimination Tool:

A) Ultraviolet
B) Visible
C) Infrared
D) Microwave

58 / 100

Physical properties of Ethyne is/are:

NTS 2015 DUHS and JSMU
Chemistry
Hydrocarbons
Alkynes
Elimination Tool:

A) It is colourless gas with a sweet smell.
B) It is sparingly soluble in water.
C) It is less dense than air.
D) It explodes on compression to a liquid because of unstable nature.
E) All of the above

59 / 100

The hybridization of atomic orbitals of N2+, NO3-, and NH4+ are, respectively:

NTS 2015 DUHS and JSMU
Chemistry
Chemical Bonding
VSEPR Theory
Elimination Tool:

A) sp, sp², sp³
B) sp, sp, sp³
C) sp², sp, sp³
D) sp², sp³, sp

60 / 100

The ionization of Hydrogen atom gives:

NTS 2015 DUHS and JSMU
Chemistry
s and p Block Elements
Introduction to s and p Block Elements
Elimination Tool:

A) hydride ion
B) hydronium ion
C) proton
D) hydroxyl ion

61 / 100

What will be the gravitational force of attraction between two balls each weighing 5 kg when placed at a distance of 0.33 m apart. (G = 6.673 x 10-11 Nm2/kg2 )

NTS 2015 DUHS and JSMU
Physics
Gravitation
Newton’s Law of Universal Gravitation
Elimination Tool:

A) 9.1 x 10-8N
B) 7.1 x 10-8N
C) 6.1 x 10-8 N
D) 3.5 x 10-8 N
E) 1.5 x 10-8 N

62 / 100

The potential difference between the terminals of a battery in an open circuit is 2.2 V. When it is connected across a resistance of 5.0 Ω, the potential falls to 1.8 V. What is the internal resistance of the battery?

NTS 2015 DUHS and JSMU
Physics
Current Electricity
Electrical Power and Power Dissipation in Resistors
Elimination Tool:

A) 9.11 Ω
B) 2.11 Ω
C) 3.11 Ω
D) 1.11 Ω
E) 0.11 Ω

63 / 100

mλ=2dsin(θ) this relation is called as

NTS 2015 DUHS and JSMU
Physics
Optics, Nature of Light and Optical Instruments
Wave Front
Elimination Tool:

A) Coulomb’s Law
B) Bragg’s Law
C) Faraday’s Law
D) Ohm’s Law
E) Gravitational Law

64 / 100

Consider the following examples of motion:

I. The daily motion of the earth about its own axis.

II. The motion of planets around the sun.

III. The sugar cane crushing machine is run by a camel that moves in a circular path around the machine.

IV. Rotation of flywheel about its axle.

Which of the following is correct?

NTS 2015 DUHS and JSMU
Physics
Circular Motion & Momentum
Elimination Tool:

A) I and II are examples of spin motion.
B) I and II are examples of orbital motion.
C) II and IV are examples of spin motion.
D) III and IV are examples of orbital motion.
E) I and IV are examples of spin motion and II and III are examples of orbital motion

65 / 100

A 70 kg sportsman runs up a long flight of stairs in 4 seconds. The vertical height of the stairs is 4.5 m. What will be his power output in watts?

NTS 2015 DUHS and JSMU
Physics
Work, Power & Energy
Power and Energy
Elimination Tool:

A) 7.7 x 10² W
B) 8.8 x 10³ W
C) 9.5 x 10³ W
D) 10.2 x 10⁴ W
E) 13.5 x 10² W

66 / 100

When the force and the displacement are in the opposite directions, the work done by the force is ______.

NTS 2015 DUHS and JSMU
Physics
Work, Power & Energy
Elimination Tool:

A) Positive
B) Negative
C) Zero
D) All of the above
E) None of the above

67 / 100

The resultant of two forces has magnitude of 20N . if one of the forces is of magnitude 20√3 N and makes an angle of 30o with the resultant then, the other forces must be of magnitude:

NTS 2015 DUHS and JSMU
Physics
Scalars and Vectors
Resolution of Vectors
Elimination Tool:

A) 10√3 N
B) 20 N
C) 20√3 N
D) 10 N
E) 37 N

68 / 100

Two capacitors C1 (6μF) and C2(12μF) are in series across a 180 volts d.c. supply. Calculate the potential difference across each capacitor (C1 and C2).

NTS 2015 DUHS and JSMU
Physics
Electrostatics
Elimination Tool:

A) 98 volts … 32 volts
B) 120 volts … 60 volts
C) 68 volts … 96 volts
D) 30 volts … 65 volts
E) 25 volts … 25 volts

69 / 100

A 1000 kg vehicle is turning around a corner at 10 m/s as it travels along an arc of a circle. If the radius of the circular path is 10 m, how large a force must be exerted by the pavement on the tires to hold the vehicle in the circular path?

NTS 2015 DUHS and JSMU
Physics
Circular Motion and Momentum
Centripetal Force
Elimination Tool:

A) 1.0 x 10⁴ N
B) 3.0 x 10⁴ N
C) 5.0 x 10⁴ N
D) 7.0 x 10⁴ N
E) 9.0 x 10⁴ N

70 / 100

Identify the instrument/s which is/are used for the measurement of resistance:

I. Wheatstone Bridge

II. Meter Bridge

III. Post office Box

IV. Ohmmeter

NTS 2015 DUHS and JSMU
Physics
Current Electricity
Elimination Tool:

A) I only
Show Explanation
B) I and II only
Show Explanation
C) II and III only
Show Explanation
D) III and IV only
Show Explanation
E) I, II, III, and IV
Show Explanation

71 / 100

A 100 kg golf ball is moving to the right with a velocity of 20 m/s. It makes a head on collision with an 8 kg steel ball, initially at rest. The two balls get stuck together. What will the velocity of these two balls after collision?

NTS 2015 DUHS and JSMU
Physics
Forces and Motion
Elastic and Inelastic Collisions
Elimination Tool:

A) 14.3 m/s
B) 17.5 m/s
C) 18.5 m/s
D) 19.7 m/s
E) 20.0 m/s

72 / 100

A microscope has an objective of 10 mm focal length and eyepiece of 25 mm focal length. What is the distance between the lenses if the object is in sharp focus when it is 10.5 mm from the objective?

NTS 2015 DUHS and JSMU
Physics
Optics, Nature of Light and Optical Instruments
Magnifying and Resolving Power of Optical Instruments
Elimination Tool:

A) 232.7 mm
B) 431.1 mm
C) 511.9 mm
D) 711.8 mm
E) 913.7 mm

73 / 100

A simple pendulum completes one oscillation in 4 seconds. Calculate its length when g= 9.8 m/s2, as the time period of a simple pendulum is given by T = 2 π √(l/g)

NTS 2015 DUHS and JSMU
Physics
Oscillations and Simple Harmonic Motion
Simple Pendulum
Elimination Tool:

A) 3.973 m
B) 5.123 m
C) 7.111 m
D) 9.231 m
E) 12.141 m

74 / 100

In a certain circuit, a transistor has a collector current of 10mA and a base current of 40μA. What is the current gain of the transistor?

NTS 2015 DUHS and JSMU
Physics
Electronics
Transistors
Elimination Tool:

A) 150
B) 200
C) 250
D) 300
E) 350

75 / 100

An apple is thrown with a speed of 30 m/s in a direction 30° above the horizon. Find out its horizontal range. (g= 9.8 m/s2)

NTS 2015 DUHS and JSMU
Physics
Motion in Two Dimensions
Maximum height and range of projectile
Elimination Tool:

A) 20 m
B) 40 m
C) 60 m
D) 80 m
E) 100 m

76 / 100

Two bodies ‘x’ and ‘Y’ are attached to the ends of a string which passes over a pulley so that the two bodies hang vertically. If the mass of the body ‘x’ is 5 kg and that of body ‘Y’ is 4.8 kg. Find the acceleration?(g = 9.8 m/s^²)

NTS 2015 DUHS and JSMU
Physics
Forces and Motion
Equations of Uniformly Accelerated Motion
Elimination Tool:

A) 0.2 m/s2
B) 1.7 m/s2
C) 3.7 m/s2
D) 4.9 m/s2
E) 9.1 m/s2

77 / 100

A circuit in which there is a current of 10 amperes is changed so that the current falls to zero in 0.5 seconds. If an average e.m.f. of 400 volts is induced, what is the self-inductance of the circuit?

NTS 2015 DUHS and JSMU
Physics
Magnetism and Electromagnetic Induction
Mutual and Self Induction
Elimination Tool:

A) 10 Henrys
B) 20 Henrys
C) 30 Henrys
D) 40 Henrys
E) 50 Henrys

78 / 100

X-rays are also known as:

NTS 2015 DUHS and JSMU
Physics
Atomic Spectra
Inner Shell Transitions And Characteristic X-rays
Elimination Tool:

A) Rydberg rays
B) Roentgen rays
C) Ultraviolet rays
D) Zig-zag rays
E) Ruby rays

79 / 100

________ are very high-energy electromagnetic radiations of the extremely short wavelength emitted from the nuclei of radioactive atoms originating from the high energy transitions of the nucleons in the nuclei.

NTS 2015 DUHS and JSMU
Physics
Nuclear Physics
Elimination Tool:

A) Alpha rays
B) Beta rays
C) Gamma rays
D) Electromagnetic rays
E) Ultraviolet rays

80 / 100

0.75 A current flows through an iron wire when a battery of 1.5 volts is connected across its ends. The length of the wire 5.0 m and its cross-sectional area is 2.5 x 10-7 m2. What is the resistivity of iron?

NTS 2015 DUHS and JSMU
Physics
Current Electricity
Electrical Power and Power Dissipation in Resistors
Elimination Tool:

A) 9.0 x 10-⁷ Ωm
B) 7.0 x 10-⁷ Ωm
C) 5.0 x 10-⁷ Ωm
D) 3.0 x 10-⁷ Ωm
E) 1.0 x 10-⁷ Ωm

81 / 100

Calculate the final kinetic energy when a shop keeper pushes a fruit crate, initially at rest, towards another shopkeeper by exerting a constant horizontal force F of magnitude 5N through a distance of 1 meter.

NTS 2015 DUHS and JSMU
Physics
Work, Power & Energy
Interconversion of Potential Energy and Kinetic Energy
Elimination Tool:

A) 2 J
B) 3 J
C) 5 J
D) 7 J
E) 9 J

82 / 100

A 20.0 cm wire carrying a current of 10.0 A is placed in a uniform magnetic field of 0.30 T. If the wire makes an angle of 40° with the direction of the magnetic field, find the magnitude of the force acting on the wire? ( sin 40° = 0.642)

NTS 2015 DUHS and JSMU
Physics
Magnetism and Electromagnetic Induction
Force on a Current Carrying Conductor in a Uniform Magnetic Field
Elimination Tool:

A) 2.71 N
B) 0.39 N
C) 6.61 N
D) 7.61 N
E) 9.91 N

83 / 100

A gas is enclosed in a container fitted with a piston of cross-sectional area of 0.10m2. The pressure of the gas is maintained at 8000N/m². When heat is slowly transferred, the piston is pushed up through a distance of 4.0cm. If 42J heat is transferred to the system during the expansion, what is the change in the internal energy of the system?

NTS 2015 DUHS and JSMU
Physics
Heat and Thermodynamics
Elimination Tool:

A) 5 J
B) 10 J
C) 20 J
D) 30 J
E) 40 J

84 / 100

A train is approaching a station at 90 km/h sounding a whistle of frequency 1000 Hz. What will be the apparent frequency heard by the listener sitting on the platform if the train moves away from the station at the same speed? (speed of sound= 340 m/s)

NTS 2015 DUHS and JSMU
Physics
Wave Motion and Sound
Superposition Of Waves
Elimination Tool:

A) 931.5 Hz
B) 105.7 Hz
C) 135.9 Hz
D) 153.1 Hz
E) 164.9 Hz

85 / 100

Kelvin, is the unit of thermodynamic temperature, which is ________ of the thermodynamic temperature of the triple point of water.

NTS 2015 DUHS and JSMU
Physics
Heat and Thermodynamics
Kinetic Theory of Gases
Elimination Tool:

A) 1/100.6
B) 1/273.16
C) 1/32.6
D) 1/241.6
E) 1/115.7

86 / 100

When we measure the nuclear masses and compare them with the masses of the constituent nucleus in free states, the mass of the nucleus is always less than the mass of the constituent nucleons. The difference in mass is known as:

NTS 2015 DUHS and JSMU
Physics
Nuclear Physics
Mass Defect And Binding Energy
Elimination Tool:

A) Mass Defect
B) Mass Value
C) Mass Disorder
D) Mass Energy
E) Mass Nucleus

87 / 100

Two spherical balls of 2.0 kg and 3.0 kg masses are moving towards each other with velocities of 6 m/s and 4 m/s respectively. What must be the velocity of the smaller ball after the collision, if the velocity of the bigger ball is 3 m/s?

NTS 2015 DUHS and JSMU
Physics
Forces and Motion
Elastic and Inelastic Collisions
Elimination Tool:

A) 1.5 m/s
B) 2.5 m/s
C) 3.5 m/s
D) 4.5 m/s
E) 5.5 m/s

88 / 100

A particle of mass 5 mg moves with a speed of 8 m/s. Calculate its de Broglie wavelength (h = 6.63 x 10-34 Js)

NTS 2015 DUHS and JSMU
Physics
Atomic Spectra
De-Broglie Waves and Hydrogen Atom
Elimination Tool:

A) 0.71 x 10-29 m
B) 1.66 x 1029 m
C) 1.66 x 10-29 m
D) 3.77 x 10-29 m
E) 5.71 x 10-29 m

89 / 100

The total outward flux over any closed hypothetical surface called _____ is equal to the total charge enclosed divided by ε irrespective of how the charge is distributed.

NTS 2015 DUHS and JSMU
Physics
Electrostatics
Elimination Tool:

A) Coulomb surface
B) Gaussian surface
C) Ohm surface
D) Faraday surface
E) Newton surface

90 / 100

A particle carrying charge of 2e falls through a potential difference of 3.0 V. Calculate energy acquired by it.

NTS 2015 DUHS and JSMU
Physics
Electrostatics
Elimination Tool:

A) 9.6 x 10-¹⁹ J
B) 12.1 x 10-¹⁹ J
C) 14.5 x 10-¹⁹ J
D) 16.7 x 10-¹⁹ J
E) 18.5 x 10-¹⁹ J

91 / 100

Choose the word or phrase most nearly opposite in meaning to the capitalized one.
AMUSED:

NTS 2015 DUHS and JSMU
English
Key Vocabulary
Elimination Tool:

A) Smiling
B) Pleased
C) Annoyed
D) Delighted

92 / 100

Identify the word or phrase that needs to be changed for the sentence to be correct. If the children do their homework quickly, they will have time to watch television. No error

NTS 2015 DUHS and JSMU
English
Identify errors in sentence
Elimination Tool:

A) If
B) Children
C) Homework
D) Have
E) No error

93 / 100

Read the passage and answer the following question:

In earlier times, when every substance was believed to have its own qualities, there was no difficulty in believing that some substances were endowed with life, others not. Wood was wood, and water was water, and though transformations did occur, as in the disappearance of wood in the fire, they were not surprising in a world where the most miraculous changes were taking place under everyone’s every day. There was nothing but ‘doth suffer a sea-change into something rich and strange’. A seed put into the ground became in a short time a plant with leaves and flowers: the white and yolk of an egg turned into the flesh and bones and feathers of a chicken, which, no sooner was the shell cracked, jumped out and started running about.

There was nothing but ‘Doth suffer a sea-change into something rich and strange’ means:

NTS 2015 DUHS and JSMU
English
Passage
Elimination Tool:

A) The transformation of seed into a tree
B) In everyday life natural things change drastically
C) The suffering of change are always enormous
D) Nature does not support any change
E) Both A and B

94 / 100

Choose the word or phrase most nearly opposite in meaning to the capitalized one.

CONVICT:

NTS 2015 DUHS and JSMU
English
Key Vocabulary
Elimination Tool:

A) Prisoner
B) Crook
C) Acquit
D) Hire
E) Stretch

95 / 100

Identify the word or phrase that needs to be changed for the sentence to be correct. The bus stopped too take up three or four people who were waiting by Post office. No error

NTS 2015 DUHS and JSMU
English
Identify errors in sentence
Elimination Tool:

A) The bus
B) Too
C) People
D) Post office
E) No error

96 / 100

Read the passage and answer the following question:

In earlier times, when every substance was believed to have its own qualities, there was no difficulty in believing that some substances were endowed with life, others not. Wood was wood, and water was water, and though transformations did occur, as in the disappearance of wood in the fire, they were not surprising in a world where the most miraculous changes were taking place under everyone’s every day. There was nothing but ‘doth suffer a sea-change into something rich and strange’. A seed put into the ground became in a short time a plant with leaves and flowers: the white and yolk of an egg turned into the flesh and bones and feathers of a chicken, which, no sooner was the shell cracked, jumped out and started running about.

Some substances are alive, and some are not.

Which of the following statements best describes this belief?

NTS 2015 DUHS and JSMU
English
Passage
Elimination Tool:

A) The transformation in natural substances was unnoticed in ancient times
B) There was no transformation in natural substances ancient times
C) There was no concept of dead and alive things in the past
D) The burning of wood is not an example of transformation
E) None of these options

97 / 100

Choose the word most similar in meaning to the capitalized one.

RELIEVED:

NTS 2015 DUHS and JSMU
English
Key Vocabulary
Elimination Tool:

A) Worried
B) Anxious
C) Relaxed
D) Alarmed

98 / 100

Complete the sentences by choosing the most appropriate option, from the given lettered choices (A to D) below each.

The milkman ____ many bottles of milk to our school every day.

NTS 2015 DUHS and JSMU
English
Fill in the blank
Elimination Tool:

A) delivers
B) has deliver
C) have deliver
D) delivering

99 / 100

Choose the word most similar in meaning to the capitalized one.

BRUTAL:

NTS 2015 DUHS and JSMU
English
Key Vocabulary
Elimination Tool:

A) Kind
B) Cruel
C) Polished
D) Smooth
E) Tender

100 / 100

Complete the sentences by choosing the most appropriate option, from the given lettered choices (A to D) below each.

I was having a cup ___ tea when he knocked on the door.

NTS 2015 DUHS and JSMU
English
Fill in the blank
Elimination Tool:

A) off
B) at
C) an
D) of

Your score is

The average score is 64%

0%

Learning from Frequently Repeated Questions

Sindh MDCAT solved past papers highlight important topics and frequently repeated questions from previous exams. By focusing on these high-priority areas, students can revise efficiently, prioritize essential chapters, and increase their chances of achieving higher marks in the MDCAT.

Improving Accuracy and Time Management

Attempting solved Sindh MDCAT papers under timed conditions helps students enhance speed, accuracy, and time management. Reviewing the answer key after completing each paper allows candidates to correct mistakes, avoid negative marking, and become familiar with the exam environment. Regular practice also reduces exam anxiety and improves overall performance.

Related: Attempt Online Mock Tests

Free Sindh MDCAT Solved Past Papers for IBA Sukkur Students

PLS Academy provides free Sindh MDCAT past papers solved with answer key to support structured and effective preparation. Alongside solved papers, students can access mock tests and chapter-wise MCQs for complete MDCAT preparation. Consistent use of these resources builds confidence, enhances accuracy, and improves overall readiness for the MDCAT exam.

JazakAllah.

BIG SALE! FLAT 50% OFF

Protected