NUMS Mock Test New 3

by

in , ,

NUMS Mock Tests: Master the MDCAT Exam

NUMS Mock Tests are an essential tool for students preparing for NUMS-affiliated medical and dental colleges. These mock tests replicate the real NUMS MDCAT exam in terms of pattern, timing, and difficulty, giving students a realistic experience before the actual test. Regular practice helps improve accuracy, speed, and confidence, which are key to achieving a top score.




NUMS Entry Test

The NUMS entry test covers various subjects, including Biology, Chemistry, Physics, and English. It assesses a candidate’s understanding of scientific concepts, problem-solving abilities, critical thinking skills, and language proficiency.

PLS Boost Bundle

Get Access to 20 thousands+ MCQs Including Topical MCQs, Practice Tests, Mock Tests, Solved Past Papers, Flashcards, Notes, FLPS, and Much More.

/150
231
Created by Ali Durrani

NUMS Mock Test New 3

Register in PLSBoost Premium Bundle to get 20,000+ Solved MCQs

▶️ ENROLL NOW

1 / 150

Precipitation occurs when the product of ionic concentrations is:

NUMS Mock 3
Chemistry
Chemical Equilibrium
A) Greater than Ksp
Show Explanation
B) Less than Ksp
Show Explanation
C) Equal to Ksp
Show Explanation
D) Equal to unity
Show Explanation

2 / 150

Aromatic compounds burn with a sooty flame because:

NUMS Mock 3
Chemistry
Fundamental Principles of Organic Chemistry
A) They are resistant to react with oxygen
Show Explanation
B) They have a cyclic structure
Show Explanation
C) They have a high percentage of Carbon
Show Explanation
D) They have a high percentage of hydrogen
Show Explanation

3 / 150

Impurities of lead in silver are removed by:

NUMS Mock 3
Chemistry
d and f Block Elements
A) Parke’s process
Show Explanation
B) Solvay process
Show Explanation
C) Cyanide process
Show Explanation
D) Amalgamation process
Show Explanation

4 / 150

The substance which conducts electricity by the movement of ions:

NUMS Mock 3
Chemistry
Chemical Bonding
A) Graphite
Show Explanation
B) Copper
Show Explanation
C) Molten NaCl
Show Explanation
D) Mercury
Show Explanation

5 / 150

Phenylmethyl ketone can be converted into ethyl benzene in one step by using:

NUMS Mock 3
Chemistry
Aldehydes and Ketones
A) LiAlH4
Show Explanation
B) Zn(Hg)-HCl
Show Explanation
C) NaBH4
Show Explanation
D) CH3MgI
Show Explanation

6 / 150

Free Nitrogen and Oxygen are present in atmosphere but they do not react with each other under normal conditions because:

NUMS Mock 3
Chemistry
Environmental Chemistry
A) Nitrogen requires a catalyst
Show Explanation
B) Oxygen is very inactive
Show Explanation
C) Oxygen is found in less concentration
Show Explanation
D) Nitrogen is highly inactive gas
Show Explanation

7 / 150

For a single step reaction A ->B + 2C, the rate law is:

NUMS Mock 3
Chemistry
Reaction Kinetics
A) Rate = k
Show Explanation
B) Rate = k[A][B]
Show Explanation
C) Rate = k[A]
Show Explanation
D) Rate = k[B]
Show Explanation

8 / 150

The products of decomposition of Mg(NO3)2are:

NUMS Mock 3
Chemistry
Periodicity in Elements
A) MgO and NO2
Show Explanation
B) Mg and NO2
Show Explanation
C) MgO, NO2and O2
Show Explanation
D) Mg(NO3)2
Show Explanation

9 / 150

Which of the following is the most environmentally friendly source to derive energy?

NUMS Mock 3
Chemistry
Environmental Chemistry
A) Lead-acid accumulator
Show Explanation
B) H2- O2fuel cell
Show Explanation
C) Silver oxide battery
Show Explanation
D) Alkaline battery
Show Explanation

10 / 150

The presence of several fine lines in a line spectrum shows the presence of:

NUMS Mock 3
Chemistry
Atomic Structure
A) Shells
Show Explanation
B) Energy levels
Show Explanation
C) Sub shells
Show Explanation
D) All of these options are correct
Show Explanation

11 / 150

The color of transition metal complexes is due to transition of electrons between:

NUMS Mock 3
Chemistry
d and f Block Elements
A) p to d orbitals
Show Explanation
B) d to d orbitals
Show Explanation
C) p to p orbitals
Show Explanation
D) d to p orbitals
Show Explanation

12 / 150

Which of the following will not undergo aldol condensation?

NUMS Mock 3
Chemistry
Aldehydes and Ketones
A) Acetaldehyde
Show Explanation
B) Propanaldehyde
Show Explanation
C) Benzaldehyde
Show Explanation
D) Trideuteroacetaldehyde
Show Explanation

13 / 150

Ketones can be made by oxidation of:

NUMS Mock 3
Chemistry
Aldehydes and Ketones
A) Aldehydes
Show Explanation
B) Primary Alcohols
Show Explanation
C) Secondary Alcohols
Show Explanation
D) Tertiary Alcohols
Show Explanation

14 / 150

Which of the following is locating agent?

NUMS Mock 3
Chemistry
Analytical Chemistry
A) H2S
Show Explanation
B) CS2
Show Explanation
C) Rubeanic acid
Show Explanation
D) Ninhydrin
Show Explanation

15 / 150

The influence of temperature on reaction rate is predicted by:

NUMS Mock 3
Chemistry
Reaction Kinetics
A) Free energy change
Show Explanation
B) Van Der Waals equation
Show Explanation
C) Arrhenius equation
Show Explanation
D) Kinetic equation
Show Explanation

16 / 150

Which of these pollutants is produced by burning of coal and causes acid rain.

NUMS Mock 3
Chemistry
Environmental Chemistry
A) NO
Show Explanation
B) CO2
Show Explanation
C) SO2
Show Explanation
D) CO
Show Explanation

17 / 150

A crystal system having all sides (a, b and c) unequal and anglesα = β = γ= 90 is:

NUMS Mock 3
Chemistry
States of Matter – Gases, Liquids and Solids
A) Cubic
Show Explanation
B) Rhombohedral
Show Explanation
C) Orthorhombic
Show Explanation
D) Hexagonal
Show Explanation

18 / 150

Salts of weak bases react with strong acids to give a/an

NUMS Mock 3
Chemistry
Acids, Bases and Salts
A) Basic solution
Show Explanation
B) Acidic solution
Show Explanation
C) Neutral solution
Show Explanation
D) None
Show Explanation

19 / 150

Which of the following gas, when ignited, burns with a blue flame and is not very soluble in water?

NUMS Mock 3
Chemistry
s and p Block Elements
Environmental Chemistry
A) O2
Show Explanation
B) CO2
Show Explanation
C) N2
Show Explanation
D) He
Show Explanation

20 / 150

Nylon-6,6 is also called:

NUMS Mock 3
Chemistry
Macromolecules
A) Poly styrene
Show Explanation
B) Polyester
Show Explanation
C) Polyamide
Show Explanation
D) Polyvinyl alcohol
Show Explanation

21 / 150

If a molecule MX3 has zero dipole moment, the sigma bonding orbitals used by M are:

NUMS Mock 3
Chemistry
Chemical Bonding
A) Pure p
Show Explanation
B) Sp hybrids
Show Explanation
C) Sp2hybrids
Show Explanation
D) Sp3hybrids
Show Explanation

22 / 150

Stronger the oxidizing agent, higher is the:

NUMS Mock 3
Chemistry
Electrochemistry
A) Emf of cell
Show Explanation
B) Oxidation potential
Show Explanation
C) Reduction potential
Show Explanation
D) Redox potential
Show Explanation

23 / 150

The shape of CO2 molecule is similar to:

NUMS Mock 3
Chemistry
Chemical Bonding
A) H2S
Show Explanation
B) SO2
Show Explanation
C) SnCl2
Show Explanation
D) BeF2
Show Explanation

24 / 150

A certain radioactive isotope has a half-life of 50 days. Fraction of the material left behind after 100 days will be:

NUMS Mock 3
Chemistry
Analytical Chemistry
A) 125%
Show Explanation
B) 25%
Show Explanation
C) 50%
Show Explanation
D) 100%
Show Explanation

25 / 150

Which of the following substances exhibits hydrogen bonding?

NUMS Mock 3
Chemistry
Chemical Bonding
A) H2S
Show Explanation
B) SiH4
Show Explanation
C) NH3
Show Explanation
D) HI
Show Explanation

26 / 150

What is the correct name for this structure?

NUMS Mock 3
Chemistry
Fundamental Principles of Organic Chemistry
A) 3,3 4- trimethyl hexane
Show Explanation
B) 1,1,2- trimethyl ethane
Show Explanation
C) 2,2-dimethyl propane
Show Explanation
D) 2-ethyl,1-methylethane
Show Explanation

27 / 150

Which of the following solids is an example of a substance with a macromolecular structure?

NUMS Mock 3
Chemistry
States of Matter – Gases, Liquids and Solids
A) Aluminium chloride
Show Explanation
B) Ice
Show Explanation
C) Magnesium oxide
Show Explanation
D) Silicon (IV) oxide
Show Explanation

28 / 150

The valency of an atom will be one if there is a sufficient gap between first and second ____.

NUMS Mock 3
Chemistry
Chemical Bonding
A) Electron affinity
Show Explanation
B) Ionization energy
Show Explanation
C) Electronegativity
Show Explanation
D) None of these options are correct
Show Explanation

29 / 150

Both ionic and covalent bonds are present in:

NUMS Mock 3
Chemistry
Chemical Bonding
A) CH4
Show Explanation
B) SO2
Show Explanation
C) KCl
Show Explanation
D) NaOH
Show Explanation

30 / 150

The following changes to the system at equilibrium have no effect on Kc except:

NUMS Mock 3
Chemistry
Chemical Equilibrium
A) Increasing reactant concentrations
Show Explanation
B) Equal number of reactant and product gas molecules
Show Explanation
C) Increasing temperature
Show Explanation
D) Using a catalyst
Show Explanation

31 / 150

Identify the correct statement:

NUMS Mock 3
Chemistry
s and p Block Elements
A) Element sodium can be prepared and isolated by electrolyzing an aqueous solution of NaCl
Show Explanation
B) Elemental Na is a strong oxidizing agent
Show Explanation
C) Elemental Na is insoluble in NH3
Show Explanation
D) Elemental Na is easily oxidizing
Show Explanation

32 / 150

Which of the following has the highest value of pKa?

NUMS Mock 3
Chemistry
Chemical Equilibrium
A) CH3- CH2OH
Show Explanation
B) CI – CH2- CH2OH
Show Explanation
C) F3C – CH2- OH
Show Explanation
D) CH3- CH(CH3) – CH2OH
Show Explanation

33 / 150

The decreasing order of second ionization energy of K, Ca, Ba is:

NUMS Mock 3
Chemistry
Chemical Bonding
A) K > Ca > Ba
Show Explanation
B) Ca > Ba > K
Show Explanation
C) Ba > K > Ca
Show Explanation
D) K > Ba > Ca
Show Explanation

34 / 150

Alkenes undergo:

NUMS Mock 3
Chemistry
Hydrocarbons
A) Electrophilic Addition
Show Explanation
B) Electrophilic substitution
Show Explanation
C) Nucleophilic substitution
Show Explanation
D) Nucleophilic addition
Show Explanation

35 / 150

If any amino acids contain greater number of NH2, it is:

NUMS Mock 3
Chemistry
Alkyl Halides and Amines
A) Acidic
Show Explanation
B) Neutral
Show Explanation
C) Amphoteric
Show Explanation
D) Basic
Show Explanation

36 / 150

Solid CO2 dry ice has a structure just like:

NUMS Mock 3
Chemistry
States of Matter – Gases, Liquids and Solids
A) Diamond
Show Explanation
B) Sulphur
Show Explanation
C) Graphite
Show Explanation
D) None of the above
Show Explanation

37 / 150

Which of these in an aqueous solution of equal concentration has the lowest pH?

NUMS Mock 3
Chemistry
Carboxylic Acids and its Derivatives
A) Chloroethanoic acid
Show Explanation
B) Ethanoic acid
Show Explanation
C) Ethylamine
Show Explanation
D) Phenol
Show Explanation

38 / 150

Which one of the following reagents is used to distinguish between aldehydes and ketones?

NUMS Mock 3
Chemistry
Aldehydes and Ketones
A) Alkaline Iodine
Show Explanation
B) Tollen’s Reagent
Show Explanation
C) Bromine
Show Explanation
D) 2, 4 DNPH
Show Explanation

39 / 150

Which of the following molecules has the largest number of shared pairs of electrons?

NUMS Mock 3
Chemistry
Chemical Bonding
A) C2H4
Show Explanation
B) N2
Show Explanation
C) CO2
Show Explanation
D) NH3
Show Explanation

40 / 150

In this reaction NH4* + H2O -> H3O*, the conjugate base of H3O+ ion is:

NUMS Mock 3
Chemistry
Chemical Equilibrium
A) NH4+
Show Explanation
B) H2O
Show Explanation
C) H*
Show Explanation
D) NH3
Show Explanation

41 / 150

Select the nearest correct meaning of the given word:

DERACINATE

NUMS Mock 3
English
Key Vocabulary
A) Inculcate
Show Explanation
B) Incarnate
Show Explanation
C) Pull up
Show Explanation
D) Send for
Show Explanation

42 / 150

Identify the correct usage of the adverb in the sentence:

She spoke ______ during the presentation.

NUMS Mock 3
English
A) Clear
Show Explanation
B) Clearly
Show Explanation
C) Clearlier
Show Explanation
D) Clearest
Show Explanation

43 / 150

Complete the sentence using the grammatically correct word or phrase.

Committee _______ issued a report.

NUMS Mock 3
English
Grammar and Punctuation
A) Has
Show Explanation
B) Will have
Show Explanation
C) Will
Show Explanation
D) Have
Show Explanation

44 / 150

_________ people know the town better than old Jake here.

NUMS Mock 3
English
Fill in the blank
A) Only few
Show Explanation
B) The few
Show Explanation
C) Only the few
Show Explanation
D) Few
Show Explanation

45 / 150

Demonstrate the correct use of subject-verb agreement:
He was ____ in the rain then.

NUMS Mock 3
English
Fill in the blank
A) Enjoys
Show Explanation
B) Enjoying
Show Explanation
C) Enjoy
Show Explanation
D) Will enjoy
Show Explanation

46 / 150

They sometimes feel a _____ for the mountains and the sea.

NUMS Mock 3
English
Fill in the blank
A) Yearning
Show Explanation
B) Yapping
Show Explanation
C) Yelling
Show Explanation
D) Yielding
Show Explanation

47 / 150

Last Saturday my father _____ (take) my friends and me to the circus.

NUMS Mock 3
English
A) Take
Show Explanation
B) Took
Show Explanation
C) Will take
Show Explanation
D) Has taken
Show Explanation

48 / 150

Choose the word most similar in meaning to the capitalized one:

MEDITATIVE:

NUMS Mock 3
English
Key Vocabulary
A) Selfish
Show Explanation
B) Thoughtful
Show Explanation
C) Heedless
Show Explanation
D) Opinion
Show Explanation

49 / 150

Identify the correct form of the adjective to complete the sentence:

The weather today is ______ than yesterday.

NUMS Mock 3
English
A) Hot
Show Explanation
B) Hotter
Show Explanation
C) Hotest
Show Explanation
D) Hotted
Show Explanation

50 / 150

_______ is involved in lipid synthesis/metabolism.

NUMS Mock 3
Biology
Cell Structure and Function
A) Smooth endoplasmic reticulum
Show Explanation
B) Rough endoplasmic reticulum
Show Explanation
C) Mitochondria
Show Explanation
D) Vacuoles
Show Explanation

51 / 150

Identify the correct form of the pronoun to complete the sentence:

_____ going to the movies tonight?

NUMS Mock 3
English
A) Who’s
Show Explanation
B) Whose
Show Explanation
C) Whom
Show Explanation
D) Who
Show Explanation

52 / 150

You will find more information in the ___________.

NUMS Mock 3
English
Fill in the blank
A) Attached to file
Show Explanation
B) Attached file
Show Explanation
C) Attachment file
Show Explanation
D) File what is attached
Show Explanation

53 / 150

In the following question, four alternative sentences are given. Choose the CORRECT one.

NUMS Mock 3
English
Grammar and Punctuation
A) A common cause of failure is a mistaking ambition for the boy on the part of the parents.
Show Explanation
B) A common cause of failure is a mistaken ambition for the boy on the part of parents.
Show Explanation
C) A common cause of failure is a mistake ambition for the boy on the part of the parents.
Show Explanation
D) A common causes of failure is a mistake ambition for the boy on the part of the parents.
Show Explanation

54 / 150

In the following question, four alternative sentences are given. Choose the CORRECT one.

NUMS Mock 3
English
Grammar and Punctuation
A) There is no clearly defined plot nor is there an attempt to establish a strong “hero figure”
Show Explanation
B) There is neither clearly defined plot not is there an attempt to establish a strong “hero figure”
Show Explanation
C) There is not clearly defined plot nor is there any attempt to establish a strong “hero figure”
Show Explanation
D) There not either clearly defined plot not is there an attempt to establish a strong “hero figure”
Show Explanation

55 / 150

Which of the following sentences is grammatically incorrect?

NUMS Mock 3
English
Grammar and Punctuation
A) Is this your jacket?
Show Explanation
B) Whose jacket is this?
Show Explanation
C) Is this jacket yours?
Show Explanation
D) Who’s jacket is this?
Show Explanation

56 / 150

The new teacher showed no _____ about hitting the students.

NUMS Mock 3
English
Fill in the blank
A) Quakes
Show Explanation
B) Qualms
Show Explanation
C) Quarrel
Show Explanation
D) Quotation
Show Explanation

57 / 150

Why picture on a TV screen become distorted when a magnet is brought near the screen?

NUMS Mock 3
Physics
Magnetism and Electromagnetic Induction
A) Beam of electrons will be negative due to magnetic field
Show Explanation
B) Beam of electrons will be zero due to magnetic field
Show Explanation
C) Beam of electrons will be reflected due to magnetic field
Show Explanation
D) Beam of electrons will be deflected due to magnetic field
Show Explanation

58 / 150

Electric field strength at a point between oppositely charged plates is ‘E’. If the distance between plates is reduced to half, what will be the new value of electric intensity?

NUMS Mock 3
Physics
Electrostatics
A) 4E
Show Explanation
B) E/2
Show Explanation
C) E/4
Show Explanation
D) 2E
Show Explanation

59 / 150

Lasers are used for producing an intense, ____ and coherent beam of visible light.

NUMS Mock 3
Physics
Optics, Nature of Light and Optical Instruments
A) Monochromatic
Show Explanation
B) Bichromatic
Show Explanation
C) Multichromatic
Show Explanation
D) Non Chromatic
Show Explanation

60 / 150

The beat frequency is given by:

NUMS Mock 3
Physics
Wave Motion and Sound
A) |fa – fb|
Show Explanation
B) |fa ÷ fb|
Show Explanation
C) |fa x fb|
Show Explanation
D) |fa + fb|
Show Explanation

61 / 150

All of the following are equivalent to watt except:

NUMS Mock 3
Physics
Work, Power & Energy
A) (Amperes)2ohm
Show Explanation
B) Joules/ sec
Show Explanation
C) Amperes x volts
Show Explanation
D) Amperes/volt
Show Explanation

62 / 150

The total energy of a block, executing simple harmonic motion is:

NUMS Mock 3
Physics
Oscillations and Simple Harmonic Motion
A) Independent of ‘x’
Show Explanation
B) Proportional to ‘x’
Show Explanation
C) Proportional to ‘x2’
Show Explanation
D) Proportional to ‘x-2’
Show Explanation

63 / 150

A bullet of mass 20g leaves the gun with a velocity of 200 m/s. If the mass of gun is 2kg then the speed of recoil of the gun is:

NUMS Mock 3
Physics
Forces and Motion
A) 2000 m/s
Show Explanation
B) 2 m/s
Show Explanation
C) 20 m/s
Show Explanation
D) 200 m/s
Show Explanation

64 / 150

In the case of linear deformation, the ratio of tensile stress to tensile strain is called:

NUMS Mock 3
Physics
Physics of Solids
Oscillations and Simple Harmonic Motion
A) Energy stored in a stretched wire
Show Explanation
B) Young’s double slit phenomenon
Show Explanation
C) Bulk Modulus
Show Explanation
D) Young’s Modulus
Show Explanation

65 / 150

Change in entropy does not depend on:

NUMS Mock 3
Physics
Heat and Thermodynamics
A) Amount of heat added to the system
Show Explanation
B) Amount of heat rejected from the system
Show Explanation
C) The temperature of the substance
Show Explanation
D) Amount of the substance
Show Explanation

66 / 150

Minimum energy required to eject an electron from metal surface is called:

NUMS Mock 3
Physics
Dawn of Modern Physics
A) Stopping potential
Show Explanation
B) Electromotive force
Show Explanation
C) Work function
Show Explanation
D) Threshold frequency
Show Explanation

67 / 150

If a wire having current 10A has a 3T magnetic field, what will be the magnetic field at a point from the wire at double the distance?

NUMS Mock 3
Physics
Magnetism and Electromagnetic Induction
A) Reduces by factor 2
Show Explanation
B) Becomes double
Show Explanation
C) Reduces by factor 4
Show Explanation
D) Becomes triple
Show Explanation

68 / 150

For one mole of gas, the relation for specific heat capacity at constant pressure ‘Cp’ and at constant volume ‘Cv’ is ________.

NUMS Mock 3
Physics
Heat and Thermodynamics
A) Cp + Cv = R
Show Explanation
B) Cp – R = Cv
Show Explanation
C) Cv – R = Cp
Show Explanation
D) Cp + R = Cv
Show Explanation

69 / 150

For a stiff spring, the value of spring constant is:

NUMS Mock 3
Physics
Oscillations and Simple Harmonic Motion
A) Higher
Show Explanation
B) Lower
Show Explanation
C) Intermediate
Show Explanation
D) Zero
Show Explanation

70 / 150

An emf of 120 volts of negligible internal resistance is connected across a resistance of 1000 ohm. The current flowing through the circuit will be:

NUMS Mock 3
Physics
Current Electricity
A) 120 A
Show Explanation
B) 120 x 103A
Show Explanation
C) 120 x 10-3A
Show Explanation
D) None
Show Explanation

71 / 150

Two long, parallel conductors which are free to move are arranged 1.0 cm apart. A steady current of 20 A flows in each of the conductors in the same direction. The conductors:

NUMS Mock 3
Physics
Magnetism and Electromagnetic Induction
A) Remains stationary
Show Explanation
B) Move towards each other
Show Explanation
C) Move away from each other
Show Explanation
D) Move at right angles to each other
Show Explanation

72 / 150

If each particle of fluid is passing through the same point, what would be the flow?

NUMS Mock 3
Physics
Fluid Dynamics
A) Linear
Show Explanation
B) Streamline
Show Explanation
C) Tubular
Show Explanation
D) Both A and B
Show Explanation

73 / 150

The point at which an applied force produces linear motion but no rotatory Motion is:

NUMS Mock 3
Physics
Forces and Motion
A) Mid-point
Show Explanation
B) Center of gravity
Show Explanation
C) Optical center
Show Explanation
D) Pole
Show Explanation

74 / 150

What force should be applied on a 10 kg body so that it moves down in a vacuum with an acceleration of 3 m/s2 ? (Take g=9.8 m/s2)

NUMS Mock 3
Physics
Forces and Motion
A) 42 N
Show Explanation
B) 46 N
Show Explanation
C) 68 N
Show Explanation
D) 53 N
Show Explanation

75 / 150

Two bodies ‘x’ and ‘Y’ are attached to the ends of a string which passes over a pulley so that the two bodies hang vertically. If the mass of the body ‘x’ is 5 kg and that of body ‘Y’ is 4.8 kg. Find the acceleration?(g = 9.8 m/s^2)

NUMS Mock 3
Physics
Forces and Motion
A) 0.2 m/s2
Show Explanation
B) 1.7 m/s2
Show Explanation
C) 3.7 m/s2
Show Explanation
D) 4.9 m/s2
Show Explanation

76 / 150

An electron enters in a magnetic field at an angle less than 90 degrees with magnetic field. Which of the following path is followed by an electron?

NUMS Mock 3
Physics
Magnetism and Electromagnetic Induction
A) Straight
Show Explanation
B) Circular
Show Explanation
C) Curve
Show Explanation
D) Helical
Show Explanation

77 / 150

In motion of satellites, necessary centripetal force is provided by:

NUMS Mock 3
Physics
Circular Motion & Momentum
A) Gravitational Force
Show Explanation
B) Coulomb’s Force
Show Explanation
C) Magnetic Force
Show Explanation
D) Nuclear Force
Show Explanation

78 / 150

Refrigerator is an example of:

NUMS Mock 3
Physics
Heat and Thermodynamics
A) First law of thermodynamics
Show Explanation
B) Second law of thermodynamics
Show Explanation
C) Newton law of motion
Show Explanation
D) Entropy
Show Explanation

79 / 150

Third law of Newton is also called:

NUMS Mock 3
Physics
Forces and Motion
A) Law of Inertia
Show Explanation
B) Equilibrium
Show Explanation
C) Law of action and reaction
Show Explanation
D) None
Show Explanation

80 / 150

In rotational motion, angular momentum plays a role which is analogous to that played by _____ in linear motion.

NUMS Mock 3
Physics
Circular Motion and Momentum
A) Linear velocity
Show Explanation
B) Linear momentum
Show Explanation
C) Linear acceleration
Show Explanation
D) Inertia
Show Explanation

81 / 150

In simple harmonic motion, acceleration will be maximum, when object is at:

NUMS Mock 3
Physics
Oscillations and Simple Harmonic Motion
A) Maximum displacement from the mean position
Show Explanation
B) Center position
Show Explanation
C) Half of the maximum displacement from mean position
Show Explanation
D) Mean position
Show Explanation

82 / 150

A body starts sliding on a rough horizontal surface with a speed of 10 m/s. If the coefficient of friction is 0.2, find the distance traveled by the body before coming to rest. (g = 10m/s)

NUMS Mock 3
Physics
Forces and Motion
A) 15 m
Show Explanation
B) 25 m
Show Explanation
C) 35 m
Show Explanation
D) 40 m
Show Explanation

83 / 150

An automobile is moving forwards with uniform velocity due to the force exerted by its engine. If the force is doubled with the velocity remaining constant what happens to its total power?

NUMS Mock 3
Physics
Work, Power and Energy
A) It is squared
Show Explanation
B) It is halved
Show Explanation
C) It is doubled
Show Explanation
D) It does not change
Show Explanation

84 / 150

An object is moving along a circular path of radius 4m. What will be its angular displacement if it moves 14 m on this circular path?

NUMS Mock 3
Physics
Circular Motion & Momentum
A) 5.0 radians
Show Explanation
B) 3.5 radians
Show Explanation
C) 4.5 radians
Show Explanation
D) 5.5 radians
Show Explanation

85 / 150

A body of mass of 2kg absorbed 10 J of radioactive radiations. The absorbed dose of radiation in rad is:

NUMS Mock 3
Physics
Nuclear Physics
A) 5
Show Explanation
B) 5 x 10-2
Show Explanation
C) 500
Show Explanation
D) 20
Show Explanation

86 / 150

The current measuring part of the Avometer consists of a number of low resistors connected …

NUMS Mock 3
Physics
Magnetism and Electromagnetic Induction
A) At an angle of 180 degrees with the galvanometer
Show Explanation
B) Parallel with galvanometer
Show Explanation
C) At an angle of 45 degrees With the galvanometer
Show Explanation
D) Perpendicular with the galvanometer
Show Explanation

87 / 150

If the temperature is increased from 200K to 800K, then what would be the change in pressure at constant volume?

NUMS Mock 3
Physics
Heat and Thermodynamics
A) Increases by factor 4
Show Explanation
B) Decreases by factor 4
Show Explanation
C) Increases by factor 2
Show Explanation
D) Decreases by factor 2
Show Explanation

88 / 150

When the frequency of the applied force becomes equal to one of natural frequencies of body then the body oscillates with maximum displacement this phenomenon is called:

NUMS Mock 3
Physics
Wave Motion and Sound
Oscillations and Simple Harmonic Motion
A) Heating
Show Explanation
B) Resonance
Show Explanation
C) Reverbnation
Show Explanation
D) Damping
Show Explanation

89 / 150

If Cv= 5/2 R , Cpwill be:

NUMS Mock 3
Physics
Heat and Thermodynamics
A) 2 / 5 R
Show Explanation
B) 2 / 7 R
Show Explanation
C) 5 / 2 R
Show Explanation
D) 7 / 2 R
Show Explanation

90 / 150

The fractional change in resistance per kelvin is known as:

NUMS Mock 3
Physics
Current Electricity
A) None
Show Explanation
B) Temperature coefficient of resistance
Show Explanation
C) Thermal coefficient
Show Explanation
D) Volumetric æfficient of expansion
Show Explanation

91 / 150

A disc, a hoop, and a sphere of the same mass and radius are rolled down from a frictionless, inclined plane. Which has a greater speed on reaching the ground?

NUMS Mock 3
Physics
Circular Motion and Momentum
A) Disc
Show Explanation
B) Loop
Show Explanation
C) Sphere
Show Explanation
D) All have the same speed
Show Explanation

92 / 150

Lenz’s law in electromagnetic induction is the direct consequence of the principle of conservation of:

NUMS Mock 3
Physics
Magnetism and Electromagnetic Induction
A) Energy
Show Explanation
B) Charge
Show Explanation
C) Momentum
Show Explanation
D) Mass
Show Explanation

93 / 150

The different magnitudes of same physical quantities are measured by comparing them to:

NUMS Mock 3
Physics
Measurements
A) Available scale
Show Explanation
B) Standard size
Show Explanation
C) Each other
Show Explanation
D) Other physical quantities
Show Explanation

94 / 150

When the antinodes, in stationary waves, are passing through their equilibrium position, the energy is:

NUMS Mock 3
Physics
Wave Motion and Sound
A) Potential only
Show Explanation
B) Kinetic only
Show Explanation
C) A combination of both forms of energy
Show Explanation
D) There is no energy in stationary waves
Show Explanation

95 / 150

Find the longest wavelength in the Paschen series, given R = 1.097 x 107m-1.

NUMS Mock 3
Physics
Atomic Spectra
A) 11097 A
Show Explanation
B) 18750 A
Show Explanation
C) 17884 A
Show Explanation
D) 19001 A
Show Explanation

96 / 150

The direction of the magnetic line of force depends upon:

NUMS Mock 3
Physics
Magnetism and Electromagnetic Induction
A) Nature of the material of the conducting wire
Show Explanation
B) Area of the conducting wire
Show Explanation
C) Amount of the current
Show Explanation
D) Direction of the current
Show Explanation

97 / 150

Now-a-days every newborn gets regular shots of vaccine for polio. It contains _________ for polio to make a child immune against this disease.

NUMS Mock 3
Biology
Bio-diversity | Variety of Life
A) Antibiotics
Show Explanation
B) Antibodies
Show Explanation
C) Antigens
Show Explanation
D) Antisera
Show Explanation

98 / 150

Conversion of ammonium into nitrates is:

NUMS Mock 3
Biology
Man and His Environment
A) Nitrification
Show Explanation
B) Nitrogen Fixation
Show Explanation
C) Ammonification
Show Explanation
D) Denitrification
Show Explanation

99 / 150

The table shows the characteristics of the blood in one blood vessel in the body.

Which blood vessel contains blood with these characteristics?

NUMS Mock 3
Biology
Transport
A) Aorta
Show Explanation
B) Pulmonary Artery
Show Explanation
C) Pulmonary Vein
Show Explanation
D) Vena cava
Show Explanation

100 / 150

In cross-section each Centriole consist of nine (each in triplets) of:

NUMS Mock 3
Biology
Cell Structure and Function
A) Microfilaments
Show Explanation
B) Microvilli
Show Explanation
C) Microtubules
Show Explanation
D) Intermediate filaments
Show Explanation

101 / 150

Which valve action results from an increase in pressure in the ventricles of the heart?

NUMS Mock 3
Biology
Transport
A) The closing of all the heart valves
Show Explanation
B) The closing of semilunar valves
Show Explanation
C) The opening of the bicuspid valve
Show Explanation
D) The opening of the semilunar valves
Show Explanation

102 / 150

Which of the following, which is the incorrectly paired one?

NUMS Mock 3
Biology
Biology and its Major Fields of Specialization
A) Robert Hooke … cell wall
Show Explanation
B) Schlelden and schwann … cell theory
Show Explanation
C) Robert Brown… nucleus
Show Explanation
D) Watson and Crick … DNA model
Show Explanation
E) Virchow… mosaic model of plasma membrane
Show Explanation

103 / 150

How many ml of blood is pumped by each contraction of the heart?

NUMS Mock 3
Biology
Transport
A) 80 ml
Show Explanation
B) 90 ml
Show Explanation
C) 70 ml
Show Explanation
D) 60 ml
Show Explanation

104 / 150

Chemical nature of primers used in the PCR process is _______.

NUMS Mock 3
Biology
Biotechnology
A) RNA
Show Explanation
B) Protein
Show Explanation
C) Carbohydrate
Show Explanation
D) DNA
Show Explanation

105 / 150

Consider the following statements regarding blood pressure:

1. It is the pressure exerted by the blood on the walls of any vessel.

2. It decreases in the arteries as the distance from the heart increases.

3. It is lower in the capillaries than in the arteries.

4. It is usually lower in women than in men.

Choose the correct statements.

NUMS Mock 3
Biology
Transport
A) 1, 2 and 3 are correct.
Show Explanation
B) 2, 3 and 4 are correct.
Show Explanation
C) 1 and 4 are correct.
Show Explanation
D) 1, 2, 3 and 4 are correct.
Show Explanation

106 / 150

DNA synthesis takes place in _____ phase of the cell cycle.

NUMS Mock 3
Biology
Cell Cycle
A) G0
Show Explanation
B) G1
Show Explanation
C) G2
Show Explanation
D) S
Show Explanation

107 / 150

Chest cavity is bounded by ribs and muscles on the sides, while the floor of chest cavity is called:

NUMS Mock 3
Biology
Gaseous Exchange
A) Pleura
Show Explanation
B) Alveoli
Show Explanation
C) Chest cage
Show Explanation
D) Diaphragm
Show Explanation

108 / 150

It is a method for rapid production of a very large number of copies of a particular fragment of DNA:

NUMS Mock 3
Biology
Biotechnology
A) Gel electrophoresis
Show Explanation
B) Polymerase chain reaction
Show Explanation
C) DNA extraction
Show Explanation
D) Recombination
Show Explanation

109 / 150

Amylase is not produced by the following type(s) of salivary gland:

NUMS Mock 3
Biology
Nutrition
A) Parotid
Show Explanation
B) Submandibular
Show Explanation
C) Sublingual
Show Explanation
D) None of the given options are correct
Show Explanation

110 / 150

The dark reactions of photosynthesis are characterized by:

NUMS Mock 3
Biology
Bioenergetics
A) Synthesis of ATP, O2 and NADH
Show Explanation
B) Utilization of ATP, CO2 and NADPH
Show Explanation
C) Electron transfer from NADPH to RuBP
Show Explanation
D) Carbon dioxide transfer from RuBP to glucose
Show Explanation

111 / 150

In which of the following growth phases, the number of bacteria increases the most rapidly?

NUMS Mock 3
Biology
Kingdom Protista
A) Lag phase
Show Explanation
B) Log phase
Show Explanation
C) Stationary phase
Show Explanation
D) Death / Decline phase
Show Explanation

112 / 150

The egg of a chick is laid at which of the following stages?

NUMS Mock 3
Biology
Growth and Development
A) Gastrula
Show Explanation
B) Blastula
Show Explanation
C) Cleavage
Show Explanation
D) Morula
Show Explanation

113 / 150

Nitrogen-cycle is facilitated by ______.

NUMS Mock 3
Biology
Ecosystem
A) Algae
Show Explanation
B) Fungi
Show Explanation
C) Bacteria
Show Explanation
D) Virus
Show Explanation

114 / 150

5 different amino acids, numbered 1, 2, 3, 4, and 5, below from the following sequence in the path of a polypeptide chain:

1-2-3-4-2-5-3

Messenger RNA codon, which correspond to the amino acids, are:
amino acid 1 UGU

amino acid 2 GAU

amino acid 3 CAC

amino acid 4 UAG

amino acid 5 AAG

Which one of the following DNA bases sequences could provide the code for the given section of the polypeptide?

NUMS Mock 3
Biology
Biological Molecules
A) ACACTTGTGATGCTATTCGTG
Show Explanation
B) ACACUAGUGAUGCUAUUCGUG
Show Explanation
C) ACACTAGTGATGCTAAACGTG
Show Explanation
D) ACACTAGTGATCCTATTCGTG
Show Explanation

115 / 150

What type of atom is the carbon atom?

NUMS Mock 3
Biology
Biological Molecules
A) Divalent
Show Explanation
B) Monovalent
Show Explanation
C) Trivalent
Show Explanation
D) Tetravalent
Show Explanation

116 / 150

Choose the term from the following which is NOT a part of gene therapy?

NUMS Mock 3
Biology
Biotechnology
A) Bone marrow transplant
Show Explanation
B) Retrovirus
Show Explanation
C) DNA Fingerprinting
Show Explanation
D) Somatic cells
Show Explanation

117 / 150

This theory says that “mitochondria and chloroplasts are, in effect, ancient bacteria which now live inside the larger cells”:

NUMS Mock 3
Biology
Evolution
A) Darwin’s theory of evolution
Show Explanation
B) Lamarckism
Show Explanation
C) Neo – darwinism
Show Explanation
D) Endosymbiont theory
Show Explanation

118 / 150

Phenylketonuria is

NUMS Mock 3
Biology
Chromosomes and DNA
A) Sex linked dominant trait
Show Explanation
B) Sex linked recessive trait
Show Explanation
C) Autosomal dominant trait
Show Explanation
D) Autosomal recessive trait
Show Explanation

119 / 150

Booklungs serve the function of respiration in:

NUMS Mock 3
Biology
Gaseous Exchange
A) Scorpion
Show Explanation
B) Earthworm
Show Explanation
C) Frog
Show Explanation
D) Cockroaches
Show Explanation

120 / 150

Identify the incorrect statement about Charles Darwin’s theory:

NUMS Mock 3
Biology
Evoloution
A) The individual of species have variations among them.
Show Explanation
B) There is always a tendency of over reproduction in a species.
Show Explanation
C) Vast gradual changes result in the origin of a new species.
Show Explanation
D) Favorable variations survive and unfavorable will be exterminated.
Show Explanation
E) Intra-specific competition occurs between different species and interspecific competition occurs among the individuals in a species.
Show Explanation

121 / 150

While working in a laboratory, before studying a sample under the microscope, it was immersed in a dye solution to obtain ______.

NUMS Mock 3
Biology
Biology and its Major Fields of Specialization
A) Magnification
Show Explanation
B) Image
Show Explanation
C) Match
Show Explanation
D) Contrast
Show Explanation

122 / 150

Many scientists believe that one of the following is evolutionary origin(s) of animals, plants and fungi?

NUMS Mock 3
Biology
Evolution
A) Protists
Show Explanation
B) Algae
Show Explanation
C) Bacteria
Show Explanation
D) Protozoans
Show Explanation

123 / 150

Below the point at which the cotyledons are attached, the embryo axis is called _______.

NUMS Mock 3
Biology
Kingdom Plantae
A) Radicle
Show Explanation
B) Epicotyl
Show Explanation
C) Hypocotyl
Show Explanation
D) Coleoptile
Show Explanation

124 / 150

All of the followings are the effects of red light on plant, EXCEPT:

NUMS Mock 3
Biology
Growth and Development
A) Causes epicotyl (plumule) hook to unbend
Show Explanation
B) Induces increase in leaf area
Show Explanation
C) Elongation of internodes is promoted
Show Explanation
D) Stimulate flowering in long day plants
Show Explanation

125 / 150

In semi-conservative replication, which of the following is true regarding the separation of two strands?

NUMS Mock 3
Biology
Chromosomes and DNA
A) Primary structure is conserved, and secondary structure is disturbed
Show Explanation
B) Secondary structure is conserved, and the primary structure is disrupted
Show Explanation
C) both the primary and secondary structures are conserved
Show Explanation
D) Both the primary and secondary structures are disrupted
Show Explanation

126 / 150

An example of competitive inhibition of an enzyme is the inhibition of;

NUMS Mock 3
Biology
Enzymes
A) Succinic dehydrogenase by malonic acid
Show Explanation
B) Cytochrome oxidase by cyanide
Show Explanation
C) Hexokinase by glucose
Show Explanation
D) Carbonic anhydrase by carbon dioxide
Show Explanation

127 / 150

Lymph nodes are not present:

NUMS Mock 3
Biology
Coordination and Control
A) Neck region
Show Explanation
B) Axilla
Show Explanation
C) Groin
Show Explanation
D) Spleen
Show Explanation

128 / 150

The diagram represents two liquids, separated by a membrane through which osmosis can occur.

What movement of molecules will occur?

NUMS Mock 3
Biology
Transport
A) Molecules of dissolved substance move from left to right.
Show Explanation
B) Molecules of dissolved substance move from right to left.
Show Explanation
C) Overall, water molecules move from left to right.
Show Explanation
D) Overall, water molecules move from right to left.
Show Explanation

129 / 150

NAD is an example of:

NUMS Mock 3
Biology
Biological Molecules
A) Mononucleotide
Show Explanation
B) Dinucleotide
Show Explanation
C) Trinucleotide
Show Explanation
D) Tetranucleotide
Show Explanation

130 / 150

DNA fingerprinting is basically done for:

NUMS Mock 3
Biology
Biotechnology
A) DNA cloning
Show Explanation
B) DNA analysis
Show Explanation
C) DNA sequencing
Show Explanation
D) DNA splicing
Show Explanation

131 / 150

Which type of protein structure contains the three dimensional structure?

NUMS Mock 3
Biology
Biological Molecules
A) Primary
Show Explanation
B) Secondary
Show Explanation
C) Tertiary
Show Explanation
D) Quaternary
Show Explanation

132 / 150

The best function of coelom is described as ____.

NUMS Mock 3
Biology
Kingdom Animalia
A) To increase the size of the animals
Show Explanation
B) To help in the functioning of reproductive system
Show Explanation
C) To provide space for the development of organs and systems
Show Explanation
D) All of these options are correct
Show Explanation

133 / 150

Unpaired facial bones are:

NUMS Mock 3
Biology
Support and Movement
A) Maxilla, Zygomatic
Show Explanation
B) Palatine, Inferior concha
Show Explanation
C) Nasal, Lacrimal
Show Explanation
D) Mandible, Vomer
Show Explanation

134 / 150

The causes of Cyanosis include:

NUMS Mock 3
Biology
Transport
A) Deficiency of vitamin C
Show Explanation
B) Varicella-zoster virus
Show Explanation
C) Degeneration of the cartilage of joints
Show Explanation
D) Ventricular septum defect
Show Explanation

135 / 150

What is the size of Parvovirus?

NUMS Mock 3
Biology
Bio-diversity | Variety of Life
A) 200nm
Show Explanation
B) 20nm
Show Explanation
C) 30nm
Show Explanation
D) 100nm
Show Explanation

136 / 150

Movement of the Hip joint is which type of synovial joints?

NUMS Mock 3
Biology
Support and Movement
A) Gliding joint
Show Explanation
B) Ball and socket joint
Show Explanation
C) Pivot joints
Show Explanation
D) Hinge joint
Show Explanation

137 / 150

According to the theory of natural selection, organisms produce:

NUMS Mock 3
Biology
Evolution
A) Offspring according to the resources available
Show Explanation
B) Offspring to create resources
Show Explanation
C) To create resources
Show Explanation
D) More offspring than supported
Show Explanation

138 / 150

The inhibitor which closely resembles the substrate in its molecular structure and inhibits the enzyme activity by binding to the active site of the enzyme is called:

NUMS Mock 3
Biology
Enzymes
A) Feedback inhibitor
Show Explanation
B) Non-competitive inhibitor
Show Explanation
C) Allosteric modulator
Show Explanation
D) Competitive inhibitor
Show Explanation

139 / 150

Icosahedral viruses have how many faces?

NUMS Mock 3
Biology
Variety of Life
A) 20
Show Explanation
B) 30
Show Explanation
C) 10
Show Explanation
D) 40
Show Explanation

140 / 150

The numbers of capsomeres found in adenovirus capsid is?

NUMS Mock 3
Biology
Bio-diversity | Variety of Life
A) 162
Show Explanation
B) 200
Show Explanation
C) 252
Show Explanation
D) 155
Show Explanation

141 / 150

Cardiac output is increased by all of the following EXCEPT:

NUMS Mock 3
Biology
Transport
A) Hypoxia
Show Explanation
B) Exercise
Show Explanation
C) Sleep
Show Explanation
D) Pregnancy
Show Explanation

142 / 150

An Rh negative woman is married to an Rh positive man whose father was also Rh negative. What are the chances that their child will be affected?

NUMS Mock 3
Biology
Variation and Genetics
A) 25%
Show Explanation
B) 50%
Show Explanation
C) 75%
Show Explanation
D) 100%
Show Explanation

143 / 150

In a marine environment, the ion secreted by the kidney is:

NUMS Mock 3
Biology
Homeostasis
A) Na+
Show Explanation
B) K+
Show Explanation
C) Mg2+
Show Explanation
D) Cl-
Show Explanation

144 / 150

What is the effect of enzyme DNA ligase?

NUMS Mock 3
Biology
Chromosomes and DNA
A) DNA is broken up at specific sites
Show Explanation
B) DNA fragments are joined together
Show Explanation
C) DNA replication occurs
Show Explanation
D) DNA transcription occurs
Show Explanation

145 / 150

A group of biologically active molecules formed from amino acids which interact with the surface of the lipid bilayer of cell membranes are called:

NUMS Mock 3
Biology
Biological Molecules
A) Integral Proteins
Show Explanation
B) Peripheral proteins
Show Explanation
C) Cell wall
Show Explanation
D) Plasmodesmata
Show Explanation

146 / 150

Red-green color-blindness is an X-linked recessive disorder. Jacob’s paternal grandfather and father are both color-blind, but his mother has two normal alleles. What is the probability that Jacob is red-green color-blind?

NUMS Mock 3
Biology
Variation and Genetics
A) 0%
Show Explanation
B) 25%
Show Explanation
C) 50%
Show Explanation
D) 75%
Show Explanation

147 / 150

Eukaryotic, multicellular, and consumers belong to ______ kingdom.

NUMS Mock 3
Biology
Bio-diversity | Variety of Life
A) Monera
Show Explanation
B) Protista
Show Explanation
C) Fungi
Show Explanation
D) Animalia
Show Explanation

148 / 150

Which of the following blood transfusions can be made safely?

NUMS Mock 3
Biology
Variation and Genetics
A) Group A to group B
Show Explanation
B) Group B to group AB
Show Explanation
C) Group AB to group O
Show Explanation
D) Group A to group O
Show Explanation

149 / 150

As an excretory organ, liver:

NUMS Mock 3
Biology
Homeostasis
A) Detoxifies many chemical poisons
Show Explanation
B) Produces ammonia for excretion by the kidneys
Show Explanation
C) Produces urea and uric acids from the nitrogen of amino acids
Show Explanation
D) All of the above
Show Explanation

150 / 150

In a pyramid of energy, which level represents the greatest amount of energy?

NUMS Mock 3
Biology
Man and His Enviornment
A) Producers
Show Explanation
B) First-order consumers
Show Explanation
C) Second-order consumers
Show Explanation
D) Third-order consumers
Show Explanation

Your score is

The average score is 47%

0%




Benefits of NUMS Mock Tests

Practicing NUMS mock tests allows students to assess their preparation, identify weak areas, and refine problem-solving strategies. They also enhance time management skills, reduce exam anxiety, and familiarize students with high-yield topics. Reviewing performance after each test ensures students can focus on improvement areas and optimize their preparation for the final MDCAT.

PLS Academy: Expert Guidance for NUMS Mock Tests

PLS Academy offers comprehensive NUMS mock tests with detailed solutions, topic-wise explanations, and performance analysis. Their structured approach includes full-length mock exams, subject-wise quizzes, and practice sessions to strengthen concepts and boost exam readiness. With PLS Academy, students gain the confidence and skills needed to excel in the NUMS MDCAT and secure admission into top medical and dental colleges.

JazakAllah

BIG SALE! FLAT 50% OFF

Protected