NUMS Mock Test 2

Created by Ali Durrani

NUMS

NUMS Mock Test 2

Register in PLSBoost Premium Bundle to get 20,000+ Solved MCQs

1 / 150

Category: Physics

For a simple harmonic motion the acceleration of the body is _______ to displacement and always directed towards ________.

NUMS Mock 2
Physics
Oscillations and Simple Harmonic Motion

A) Directly proportional ; maximum position

B) Inversely proportional ; maximum position

C) Directly proportional ; mean position

D) Directly proportional ; minimum position

2 / 150

Category: Physics

The area under the extension-load graph Of an elastic material whose elastic limit has not been exceeded gives its:

NUMS Mock 2
Physics
Work, Power & Energy

A) Stress

B) Strain energy

C) Strain

D) Young modulus

3 / 150

Category: Physics

Identify the postulate(s) which help to formulate a mathematical model of gases.

I. A finite volume of gas consists of very large number of molecules

II. The size of the molecules is much smaller than the separation between molecules

III. Molecules do not exert force on each other except during a collision.

NUMS Mock 2
Physics
Heat and Thermodynamics

B) II only

C) III only

D) I & II only

E) I, II & III

4 / 150

Category: Physics

If both inputs “A” and “B” are ON and the output is also ON. This type of gate is known as:

NUMS Mock 2
Physics
Electronics

A) OR Gate

B) AND Gate

C) NAND Gate

D) NOR Gate

5 / 150

Category: Physics

The bicycle pump works on the basis of:

NUMS Mock 2
Physics
Heat and Thermodynamics

A) 1st Law of thermodynamics

B) 2nd Law of thermodynamics

C) Law of conservation of energy

D) Law of entropy

6 / 150

Category: Physics

Why picture on a TV screen become distorted when a magnet is brought near the screen?

NUMS Mock 2
Physics
Magnetism and Electromagnetic Induction

A) Beam of electrons will be negative due to magnetic field

B) Beam of electrons will be zero due to magnetic field

C) Beam of electrons will be reflected due to magnetic field

D) Beam of electrons will be deflected due to magnetic field

7 / 150

Category: Physics

The energy stored in the capacitor is written as:

NUMS Mock 2
Physics
Electrostatics

A) ½ CV2

B) ⅓ CV2

C) CV2

D) None of these

8 / 150

Category: Physics

When the antinodes, in stationary waves, are passing through their equilibrium position, the energy is:

NUMS Mock 2
Physics
Wave Motion and Sound

A) Potential only

B) Kinetic only

C) A combination of both forms of energy

D) There is no energy in stationary waves

9 / 150

Category: Physics

Lasers are used for producing an intense, ____ and coherent beam of visible light.

NUMS Mock 2
Physics
Optics, Nature of Light and Optical Instruments

A) Monochromatic

B) Bichromatic

C) Multichromatic

D) Non Chromatic

10 / 150

Category: Physics

A body starts sliding on a rough horizontal surface with a speed of 10 m/s. If the coefficient of friction is 0.2, find the distance traveled by the body before coming to rest. (g = 10m/s)

NUMS Mock 2
Physics
Forces and Motion

A) 15 m

B) 25 m

C) 35 m

D) 40 m

11 / 150

Category: Physics

Minimum energy required to eject an electron from metal surface is called:

NUMS Mock 2
Physics
Dawn of Modern Physics

A) Stopping potential

B) Electromotive force

C) Work function

D) Threshold frequency

12 / 150

Category: Physics

The direction of the magnetic line of force depends upon:

NUMS Mock 2
Physics
Magnetism and Electromagnetic Induction

A) Nature of the material of the conducting wire

B) Area of the conducting wire

C) Amount of the current

D) Direction of the current

13 / 150

Category: Physics

If the temperature is increased from 200K to 800K, then what would be the change in pressure at constant volume?

NUMS Mock 2
Physics
Heat and Thermodynamics

A) Increases by factor 4

B) Decreases by factor 4

C) Increases by factor 2

D) Decreases by factor 2

14 / 150

Category: Physics

An object is moving along a circular path of radius 4m. What will be its angular displacement if it moves 14 m on this circular path?

NUMS Mock 2
Physics
Circular Motion and Momentum

A) 5.0 radians

B) 3.5 radians

C) 4.5 radians

D) 5.5 radians

15 / 150

Category: Physics

The magnetic force acting on a unit positive charge moving perpendicular to the magnetic field with a unit velocity is called:

NUMS Mock 2
Physics
Magnetism and Electromagnetic Induction

A) Magnetic flux

B) Magnetic field intensity

C) Magnetic induction

D) Self inductance

16 / 150

Category: Physics

In Doppler effect, if listener moves towards a stationary source then:

NUMS Mock 2
Physics
Wave Motion and Sound

A) Observed frequency is greater than original frequency

B) Observed frequency is less than original frequency

C) Observed frequency is equal to original frequency

D) Observed frequency is independent of original frequency

17 / 150

Category: Physics

If the unit vectors i, j, k are perpendicular to each other therefore

i.i = j.j = k.k = ______.

I.j = j.k = k.i = ______.

NUMS Mock 2
Physics
Scalars and Vectors

A) 0 … 1

B) 1 … 0

C) 0 …. 0

D) 1 …. 1

18 / 150

Category: Physics

If the body is rotating with uniform angular velocity, then its torque is:

NUMS Mock 2
Physics
Circular Motion and Momentum

A) Zero

B) 90

C) 1

D) -1

19 / 150

Category: Physics

If frequency of incident light is increased beyond threshold frequency, keeping light intensity constant, then:

NUMS Mock 2
Physics
Dawn of Modern Physics

A) Stopping potential increases

B) Stopping potential decreases

C) Stopping potential remains constant

D) Stopping potential becomes infinite

20 / 150

Category: Physics

The moment of inertia of a solid sphere of mass ‘m’ having radius ‘r’ about a line passing through its center is:

NUMS Mock 2
Physics
Circular Motion and Momentum

A) 5/2 mr2

B) 2/5 mr2

C) 1/2 mr2

D) 1/3 mr2

21 / 150

Category: Physics

If a pendulum is oscillating with a frequency f then what is the frequency at which it’s K.E. changes?

NUMS Mock 2
Physics
Oscillations and Simple Harmonic Motion

A) 2f

B) f/2

C) F

D) None of these

22 / 150

Category: Physics

The chemical properties of elements depend on ________.

NUMS Mock 2
Physics
Nuclear Physics

A) Atomic number only

B) Mass number only

C) Atomic number and mass both

D) Neither atomic number nor mass number

23 / 150

Category: Physics

All of the following are equivalent to watt except:

NUMS Mock 2
Physics
Work, Power & Energy

A) (Amperes)2ohm

B) Joules/ sec

C) Amperes x volts

D) Amperes/volt

24 / 150

Category: Physics

An object is thrown vertically upward with a velocity of 20 m/s. How much time it will take to reach the highest point?

NUMS Mock 2
Physics
Motion in Two Dimensions

A) 2 sec

B) 4 sec

C) 1 sec

D) Insufficient information

25 / 150

Category: Physics

An emf of 120 volts of negligible internal resistance is connected across a resistance of 1000 ohm. The current flowing through the circuit will be:

NUMS Mock 2
Physics
Current Electricity

A) 120 A

B) 120 x 103A

C) 120 x 10-3A

D) None

26 / 150

Category: Physics

_____ are such nuclei of an element that have the same mass number A, but have different charge number Z.

NUMS Mock 2
Physics
Atomic Spectra

A) Isotopes

B) Isobars

C) Isomers

D) Isotherms

27 / 150

Category: Physics

The velocity of an object increases from 0 to 10 m/s in 2 seconds. The distance covered by the object is _________.

NUMS Mock 2
Physics
Motion in Two Dimensions

A) 10 m

B) 7.5 m

C) 05 m

D) 2.5 m

28 / 150

Category: Physics

An astronomical telescope has Magnifying power 5. If the focal length is 20 cm then what is the focal length of the objective?

NUMS Mock 2
Physics
Optics, Nature of Light and Optical Instruments

A) 1m

B) 0.1 m

C) 50 cm

E) 15 cm

29 / 150

Category: Physics

Lenz’s law in electromagnetic induction is the direct consequence of the principle of conservation of:

NUMS Mock 2
Physics
Magnetism and Electromagnetic Induction

A) Energy

B) Charge

C) Momentum

D) Mass

30 / 150

Category: Physics

1 kilowatt hour =

NUMS Mock 2
Physics
Work, Power and Energy

A) 1.6 x 10-19 J

B) 3.6×106 J

C) 9.1 x 1031J

D) 1.67x 10-27 J

31 / 150

Category: Physics

What is the quark composition of a Proton?

NUMS Mock 2
Physics
Nuclear Physics

A) Two up quarks and one down quark

B) Two up quarks and one strange quark

C) One up quark and two strange quarks

D) Two down quarks and one up quark

32 / 150

Category: Physics

Radioactive elements emit:

NUMS Mock 2
Physics
Nuclear Physics

A) ɑ radiations

B) β radiations

C) ɣ radiations

D) All of these

33 / 150

Category: Physics

Which of the following is the percentage of the original quantity of a radioactive material left after five half–lives approximately.

NUMS Mock 2
Physics
Nuclear Physics

A) 3%

B) 10%

C) 6.25%

D) 20%

34 / 150

Category: Physics

Why is the total mass of all individual protons and neutrons in a nucleus greater than the mass of the nucleus which they constitute?

NUMS Mock 2
Physics
Nuclear Physics

A) When protons and neutrons combine to form nucleus, mass decrease due to gain of energy

B) Possible mass loss is due to faulty techniques to measure mass of nucleus

C) This statement is not true in most of the cases

D) When protons and neutrons combine to form nucleus, some mass is destroyed resulting in energy release

35 / 150

Category: Physics

Absolute zero is equivalent to:

NUMS Mock 2
Physics
Heat and Thermodynamics

A) 0K

B) -273 C

C) -459.4 F

D) All of these

36 / 150

Category: Physics

A force F = 0.12 N is applied on a spring and the spring elongates by 3 cm. The specific constant of the spring is?

NUMS Mock 2
Physics
Oscillations and Simple Harmonic Motion

A) 0.4 Nm-2

B) 40 Nm-1

C) 400 Nm-1

D) 4 Nm-1

37 / 150

Category: Physics

Thirty joules of heat flow into a system. The system in turn does 50 Joules of work. The internal energy of the system has:

NUMS Mock 2
Physics
Heat and Thermodynamics

A) Increased by 80 joules

B) Decreased by 80 joules

C) Increased by 20 joules

D) Decreased by 20 joules

38 / 150

Category: Physics

The fractional change in resistance per kelvin is known as:

NUMS Mock 2
Physics
Current Electricity

A) None

B) Temperature coefficient of resistance

C) Thermal coefficient

D) Volumetric æfficient of expansion

39 / 150

Category: Physics

Third law of Newton is also called:

NUMS Mock 2
Physics
Forces and Motion

A) Law of Inertia

B) Equilibrium

C) Law of action and reaction

D) None

40 / 150

Category: Physics

Simple Harmonic Motion of a body is described by which statements mentioned below:

K : K.E is maximum when displacement x = 0

L : P.E is maximum when x = 0

M : P.E is maximum when x = ± x0

NUMS Mock 2
Physics
Oscillations and Simple Harmonic Motion

A) K and L

B) K and M

C) K, L and M

D) L and M

41 / 150

Category: Chemistry

The rate of a reaction in general can be increased by all the following factors except:

NUMS Mock 2
Chemistry
Reaction Kinetics

A) By increasing temperature

B) Using a suitable catalyst

C) By an increase in activation energy

D) By increasing conc. Of reactants

42 / 150

Category: Chemistry

Which one of the following is not an isotope of hydrogen:

NUMS Mock 2
Chemistry
Atomic Structure

A) Deuterium

B) Tritium

C) Ortho hydrogen

D) None of these

43 / 150

Category: Chemistry

The process of depositing a thin layer of expensive metals on ordinary or expensive metals is called:

NUMS Mock 2
Chemistry
Electrochemistry

A) Electroplating

B) Conductivity

C) Galvanizing

D) Metallurgy

44 / 150

Category: Chemistry

The products of decomposition of Mg(NO3)2are:

NUMS Mock 2
Chemistry
Periodicity in Elements

A) MgO and NO2

B) Mg and NO2

C) MgO, NO2and O2

D) Mg(NO3)2

45 / 150

Category: Chemistry

All of the following react with KMnO4 except

NUMS Mock 2
Chemistry
Hydrocarbons

A) Ethane

B) Ethyne

C) Ethylbenzene

D) Ethene

46 / 150

Category: Chemistry

Which enthalpy change is relevant in the following process

Na(s) -> Na (g) ΔH = +107

NUMS Mock 2
Chemistry
Thermochemistry

A) Enthalpy of atomization

B) Enthalpy of fusion

C) Enthalpy of vaporization

D) Enthalpy of formation

47 / 150

Category: Chemistry

Carboxylic acids can be reduced to corresponding alcohols. Which of the following reagent can be used for this purpose?

NUMS Mock 2
Chemistry
Carboxylic Acids and its Derivatives

A) KMnO4

B) LiAlH4

C) K2Cr2O4

D) H2SO4

48 / 150

Category: Chemistry

Enthalpy of a compound is equal to its

NUMS Mock 2
Chemistry
Thermochemistry

A) Heat of combustion

B) Heat of formation

C) Heat of solution

D) Heat of dilution

49 / 150

Category: Chemistry

Stronger the oxidizing agent, higher is the:

NUMS Mock 2
Chemistry
Electrochemistry

A) Emf of cell

B) Oxidation potential

C) Reduction potential

D) Redox potential

50 / 150

Category: Chemistry

All the collisions between the particles of gases are elastic in nature. What is meant by “Elastic Collisions”?

NUMS Mock 2
Chemistry
States of Matter – Gases, Liquids and Solids

A) No change in the total kinetic energy

B) The velocity of the molecules changes

C) No change in potential energy during the collisions

D) No change in mass during the collisions

51 / 150

Category: Chemistry

Water has maximum density at:

NUMS Mock 2
Chemistry
States of Matter – Gases, Liquids and Solids

A) -4 C

B) – 1 C

C) 0 C

D) 4 C

52 / 150

Category: Chemistry

“The sum of all the exponents to which the molar concentration in terms in the rate equation are raised” defines:

NUMS Mock 2
Chemistry
Reaction Kinetics

A) Rate of reaction

B) Order of reaction

C) Type of reaction

D) Product of reaction

53 / 150

Category: Chemistry

Solid NaCl is a bad conductor of electricity because:

NUMS Mock 2
Chemistry
States of Matter – Gases, Liquids and Solids

A) Solid NaCl is covalent

B) In the solid state, there are no ions

C) In solid NaCl. there is no migration of ions

D) In solid NaCl, there are not electron

54 / 150

Category: Chemistry

A certain radioactive isotope has a half-life of 50 days. Fraction of the material left behind after 100 days will be:

NUMS Mock 2
Chemistry
Analytical Chemistry

A) 125%

B) 25%

C) 50%

D) 100%

55 / 150

Category: Chemistry

Ketones can be made by oxidation of:

NUMS Mock 2
Chemistry
Aldehydes and Ketones

A) Aldehydes

B) Primary Alcohols

C) Secondary Alcohols

D) Tertiary Alcohols

56 / 150

Category: Chemistry

The potential difference of an electrochemical cell is measured by:

NUMS Mock 2
Chemistry
Electrochemistry

A) Ammeter

B) Voltmeter

C) Galvanometer

D) Calorimeter

57 / 150

Category: Chemistry

Linear combination of atomic orbitals (LCAO) results in the formation of:

NUMS Mock 2
Chemistry
Chemical Bonding

A) Sigma bond

B) Pi bond

C) Bonding molecular orbitals only

D) Bonding and antibonding molecular orbitals

58 / 150

Category: Chemistry

Which statement is true about electron affinity?

NUMS Mock 2
Chemistry
Periodicity in Elements
Chemical Bonding

A) The value of electron affinity is always positive

B) The value of electron affinity is always negative

C) The value of first electron affinity is always positive

D) The value of first electron affinity is always negative

59 / 150

Category: Chemistry

The value of surface tension of isopropyl alcohol is?

NUMS Mock 2
Chemistry
Chemical Bonding

A) Less than water

B) Less than ethylene glycol

C) less than methyl alcohol

D) same as ethyl alcohol

60 / 150

Category: Chemistry

What is the measure of activation energy in an endothermic reaction?

NUMS Mock 2
Chemistry
Thermochemistry

A) The energy of activation of backward reaction is less than that of forward reaction

B) The energy of activation of backward reaction is more that that of forward reaction.

C) The energy of activation of forward reaction is less than that of backward reaction.

D) The energy of activation of forward – backward reaction is same.

61 / 150

Category: Chemistry

Which of the following statements is true?

NUMS Mock 2
Chemistry
s and p Block Elements

A) Alkali metal hydroxides are stable to heat except LiOH

B) CaOH is a stronger base than NaOH

C) When NaOH is made the gas released at the cathode is C12

D) NaOH is named as caustic soda because it reacts with fats to form soap.

62 / 150

Category: Chemistry

Impurities of lead in silver are removed by:

NUMS Mock 2
Chemistry
d and f Block Elements

A) Parke’s process

B) Solvay process

C) Cyanide process

D) Amalgamation process

63 / 150

Category: Chemistry

The shape of CO2 molecule is similar to:

NUMS Mock 2
Chemistry
Chemical Bonding

A) H2S

B) SO2

C) SnCl2

D) BeF2

64 / 150

Category: Chemistry

Which is the correct electronic configuration of Chromium (24Cr)?

NUMS Mock 2
Chemistry
d and f Block Elements

A) 1s2, 2s2, 3s2, 2p6, 3p6, 4s2, 3d6

B) 1s2, 2s2, 2p6, 3s2, 3p6, 4s2, 3d4

C) 1s1, 2s2, 2p6, 3s2, 3p6, 3d6

D) 1s2, 2s2, 2p6, 3s2, 3p6, 4s1, 3d5

65 / 150

Category: Chemistry

The following sketch shows the variation in a physical property of third period elements against their atomic numbers:

What physical property is plotted in this sketch?

NUMS Mock 2
Chemistry
Periodicity in Elements

A) Ionization energy

B) Melting point

C) Ionic radius

D) Atomic radius

66 / 150

Category: Chemistry

The radiations from a naturally occurring radioactive substance, as seen after deflection by a magnetic field in one direction, are:

NUMS Mock 2
Chemistry
Analytical Chemistry

A) Definitely Alpha-rays

B) Definitely Beta-rays

C) Both Alpha and Beta rays

D) Either Alpha or Beta rays

67 / 150

Category: Chemistry

Catalytic hydrogenation of alkenes exhibits:

NUMS Mock 2
Chemistry
Hydrocarbons

A) Substitution reaction

B) Elimination reaction

C) Addition reaction

D) Condensation reaction

68 / 150

Category: Chemistry

By treating CO2 with Grignard’s reagent, the following compound is obtained;

NUMS Mock 2
Chemistry
Carboxylic Acids and its Derivatives

A) Aromatic compounds

B) Alcohols

C) Carboxylic acid

D) Ethers

69 / 150

Category: Chemistry

Alkenes undergo:

NUMS Mock 2
Chemistry
Hydrocarbons

A) Electrophilic Addition

B) Electrophilic substitution

C) Nucleophilic substitution

D) Nucleophilic addition

70 / 150

Category: Chemistry

Which of the following compounds is solid at room temperature?

NUMS Mock 2
Chemistry
Alcohols, Phenols and Ethers

A) Ethanol

B) Butane

C) Methanol

D) Phenol

71 / 150

Category: Chemistry

Down the group acid-base behaviour of metallic oxides of group 2 elements changes to:

NUMS Mock 2
Chemistry
s and p Block Elements

A) More basic

B) No change

C) Less basic

D) More acidic

72 / 150

Category: Chemistry

Which of the following has the highest electrical conductivity?

NUMS Mock 2
Chemistry
Solution and Colloids

A) Aqueous sugar solution

B) Solid graphite

C) Solid sodium chloride

D) Gaseous carbon dioxide

73 / 150

Category: Chemistry

Which one of the following molecules has sp3 hybridization?

NUMS Mock 2
Chemistry
Chemical Bonding

A) CH4

B) C2H4

C) CO2

D) C2H2

74 / 150

Category: Chemistry

The isomers due to the unequal distribution of carbon atoms on either side of the functional group belonging to the same homologous series are called:

NUMS Mock 2
Chemistry
Fundamental Principles of Organic Chemistry

A) Functional isomers

B) Position isomers

C) Chain isomers

D) Metamers

75 / 150

Category: Chemistry

The amount (in liters) of Oxygen at STP that is required for the combustion of 4gm of ethylene is :

NUMS Mock 2
Chemistry
Stoichiometry

A) 96 liters

B) 9.6 liters

C) 44.8 liters

D) 7.2 liters

76 / 150

Category: Chemistry

Transition Elements usually show:

NUMS Mock 2
Chemistry
d and f Block Elements

A) Para magnetism

B) Diamagnetism

C) Ferromagnetism

D) Both Ferromagnetism and Paramagnetism

77 / 150

Category: Chemistry

Copper is a typical transition metal. Its atomic number is 29. In which oxidation state does it have a partially filled orbital in d-subshell?

NUMS Mock 2
Chemistry
d and f Block Elements

A) Cu

B) Cu+

C) Cu-

D) Cu2+

78 / 150

Category: Chemistry

Copper is a typical transition metal. Its atomic number is 29. In which oxidation state does it have a partially filled orbital in d-subshell?

NUMS Mock 2
Chemistry
d and f Block Elements

A) Cu

B) Cu+

C) Cu-

D) Cu2+

79 / 150

Category: Chemistry

Transition Elements usually show:

NUMS Mock 2
Chemistry
d and f Block Elements

A) Para magnetism

B) Diamagnetism

C) Ferromagnetism

D) Both Ferromagnetism and Paramagnetism

80 / 150

Category: Biology

Which of the following will not undergo aldol condensation?

NUMS Mock 2
Chemistry
Aldehydes and Ketones

A) Acetaldehyde

B) Propanaldehyde

C) Benzaldehyde

D) Trideuteroacetaldehyde

81 / 150

Category: Biology

Why cannot viruses replicate on their own?

NUMS Mock 2
Biology
Variety of Life

A) They are too small.

B) They have no cell wall.

C) They lack metabolic machinery.

D) All of theoptions are correct.

82 / 150

Category: Biology

Which of the following photosystems is involved in cyclic photophosphorylation?

NUMS Mock 2
Biology
Bioenergetics

A) PS II

B) PS I

C) PS I and PS II

D) PS III

83 / 150

Category: Biology

It is a method for rapid production of a very large number of copies of a particular fragment of DNA:

NUMS Mock 2
Biology
Biotechnology

A) Gel electrophoresis

B) Polymerase chain reaction

C) DNA extraction

D) Recombination

84 / 150

Category: Biology

Choose the term from the following which is NOT a part of gene therapy?

NUMS Mock 2
Biology
Biotechnology

A) Bone marrow transplant

B) Retrovirus

C) DNA Fingerprinting

D) Somatic cells

85 / 150

Category: Biology

Below the point at which the cotyledons are attached, the embryo axis is called _______.

NUMS Mock 2
Biology
Kingdom Plantae

A) Radicle

B) Epicotyl

C) Hypocotyl

D) Coleoptile

86 / 150

Category: Biology

The finger like infoldings, which are formed by inner membrane of mitochondria, are called:

NUMS Mock 2
Biology
Cell Structure and Function

A) Ribosomes

B) Matrix

C) Porin

D) Cristae

87 / 150

Category: Biology

What type of atom is the carbon atom?

NUMS Mock 2
Biology
Biological Molecules

A) Divalent

B) Monovalent

C) Trivalent

D) Tetravalent

88 / 150

Category: Biology

In the human cell, ______ is responsible for producing hydrogen peroxide.

NUMS Mock 2
Biology
Cell Structure and Function

A) Lysosomes

B) Mitochondria

C) Peroxisomes

D) Glyoxysomes

89 / 150

Category: Biology

The light dependent reaction of photosynthesis occurs in:

NUMS Mock 2
Biology
Bioenergetics

A) Stroma of chloroplast

B) Guard cells of stomata

C) Thylakoid membrane of chloroplast

D) Cytoplasm of leaf cell

90 / 150

Category: Biology

The region of the chromosome or, more specifically, the length of the DNA molecule, which has a particular function is called _______.

NUMS Mock 2
Biology
Chromosomes and DNA

A) Kinetochore

B) Locus

C) Allele

D) Gene

91 / 150

Category: Biology

The sympathetic nervous system causes which of the following?

NUMS Mock 2
Biology
Coordination and Control

A) Constriction of the pupil

B) Decreased heart rate

C) Increased gastric section

E) Increased respiration

92 / 150

Category: Biology

The causes of Cyanosis include:

NUMS Mock 2
Biology
Transport

A) Deficiency of vitamin C

B) Varicella-zoster virus

C) Degeneration of the cartilage of joints

D) Ventricular septum defect

93 / 150

Category: Biology

The hormone which controls the uptake of Sodium ions in kidney and its maintenance in blood plasma is:

NUMS Mock 2
Biology
Coordination and Control

A) Somatotrophic Hormone

B) Aldosterone Hormone

C) Gonadotrophic Hormone

D) Thyroxine Hormone

94 / 150

Category: Biology

What is the effect of enzyme DNA ligase?

NUMS Mock 2
Biology
Chromosomes and DNA

A) DNA is broken up at specific sites

B) DNA fragments are joined together

C) DNA replication occurs

D) DNA transcription occurs

95 / 150

Category: Biology

Red-green color-blindness is an X-linked recessive disorder. Jacob’s paternal grandfather and father are both color-blind, but his mother has two normal alleles. What is the probability that Jacob is red-green color-blind?

NUMS Mock 2
Biology
Variation and Genetics

A) 0%

B) 25%

C) 50%

D) 75%

96 / 150

Category: Biology

The number and sequence of amino acids along a polypeptide chain is called _______ structure of a protein.

NUMS Mock 2
Biology
Biological Molecules

A) Quaternary

B) Tertiary

C) Primary

D) Secondary

97 / 150

Category: Biology

The scientific name of thorn Apple is?

NUMS Mock 2
Biology
Kingdom Plantae

A) Sycopodium phlogmaria

B) Anthocoros fusiform

C) Ginkgo biloba

D) Datura alba

98 / 150

Category: Biology

Which processes are essential in making nitrogen from dead plant material available to growing plants?

ammonification
deamination
nitrification
nitrogen fixation
NUMS Mock 2
Biology
Man and His Enviornment

A) I, II and III only

B) I, II and IV only

C) I, III and IV only

D) II, III and IV only

99 / 150

Category: Biology

All of the followings are the effects of red light on plant, EXCEPT:

NUMS Mock 2
Biology
Growth and Development

A) Causes epicotyl (plumule) hook to unbend

B) Induces increase in leaf area

C) Elongation of internodes is promoted

D) Stimulate flowering in long day plants

100 / 150

Category: Biology

As pH of blood decreases, H+ ions increases, which combine the proteins part of hemoglobin, to decrease its ability to bind with:

NUMS Mock 2
Biology
Gaseous Exchange

A) O2

B) CO2

C) CO

D) H2

101 / 150

Category: Biology

Which of the following is not an infection of the lungs/respiratory tract?

NUMS Mock 2
Biology
Gaseous Exchange

A) Histoplasmosis

B) Tuberculosis

C) Cystic fibrosis

D) None of the given options

102 / 150

Category: Biology

In semi-conservative replication, which of the following is true regarding the separation of two strands?

NUMS Mock 2
Biology
Chromosomes and DNA

A) Primary structure is conserved, and secondary structure is disturbed

B) Secondary structure is conserved, and the primary structure is disrupted

C) both the primary and secondary structures are conserved

D) Both the primary and secondary structures are disrupted

103 / 150

Category: Biology

Which of the following blood transfusions can be made safely?

NUMS Mock 2
Biology
Variation and Genetics

A) Group A to group B

B) Group B to group AB

C) Group AB to group O

D) Group A to group O

104 / 150

Category: Biology

This theory says that “mitochondria and chloroplasts are, in effect, ancient bacteria which now live inside the larger cells”:

NUMS Mock 2
Biology
Evolution

A) Darwin’s theory of evolution

B) Lamarckism

C) Neo – darwinism

D) Endosymbiont theory

105 / 150

Category: Biology

The position of an organism in a food chain of an ecosystem called:

NUMS Mock 2
Biology
Man and His Environment

A) Level of ecosystem

B) Food chain

C) Food web

D) Trophic level

106 / 150

Category: Biology

Four plants are present in different environmental conditions. Plant A is present in a warm climate with continuous rainfall, plant B is present in a cool forest, plant C is present in a warm climate with little breeze, while plant D is present in a warm climate with high wind speed. Which one of the above plants will have the highest rate of transpiration?

NUMS Mock 2
Biology
Gaseous Exchange

A) Plant B

B) Plant D

C) Plant A

D) Plant C

107 / 150

Category: Biology

Which of the following is correct in case of active membrane potential?

NUMS Mock 2
Biology

A) Extra cellular sodium is high

B) Extra cellular potassium is high

C) Intracellular sodium is high

D) Intracellular potassium is less

108 / 150

Category: Biology

The branch of science dealing with the fossil record is called:

NUMS Mock 2
Biology
Biology and its Major Fields of Specialization

A) Genetics

B) Taxonomy

C) Archeology

D) Palentology

109 / 150

Category: Biology

5 different amino acids, numbered 1, 2, 3, 4, and 5, below from the following sequence in the path of a polypeptide chain:

1-2-3-4-2-5-3

Messenger RNA codon, which correspond to the amino acids, are:
amino acid 1 UGU

amino acid 2 GAU

amino acid 3 CAC

amino acid 4 UAG

amino acid 5 AAG

Which one of the following DNA bases sequences could provide the code for the given section of the polypeptide?

NUMS Mock 2
Biology
Biological Molecules

A) ACACTTGTGATGCTATTCGTG

B) ACACUAGUGAUGCUAUUCGUG

C) ACACTAGTGATGCTAAACGTG

D) ACACTAGTGATCCTATTCGTG

110 / 150

Category: Biology

Process ensuring the survival of species over long periods of time, even though individual members of the species die.

NUMS Mock 2
Biology
Man and His Environment

A) Reproduction

B) Adaptability

C) Mitosis

D) Respiration

111 / 150

Category: Biology

An example of competitive inhibition of an enzyme is the inhibition of;

NUMS Mock 2
Biology
Enzymes

A) Succinic dehydrogenase by malonic acid

B) Cytochrome oxidase by cyanide

C) Hexokinase by glucose

D) Carbonic anhydrase by carbon dioxide

112 / 150

Category: Biology

It is the smallest eukaryote:

NUMS Mock 2
Biology
Kingdom Protista

A) Virus

B) Bacteria

C) Plasmodium

D) Sponge

113 / 150

Category: Biology

Phenylketonuria is

NUMS Mock 2
Biology
Chromosomes and DNA

A) Sex linked dominant trait

B) Sex linked recessive trait

C) Autosomal dominant trait

D) Autosomal recessive trait

114 / 150

Category: Biology

According to the theory of natural selection, organisms produce:

NUMS Mock 2
Biology
Evolution

A) Offspring according to the resources available

B) Offspring to create resources

C) To create resources

D) More offspring than supported

115 / 150

Category: Biology

There existed two varieties of female freshwater Mollusks in which some were streamlined and some had a high bulge. Over the generations, male freshwater Mollusks learned that high bulge favors more production of offspring. So they started preferring to mate with females having high bulge as compared to streamlined. Will this affect Hardy Weinberg Equilibrium in the population?

NUMS Mock 2
Biology
Evolution

A) No, it will not affect the Hardy Weinberg equilibrium

B) Yes, it will affect the Hardy Weinberg equilibrium

C) It will help to balance equilibrium

D) The Hardy Weinberg equilibrium doesn't apply here

116 / 150

Category: Biology

Which trait is not sex-linked recessive:

NUMS Mock 2
Biology
Variation and Genetics

A) Haemophilia

B) Colour blindness

C) Hypophosphatemia

D) TFM syndrome

117 / 150

Category: Biology

Select a method which causes the oxidation of chemical constituent of a bacterial cell:

NUMS Mock 2
Biology
Kingdom Prokaryote

A) Steam

B) Dry heat

C) Filtration

D) Radiation

118 / 150

Category: Biology

The structure of a fibrous protein comprises of polypeptide chains in the form of:

NUMS Mock 2
Biology
Biological Molecules

A) Cluster

B) Spherical or curried up ball

C) Long strands or fibrils

D) Flat uncoiled chains

119 / 150

Category: Biology

As an essential element in living organisms, _______ ion is playing an important role in insulin secretion, the release of neurotransmitters, muscle contraction, and heartbeat regulation.

NUMS Mock 2
Biology
Coordination and Control

A) Sodium

B) Potassium

C) Calcium

D) Chloride

120 / 150

Category: Biology

Which vertebrae together are called pelvic vertebrae?

NUMS Mock 2
Biology
Support and Movement

A) Coccygeal and lumbar

B) Sacral and lumbar

C) Sacral and coccygeal

D) Sacral and thoracic

121 / 150

Category: Biology

When were bacteriophages discovered by Twort?

NUMS Mock 2
Biology
Bio-diversity | Variety of Life
Variety of Life

A) 1915

B) 1920

C) 1910

D) 1820

122 / 150

Category: Biology

Which of the following occurs in the body in response to the secretion of Glucagon?

NUMS Mock 2
Biology
Homeostasis

A) Conversion of glucose to glycogen in liver cells

B) Decrease in blood glucose concentration

C) Increased uptake of glucose by muscle cells

D) Production of cyclic AMP in target cells

123 / 150

Category: Biology

Which of the following basic structural level of proteins is indicated by an association of two alpha and two beta chains in the haemoglobin molecule?

NUMS Mock 2
Biology
Biological Molecules

A) Primary structure

B) Secondary structure

C) Tertiary structure

D) Quatenary Structure

124 / 150

Category: Biology

Optimum pH for action of pepsin and salivary amylase is

NUMS Mock 2
Biology
Nutrition

A) 3.5 and 7.7 respectively

B) 1.8 and 6.8 respectively

C) 6.8 and 7.4 respectively

D) 1.8 and 7.4 respectively

125 / 150

Category: Biology

The system involved in preparing our body in condition of stress and emergency:

NUMS Mock 2
Biology
Coordination and Control

A) Nervous system only

B) Endocrine system only

C) Both nervous & endocrine system

D) Both endocrine & exocrine

126 / 150

Category: Biology

In cross-section each Centriole consist of nine (each in triplets) of:

NUMS Mock 2
Biology
Cell Structure and Function

A) Microfilaments

B) Microvilli

C) Microtubules

D) Intermediate filaments

127 / 150

Category: Biology

Which of the following processes does NOT need Pyruvic Acid as a substrate?

NUMS Mock 2
Biology
Bioenergetics

A) Alcoholic fermentation

B) Calvin cycle

C) Aerobic respiration

D) Lactic Acid fermentation

128 / 150

Category: Biology

Cardiac output is increased by all of the following EXCEPT:

NUMS Mock 2
Biology
Transport

A) Hypoxia

B) Exercise

C) Sleep

D) Pregnancy

129 / 150

Category: Biology

Which of the following, which is the incorrectly paired one?

NUMS Mock 2
Biology
Biology and its Major Fields of Specialization

B) Schlelden and schwann … cell theory

C) Robert Brown… nucleus

D) Watson and Crick … DNA model

E) Virchow… mosaic model of plasma membrane

130 / 150

Category: Biology

Germ layers are formed in which stage of development?

NUMS Mock 2
Biology
Growth and Development

A) Morulation

B) Blastulation

C) Gastrulation

D) Organogenesis

131 / 150

Category: Biology

Erythroblastosis foetalis occurs when:

NUMS Mock 2
Biology
Variation and Genetics

A) Mother is Rh-positive and baby is Rh-negative

B) Mother is Rh-negative and the baby is Rh-positive

C) Both mother and baby are Rh-negative

D) Both mother and baby are Rh-positive

132 / 150

Category: Biology

In which of the following phases of bacterial growth, is the death rate more rapid than the multiplication rate?

NUMS Mock 2
Biology
Kingdom Prokaryote

A) Stationary phase

B) LAG phase

C) Decline phase

D) LOG phase

133 / 150

Category: Biology

What part of the brain integrates sensory information such as pain and temperature?

NUMS Mock 2
Biology
Coordination and Control

A) Forebrain

B) Midbrain

C) Hindbrain

D) Spinal cord

134 / 150

Category: Biology

Bones of the skull are joined by:

NUMS Mock 2
Biology
Support and Movement

A) Fixed joints

B) Sliding joints

C) Pivot joints

D) Hinge joints

135 / 150

Category: Biology

They serve as a scaffold for formation of higher order chromatin structure:

NUMS Mock 2
Biology
Cell Structure and Function

A) Nucleosome

B) Nucleus

C) Chromosomes

D) Histones

136 / 150

Category: English

Choose the nearest meaning to the following word:

Relinquish

NUMS Mock 2
English
Key Vocabulary

A) Use

B) Surrender

C) Increase

D) Retain

137 / 150

Category: English

Select the nearest correct meaning of the given word:

DERACINATE

NUMS Mock 2
English
Key Vocabulary

A) Inculcate

B) Incarnate

C) Pull up

D) Send for

138 / 150

Category: English

In the following question, four alternative sentences are given. Choose the CORRECT one.

NUMS Mock 2
English
Grammar and Punctuation

A) I leaned over the parapet and looked down.

B) I leaned at the parapet and looked down.

C) I leaned against the parapet and looked down.

D) I leaned down the parapet and looked down.

139 / 150

Category: English

Select the nearest correct meaning of the given word:

CHURN:

NUMS Mock 2
English
Key Vocabulary

A) Freeze

B) Gum

C) Overcast

D) Froth

140 / 150

Category: English

Antonym of Adapt will be:

NUMS Mock 2
English
Key Vocabulary

A) Approve

B) Applaud

C) Shed

D) Reject

141 / 150

Category: English

Select the best word to complete the sentence.

The ant marched quickly back to ____ home.

NUMS Mock 2
English
Fill in the blank

A) Its

B) It's

C) Their

D) its'

142 / 150

Category: English

In the following question, four alternative sentences are given. Choose the CORRECT one.

NUMS Mock 2
English
Grammar and Punctuation

A) A common cause of failure is a mistaking ambition for the boy on the part of the parents.

B) A common cause of failure is a mistaken ambition for the boy on the part of parents.

C) A common cause of failure is a mistake ambition for the boy on the part of the parents.

D) A common causes of failure is a mistake ambition for the boy on the part of the parents.

143 / 150

Category: English

They sometimes feel a _____ for the mountains and the sea.

NUMS Mock 2
English
Fill in the blank

A) Yearning

B) Yapping

C) Yelling

D) Yielding

144 / 150

Category: English

Last Saturday my father _____ (take) my friends and me to the circus.

NUMS Mock 2
English

A) Take

B) Took

C) Will take

D) Has taken

145 / 150

Category: English

A successful businessman is _______ of the risks.

NUMS Mock 2
English
Fill in the blank

A) Audacious

B) Agoraphobic

C) Dismay

D) Coerce

146 / 150

Category: English

What type of sentence is this?

Our car broke down, so we came last.

NUMS Mock 2
English
Tenses and Sentence Structure

A) Complex

B) Simple

C) Compound

D) Compound-complex

147 / 150

Category: English

Choose the correct answer:

NUMS Mock 2
English
Grammar and Punctuation

A) A friend of him told us the sad news of his father’s demise.

B) Friend of him told us the sad news of his father’s demise.

C) A friend of his told us the sad news of his father’s demise.

D) A friend of him told the sad news of his father’s demise.

148 / 150

Category: English

Choose the correct sentence:

NUMS Mock 2
English
Tenses and Sentence Structure

A) Does your train leave before eight o'clock?

B) Do your train leave before eight o'clock?

C) Does your train leaves before eight o'clock

D) Does your train leave before eight oclock?

149 / 150

Category: English

Complete the sentences by choosing the most appropriate option, from the given lettered choices (A to D) below each.

He composed a great many pieces _____ music in his life time.

NUMS Mock 2
English

A) Too

B) Of

C) At

D) In

150 / 150

Category: English

Demonstrate the correct use of subject-verb agreement:
He was ____ in the rain then.

NUMS Mock 2
English
Fill in the blank
Elimination Tool:

A) Enjoys

B) Enjoying

C) Enjoy

D) Will enjoy

Your score is

The average score is 55%

0%

LearnoSpot by PLS

PLS Boost Bundle

One response to “NUMS Mock Test 2”